The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	40268	121518	7241575	transposase,plate	Dishui_lake_phycodnavirus(20.0%)	59	NA	NA
WP_004423958.1|40268_41540_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_003097345.1|41856_42072_+	dodecin family protein	NA	NA	NA	NA	NA
WP_003097347.1|42255_42483_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_023124886.1|42778_44467_+	two-partner secretion system transporter TpsB2	NA	NA	NA	NA	NA
WP_085286921.1|44579_56174_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023874766.1|56174_56687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809523.1|56911_57118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252823.1|61909_62602_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023124795.1|62728_63322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019485604.1|63912_64230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|64830_65226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003128157.1|65490_66873_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003111705.1|67064_68438_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003111706.1|68933_69620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083569.1|69650_70004_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|70000_70666_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003128160.1|70680_71064_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003083582.1|73615_73756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003128169.1|74580_76413_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	6.0e-17
WP_003083588.1|76465_76894_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003128172.1|77102_77651_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.0	4.0e-33
WP_003083593.1|77689_78196_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003128174.1|78261_79182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|79289_80177_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003128176.1|80239_80944_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|81027_81483_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003122274.1|81593_81827_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|81838_82276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|82332_82749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|82840_83968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114660.1|83975_84959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015502122.1|84991_85657_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003128183.1|85649_86192_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|86269_88315_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|88311_88587_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_123809159.1|89437_90310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087921017.1|90391_92314_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_087920857.1|92310_92685_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_087920858.1|92965_94567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003128185.1|95672_96587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003128187.1|96648_98361_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003128189.1|98353_99553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003128191.1|99552_100272_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	5.6e-19
WP_023094469.1|100268_103367_-	protein kinase	NA	M1PCM5	Moumouvirus	27.8	2.5e-23
WP_003083639.1|103374_104103_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|104112_104793_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_023092244.1|104789_108329_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003115051.1|108325_109675_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|109681_111016_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003128248.1|111031_111496_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_087920859.1|111540_113046_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_003111627.1|113413_114448_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|114536_115055_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104973.1|115067_116564_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|116639_117128_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|117295_118141_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111625.1|118142_118652_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003128254.1|118648_120508_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003128256.1|120471_121518_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	795381	826470	7241575	holin,tail,plate	Pseudomonas_phage(46.67%)	36	NA	NA
WP_003113202.1|795381_796152_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|796609_796810_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|796857_797217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129208.1|797579_798029_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|798050_798566_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003129209.1|798562_799120_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.9	1.7e-44
WP_003085143.1|799272_799599_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|799595_800483_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003129210.1|800475_801009_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	6.7e-62
WP_003129211.1|801010_803119_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|803127_803568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|803610_804771_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003129212.1|804783_805287_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|805301_805646_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003129213.1|805815_808053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|808062_808935_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|808909_809116_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003129214.1|809173_810163_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	6.3e-106
WP_003129215.1|810195_810825_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003129216.1|810821_811184_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	5.5e-15
WP_003118919.1|811180_811438_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|811753_812248_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|812259_812607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|812636_812891_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003129218.1|812937_814776_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|814768_815110_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|815117_815813_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|815815_816586_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003129220.1|817300_820954_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.3	0.0e+00
WP_023094500.1|821222_821927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129221.1|821939_823040_+	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.6e-116
WP_023094501.1|823039_823351_+	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	84.5	4.8e-44
WP_003129222.1|823347_823575_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
WP_003129224.1|823980_824586_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|824587_825637_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003129225.1|825633_826470_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.6e-70
>prophage 3
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	1593493	1602519	7241575		Bacillus_phage(33.33%)	7	NA	NA
WP_003098558.1|1593493_1594129_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_157737733.1|1594218_1595067_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	2.9e-06
WP_003113871.1|1595171_1596176_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1596601_1596925_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003113873.1|1596991_1599559_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003129950.1|1600838_1601345_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003092260.1|1601478_1602519_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	1691455	1737279	7241575	head,integrase,capsid,portal,protease,terminase,holin,tail	Pseudomonas_phage(80.7%)	66	1682740:1682758	1741820:1741838
1682740:1682758	attL	GCCGCCGGTATCGACGGCC	NA	NA	NA	NA
WP_003110461.1|1691455_1692766_-	GDP-mannose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	29.6	1.1e-36
WP_003092094.1|1693668_1694448_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003092092.1|1694554_1695637_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_003092090.1|1695641_1696559_-	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	27.6	2.0e-21
WP_034069868.1|1696740_1697907_-|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	97.9	2.0e-220
WP_034069866.1|1698300_1698618_-	hypothetical protein	NA	A0A0U4JNZ9	Pseudomonas_phage	90.5	6.6e-49
WP_023118159.1|1698662_1698866_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	86.6	3.1e-28
WP_034069863.1|1698862_1699201_-	hypothetical protein	NA	A0A0U3TGW4	Pseudomonas_phage	65.0	2.5e-38
WP_023109419.1|1699193_1699577_-	hypothetical protein	NA	A0A2H5BQE7	Pseudomonas_phage	96.8	9.6e-10
WP_087920870.1|1699569_1701138_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	73.9	8.0e-71
WP_003124822.1|1701134_1701341_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	87.0	4.2e-28
WP_087920871.1|1701304_1701553_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	95.1	2.8e-39
WP_087920872.1|1701635_1701986_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	89.7	1.3e-58
WP_087920873.1|1702043_1702580_-	DUF4406 domain-containing protein	NA	A0A0U4IBL4	Pseudomonas_phage	96.0	2.6e-98
WP_087920874.1|1702576_1704001_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	48.9	3.0e-109
WP_087920875.1|1703997_1704375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003105586.1|1704441_1704744_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	96.0	1.1e-40
WP_087920876.1|1704743_1705418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047689520.1|1705631_1705880_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	90.2	5.5e-35
WP_034005692.1|1705890_1706277_-	LuxR family transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	98.4	4.0e-64
WP_087920877.1|1706481_1707351_-	hypothetical protein	NA	A0A1B0YZX8	Pseudomonas_phage	89.9	6.3e-142
WP_087920878.1|1707340_1708051_-	transcription elongation protein SprT	NA	A0A088FRV0	Escherichia_phage	47.8	1.5e-53
WP_123809179.1|1708324_1708507_-	hypothetical protein	NA	W6MYA9	Pseudomonas_phage	100.0	7.2e-32
WP_012613693.1|1709279_1709534_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	69.5	4.8e-26
WP_023101754.1|1709586_1709925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031642139.1|1709942_1710236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920879.1|1710348_1711104_-	helix-turn-helix transcriptional regulator	NA	L7TH81	Pseudomonas_virus	73.6	6.4e-74
WP_087920880.1|1711700_1712462_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	98.4	3.0e-95
WP_087920881.1|1712458_1713142_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	89.9	9.7e-114
WP_042854195.1|1713138_1713345_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	4.5e-30
WP_042854197.1|1713341_1713923_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	99.5	2.2e-106
WP_087920882.1|1713919_1714216_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	85.7	3.3e-42
WP_087920883.1|1714253_1714928_+	hypothetical protein	NA	A0A1B0YZZ3	Pseudomonas_phage	98.7	1.3e-118
WP_087920884.1|1715122_1715662_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	83.8	3.7e-76
WP_087920885.1|1715841_1716177_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	99.1	8.2e-58
WP_087920886.1|1716173_1716791_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	91.2	5.7e-105
WP_042854199.1|1716760_1717240_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.3e-51
WP_020989244.1|1717409_1717751_+	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	97.3	2.6e-59
WP_087920887.1|1717880_1718291_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_087921018.1|1718283_1720044_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	95.2	0.0e+00
WP_079993109.1|1720203_1721538_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	54.9	6.9e-132
WP_031801614.1|1721537_1722236_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.8	7.4e-69
WP_031801613.1|1722247_1723504_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	49.5	8.3e-95
WP_058168663.1|1723550_1723769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031801611.1|1723772_1723952_+	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	71.2	1.2e-15
WP_031801610.1|1723962_1724295_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JEH2	Pseudomonas_phage	83.6	3.9e-44
WP_031801609.1|1724295_1724847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087920889.1|1724843_1725437_+	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	3.7e-101
WP_023092524.1|1725449_1725887_+	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	95.9	2.0e-72
WP_087920890.1|1725910_1726696_+	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	96.2	7.4e-142
WP_087920891.1|1726751_1727117_+	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	97.5	1.2e-57
WP_003098505.1|1727161_1727311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034083369.1|1727300_1729442_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	99.4	0.0e+00
WP_023118122.1|1729451_1729955_+	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	99.4	9.1e-93
WP_087920892.1|1729956_1731660_+	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	96.3	0.0e+00
WP_023103823.1|1731662_1732073_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	94.1	4.7e-55
WP_046094892.1|1732072_1732615_+	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	95.6	1.3e-92
WP_087920893.1|1732627_1733050_+	hypothetical protein	NA	A0A1B0YZV1	Pseudomonas_phage	97.1	1.0e-68
WP_087920894.1|1733036_1734530_+	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	99.0	1.8e-285
WP_023103658.1|1734551_1735139_+	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	91.8	5.3e-100
WP_023110598.1|1735131_1735323_+	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	98.4	3.5e-29
WP_087920895.1|1735325_1735886_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	97.3	1.0e-97
WP_003159084.1|1735885_1736167_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
WP_003159085.1|1736159_1736723_+	hypothetical protein	NA	A0A0A0YRS1	Pseudomonas_phage	98.4	3.3e-99
WP_023124666.1|1736722_1737025_+	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	88.0	2.2e-41
WP_087920896.1|1737021_1737279_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	97.3	1.8e-33
1741820:1741838	attR	GGCCGTCGATACCGGCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	2654567	2688339	7241575	integrase,transposase,protease	Acinetobacter_phage(20.0%)	35	2672163:2672177	2691827:2691841
WP_003090808.1|2654567_2655038_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003090806.1|2655386_2655617_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_003090804.1|2655795_2655993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090802.1|2656058_2656388_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003090800.1|2656498_2656873_-	DUF5064 family protein	NA	NA	NA	NA	NA
WP_003131004.1|2657008_2657452_+	DedA family protein	NA	NA	NA	NA	NA
WP_023094653.1|2657604_2657922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090797.1|2657911_2658811_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003090796.1|2659033_2659267_+	DUF3509 domain-containing protein	NA	NA	NA	NA	NA
WP_003090795.1|2659332_2659563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090794.1|2659537_2660056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920908.1|2660650_2661790_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534604.1|2661792_2663454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090790.1|2663453_2665328_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_034082648.1|2665320_2665728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098552.1|2666115_2667222_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_086005596.1|2667684_2668698_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003154856.1|2668773_2669913_+	peptidase S1	NA	W5SAB9	Pithovirus	32.4	1.1e-05
WP_003154854.1|2669981_2671109_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	6.7e-27
WP_003090785.1|2671098_2671857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090784.1|2671849_2672944_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	8.2e-38
2672163:2672177	attL	GCGCCGGCCTTCCCC	NA	NA	NA	NA
WP_003090783.1|2672943_2673891_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_023098554.1|2673890_2674619_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_087920909.1|2674621_2675215_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	37.4	2.4e-23
WP_087920910.1|2675211_2676402_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_003090780.1|2676449_2676899_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003090778.1|2676911_2677946_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	45.9	6.5e-69
WP_087920911.1|2677974_2678553_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	8.7e-31
WP_087920912.1|2678588_2679167_+	TerD family protein	NA	NA	NA	NA	NA
WP_087920913.1|2679543_2680875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023104035.1|2680985_2682179_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_077565896.1|2682404_2683424_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.1e-36
WP_003090772.1|2683420_2686387_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.8	0.0e+00
WP_003090771.1|2686390_2686951_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
WP_000845048.1|2687325_2688339_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2691827:2691841	attR	GGGGAAGGCCGGCGC	NA	NA	NA	NA
>prophage 6
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	2871105	2877999	7241575	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2871105_2872386_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003131135.1|2872387_2873785_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003108775.1|2873789_2874764_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2874851_2875835_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2875831_2876167_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2876163_2876469_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2876468_2876828_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2876824_2877220_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2877330_2877999_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 7
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	2996136	3048971	7241575	head,holin,integrase,terminase	Pseudomonas_phage(77.19%)	63	2999963:3000022	3049200:3049291
WP_023094666.1|2996136_2999022_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.9e-33
WP_003090076.1|2999112_2999646_+	hypothetical protein	NA	NA	NA	NA	NA
2999963:3000022	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_023094667.1|3000108_3001146_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	2.8e-112
WP_003158549.1|3001174_3001408_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_003130970.1|3001684_3002164_-	hypothetical protein	NA	I6NVL3	Burkholderia_virus	55.3	3.6e-22
WP_003131143.1|3003541_3004048_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	95.8	1.2e-87
WP_003126885.1|3004044_3004410_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	97.3	3.0e-61
WP_003126887.1|3004406_3004967_-	hypothetical protein	NA	H2BD41	Pseudomonas_phage	93.7	3.8e-100
WP_003126888.1|3004963_3005590_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	58.8	8.7e-61
WP_108116075.1|3005784_3005886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126889.1|3005976_3006471_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	95.1	5.4e-74
WP_153549535.1|3008266_3008593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003126892.1|3008763_3009477_-	DNA exonuclease	NA	A0A059VJT9	Pseudomonas_phage	47.3	7.2e-51
WP_003131149.1|3009526_3011269_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	92.7	2.3e-284
WP_023103950.1|3011268_3011856_-	hypothetical protein	NA	A0A2I7RT07	Vibrio_phage	39.9	6.8e-23
WP_003126905.1|3011859_3012624_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.8	6.0e-104
WP_003116739.1|3012636_3012837_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_003126907.1|3012843_3013734_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	9.1e-104
WP_023094674.1|3013746_3014655_-	hypothetical protein	NA	Q858E0	Salmonella_phage	71.6	2.1e-124
WP_010793152.1|3014665_3014875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|3014871_3015093_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003131166.1|3015746_3016118_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	80.5	8.3e-51
WP_003126916.1|3016153_3016366_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	95.7	2.0e-33
WP_071536250.1|3018436_3018925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023094678.1|3018971_3019637_-	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	41.5	3.5e-44
WP_023103954.1|3020182_3020695_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	97.1	9.0e-88
WP_003136886.1|3020777_3021350_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	4.6e-101
WP_023094680.1|3021340_3021592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016263332.1|3021629_3021812_+	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	100.0	4.5e-26
WP_031632346.1|3021804_3022326_+	HNH endonuclease	NA	Q7Y3U9	Yersinia_phage	39.7	3.9e-06
WP_023094681.1|3022325_3023174_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	97.8	1.1e-74
WP_016263334.1|3023166_3024582_+	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.4	2.6e-262
WP_023094682.1|3024574_3025018_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	1.4e-76
WP_023094683.1|3025046_3025916_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	99.0	4.8e-166
WP_023124722.1|3026030_3026420_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	97.7	2.4e-61
WP_016852757.1|3026412_3026697_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	97.9	5.9e-41
WP_003131202.1|3026705_3027248_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	98.3	5.0e-97
WP_023094684.1|3027231_3028485_+|terminase	PBSX family phage terminase large subunit	terminase	J7I4J3	Pseudomonas_phage	99.8	2.9e-249
WP_016852759.1|3028484_3028682_+	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	5.2e-28
WP_003127999.1|3028684_3030055_+	DUF1073 domain-containing protein	NA	J7I414	Pseudomonas_phage	99.3	4.0e-268
WP_031632796.1|3030011_3030941_+|head	SPP1 gp7 family phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	99.0	3.4e-170
WP_023094686.1|3030944_3032222_+	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.3	2.4e-214
WP_023094687.1|3032225_3032675_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.6e-77
WP_003127996.1|3032690_3033785_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	98.9	7.0e-207
WP_003127995.1|3033795_3034260_+	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	77.0	2.7e-51
WP_003131204.1|3034333_3034735_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.0	2.3e-70
WP_023094688.1|3034731_3035070_+	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	8.0e-61
WP_023124723.1|3035071_3035476_+	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	99.3	2.1e-68
WP_003127992.1|3035472_3035847_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_023094689.1|3035861_3036857_+	hypothetical protein	NA	J7HX84	Pseudomonas_phage	93.1	1.8e-156
WP_023094690.1|3036853_3037471_+	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.5	1.3e-112
WP_023124724.1|3037470_3039969_+	tape measure protein	NA	J7HXG0	Pseudomonas_phage	98.1	0.0e+00
WP_023094692.1|3039965_3040433_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.1	9.3e-92
WP_023094693.1|3040416_3040908_+	DUF1833 domain-containing protein	NA	J7I404	Pseudomonas_phage	96.3	1.1e-87
WP_003131216.1|3040912_3041320_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	95.6	7.1e-72
WP_023094694.1|3041291_3044015_+	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	83.8	0.0e+00
WP_023124725.1|3044075_3046133_+	hypothetical protein	NA	A0A127KNR5	Pseudomonas_phage	91.8	0.0e+00
WP_031690640.1|3046199_3046829_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	94.7	9.3e-111
WP_003088479.1|3046825_3047194_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.0	2.3e-45
WP_023094697.1|3047190_3047454_+	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	91.9	5.3e-36
WP_023094698.1|3047489_3047753_+	hypothetical protein	NA	J7I447	Pseudomonas_phage	94.3	2.9e-42
WP_023094699.1|3047734_3048421_-	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	89.9	8.8e-123
WP_023094700.1|3048458_3048971_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	89.9	1.2e-89
3049200:3049291	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAGTGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 8
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	4217047	4221298	7241575	holin	Pseudomonas_phage(62.5%)	8	NA	NA
WP_087920972.1|4217047_4217563_+	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	94.1	1.3e-94
WP_087920973.1|4217858_4218548_+	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	87.3	2.1e-116
WP_009314099.1|4218529_4218796_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.4e-44
WP_087920974.1|4218833_4219328_-	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	95.8	2.6e-84
WP_087920975.1|4219404_4219998_-	DUF1737 domain-containing protein	NA	L7TKV3	Pseudomonas_virus	95.4	3.0e-71
WP_010793289.1|4220008_4220527_-	hypothetical protein	NA	A0A0U1UNS0	Pseudomonas_phage	96.5	1.9e-69
WP_010793290.1|4220523_4221057_-	glycoside hydrolase family protein	NA	A0A0U1UNS2	Pseudomonas_phage	99.4	1.9e-101
WP_033944880.1|4221040_4221298_-|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	98.8	2.8e-37
>prophage 9
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	4245684	4285329	7241575	integrase,tRNA,terminase	Pseudomonas_phage(67.39%)	51	4236614:4236630	4285371:4285387
4236614:4236630	attL	GATGTCCGGGCGTTCCG	NA	NA	NA	NA
WP_058134973.1|4245684_4246536_-	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	61.1	1.8e-93
WP_087920980.1|4246543_4246900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920981.1|4246906_4247869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058135002.1|4247865_4248186_-	hypothetical protein	NA	A0A0U1VZM2	Pseudomonas_phage	80.2	1.0e-44
WP_058134977.1|4248193_4248598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349209.1|4248614_4249022_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_004349207.1|4249002_4249209_-	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_019486219.1|4249205_4249883_-	hypothetical protein	NA	L7TH94	Pseudomonas_virus	99.1	1.7e-131
WP_087920982.1|4249879_4250752_-	hypothetical protein	NA	L7TJQ0	Pseudomonas_virus	99.0	2.6e-164
WP_016263604.1|4250816_4251296_-	hypothetical protein	NA	L7TP37	Pseudomonas_virus	100.0	6.4e-80
WP_010793303.1|4251354_4252647_-	DUF4043 family protein	NA	L7TIC0	Pseudomonas_virus	100.0	5.0e-252
WP_094742822.1|4252659_4253790_-	hypothetical protein	NA	L7TKT3	Pseudomonas_virus	99.7	1.3e-176
WP_087920984.1|4253936_4256255_-	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.6	0.0e+00
WP_087920985.1|4256264_4257548_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	7.1e-259
WP_023443626.1|4257544_4258111_-	hypothetical protein	NA	L7TIB4	Pseudomonas_virus	97.3	1.1e-97
WP_015975447.1|4258161_4258656_-	hypothetical protein	NA	A0A2K8I380	Pseudomonas_phage	100.0	1.7e-83
WP_052013852.1|4258655_4258955_-	DUF1064 domain-containing protein	NA	A0A2K8HVS3	Pseudomonas_phage	100.0	1.9e-53
WP_015975445.1|4258999_4259320_-	DUF1364 family protein	NA	A0A2K8HR56	Pseudomonas_phage	100.0	2.1e-55
WP_010793309.1|4259319_4259871_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	100.0	7.6e-101
WP_087920986.1|4259863_4260721_-	hypothetical protein	NA	Q5QF86	Pseudomonas_virus	99.3	2.2e-147
WP_010793311.1|4260707_4261724_-	hypothetical protein	NA	A0A0U1UNR4	Pseudomonas_phage	100.0	5.6e-150
WP_004349179.1|4261725_4261926_-	Cro/Cl family transcriptional regulator	NA	A0A2K8HL98	Pseudomonas_phage	100.0	1.8e-28
WP_015975417.1|4262033_4262831_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	100.0	1.9e-148
WP_004349174.1|4262867_4263134_-	DUF1654 domain-containing protein	NA	A0A2K8HZW3	Pseudomonas_phage	100.0	2.3e-42
WP_031642910.1|4263767_4263983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015975440.1|4264045_4264258_+	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	100.0	4.0e-34
WP_004354960.1|4264292_4264664_+	carbon storage regulator CsrA	NA	A0A0U1UNS3	Pseudomonas_phage	100.0	2.7e-62
WP_087920987.1|4264806_4265310_+	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	96.4	1.8e-96
WP_015975438.1|4265306_4265456_+	hypothetical protein	NA	A0A0U1T4N1	Pseudomonas_phage	100.0	2.5e-14
WP_004354968.1|4265439_4265661_+	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	100.0	2.2e-35
WP_033944860.1|4265657_4266029_+	hypothetical protein	NA	A0A0U1VZL6	Pseudomonas_phage	100.0	8.8e-61
WP_015975436.1|4266290_4267046_+	hypothetical protein	NA	A0A0U1UNQ9	Pseudomonas_phage	100.0	5.3e-145
WP_015975435.1|4267050_4268067_+	hypothetical protein	NA	A0A0U1UNR0	Pseudomonas_phage	100.0	7.7e-123
WP_015975434.1|4268114_4268669_+	hypothetical protein	NA	Q5QF94	Pseudomonas_virus	100.0	1.1e-110
WP_004349164.1|4268777_4269383_+	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	100.0	7.3e-113
WP_033944857.1|4269386_4269902_+	single-stranded DNA-binding protein	NA	A0A0U1VYM4	Pseudomonas_phage	87.1	1.8e-75
WP_087920988.1|4269928_4271155_+	recombination-associated protein RdgC	NA	A0A0U1SXS1	Pseudomonas_phage	96.1	6.3e-164
WP_073660059.1|4271172_4271361_+	hypothetical protein	NA	A0A0U1UNR9	Pseudomonas_phage	98.4	3.2e-27
WP_087920989.1|4271473_4272754_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	51.4	1.4e-92
WP_087920990.1|4272750_4274748_+	DNA cytosine methyltransferase	NA	J7HXB9	Pseudomonas_phage	94.0	0.0e+00
WP_034072435.1|4274933_4275299_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	95.5	3.3e-60
WP_087920991.1|4275295_4275802_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	96.4	8.8e-88
WP_079392340.1|4275899_4277039_+	hypothetical protein	NA	A0A127KN88	Pseudomonas_phage	90.1	2.2e-118
WP_016263636.1|4277040_4277424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396707.1|4277416_4277995_+	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	89.4	6.2e-69
WP_016263640.1|4278480_4278714_+	AlpA family phage regulatory protein	NA	H2BDA4	Pseudomonas_phage	94.8	3.5e-39
WP_058180503.1|4278714_4279950_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q5QF66	Pseudomonas_virus	99.5	1.5e-234
WP_003087898.1|4280734_4281589_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
WP_003113587.1|4281646_4283029_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_003113586.1|4283038_4284709_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.5	4.8e-199
WP_003087890.1|4284831_4285329_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
4285371:4285387	attR	CGGAACGCCCGGACATC	NA	NA	NA	NA
>prophage 10
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	4981795	5031486	7241575	integrase,transposase,tRNA	Bacillus_phage(13.33%)	43	5014992:5015051	5031532:5031636
WP_003086553.1|4981795_4982608_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.3	1.4e-13
WP_003133834.1|4982819_4985429_+	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	26.8	1.1e-16
WP_003109062.1|4985543_4986695_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003101808.1|4986694_4987498_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003082373.1|4987515_4987899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003082372.1|4988004_4988214_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.1	2.0e-14
WP_003082362.1|4988533_4989892_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.3	7.8e-14
WP_003133838.1|4990232_4990943_-	response regulator	NA	W8CYM9	Bacillus_phage	33.9	3.3e-32
WP_003082358.1|4991675_4994567_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.3	9.9e-184
WP_044059624.1|4994758_4995964_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_044059625.1|4995956_4997417_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_034065454.1|4997409_4999521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396225.1|4999521_4999932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009957.1|5000569_5000935_-	mCpol domain-containing protein	NA	NA	NA	NA	NA
WP_034065451.1|5001338_5003321_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	2.7e-31
WP_023109451.1|5003317_5004685_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087920997.1|5004685_5007889_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_034065447.1|5007920_5008142_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015648372.1|5008244_5008835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034065443.1|5008831_5010232_+	AAA family ATPase	NA	I4AZM6	Saccharomonospora_phage	32.5	5.0e-40
WP_000429836.1|5010391_5010826_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|5010897_5011248_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|5011261_5011537_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|5011572_5011995_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|5012046_5013741_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000993386.1|5014117_5014354_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|5014350_5015058_+	EAL domain-containing protein	NA	NA	NA	NA	NA
5014992:5015051	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_000935451.1|5015096_5016812_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003155746.1|5016814_5017723_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_006122485.1|5017719_5018937_+	TniQ family protein	NA	NA	NA	NA	NA
WP_003155741.1|5018998_5019622_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
WP_013250881.1|5019837_5020701_-	class A extended-spectrum beta-lactamase GES-1	NA	A0A1B0VBP7	Salmonella_phage	39.0	4.3e-42
WP_000845048.1|5020880_5021894_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_034002765.1|5022143_5022716_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	51.4	2.0e-40
WP_079384023.1|5022829_5023477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034002762.1|5023969_5024506_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_034002759.1|5024637_5025129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079384028.1|5025296_5026256_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_157737746.1|5026434_5026905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163403.1|5026949_5027732_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|5027721_5029245_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_032488973.1|5029315_5029768_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|5029770_5031486_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
5031532:5031636	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACAAGATCGGAAGCGAGAGGCAGTTTTGAGAGACCTTCAACCTTCGGC	NA	NA	NA	NA
>prophage 11
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	5534750	5543305	7241575	coat	Pseudomonas_phage(80.0%)	14	NA	NA
WP_003134394.1|5534750_5536043_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.7	1.0e-244
WP_023127773.1|5536272_5537556_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	96.5	1.1e-227
WP_003114150.1|5537559_5537916_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_031757282.1|5537920_5539234_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	54.8	3.7e-45
WP_003125072.1|5539385_5539634_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|5539646_5539898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5539910_5540003_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003140508.1|5540019_5540454_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_049237859.1|5540588_5540966_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	1.1e-58
WP_003133746.1|5540969_5541614_-	DNA cytosine methyltransferase	NA	E3SMD8	Cyanophage	64.4	4.3e-63
WP_023094972.1|5541610_5542279_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_023086597.1|5542275_5542491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003125079.1|5542612_5542882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809168.1|5543011_5543305_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	38.5	2.3e-11
>prophage 12
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	6039952	6081296	7241575	integrase,transposase	Pseudomonas_phage(98.08%)	53	6031359:6031375	6068402:6068418
6031359:6031375	attL	CGCGCGCTGTAGGTCGC	NA	NA	NA	NA
WP_003134974.1|6039952_6041167_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	61.1	4.5e-138
WP_003094179.1|6041726_6042086_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_023657063.1|6042088_6042652_-	regulatory protein GemA	NA	J9RWI3	Pseudomonas_phage	100.0	5.0e-100
WP_003129239.1|6042638_6043106_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003148480.1|6043107_6043326_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_034066083.1|6043327_6044017_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	99.1	2.5e-125
WP_031638066.1|6044018_6044642_-	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	100.0	4.5e-110
WP_033990702.1|6044634_6044835_-	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	100.0	1.3e-31
WP_003094193.1|6044827_6045202_-	hypothetical protein	NA	Q5ZR08	Pseudomonas_phage	94.4	3.9e-64
WP_003094195.1|6045201_6045483_-	hypothetical protein	NA	J9STZ0	Pseudomonas_phage	100.0	3.3e-44
WP_003094197.1|6045479_6045821_-	hypothetical protein	NA	J9SNT1	Pseudomonas_phage	100.0	9.3e-57
WP_003094200.1|6045822_6046989_-	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	100.0	1.8e-216
WP_034023955.1|6046988_6048773_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	99.3	0.0e+00
WP_034066084.1|6048776_6049754_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	99.7	3.4e-160
WP_003094211.1|6049763_6050078_-	hypothetical protein	NA	J9SH06	Pseudomonas_phage	100.0	1.2e-50
WP_003094213.1|6050074_6050335_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	100.0	1.6e-40
WP_023127890.1|6050327_6050816_-	hypothetical protein	NA	J9SVV8	Pseudomonas_phage	100.0	2.8e-91
WP_023127889.1|6050939_6051164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003094216.1|6051448_6051679_-	DNA-binding protein	NA	J9SNE2	Pseudomonas_phage	100.0	3.2e-37
WP_023127888.1|6051784_6052156_+	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	98.1	2.6e-20
WP_034066089.1|6052173_6052677_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	95.2	6.5e-83
WP_003094225.1|6053734_6053992_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_042933672.1|6054149_6054779_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	98.6	2.1e-118
WP_023657073.1|6054959_6055571_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|6055574_6055964_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003139994.1|6055965_6056262_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094238.1|6056267_6056843_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|6056844_6058548_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|6058547_6060026_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
WP_003139984.1|6060025_6061276_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|6061272_6061842_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|6062129_6063299_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|6063302_6063680_+	hypothetical protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_042933673.1|6063691_6064621_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	99.7	2.9e-177
WP_003094256.1|6064667_6064862_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|6064861_6065188_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|6065195_6065705_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|6065706_6066162_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|6066158_6066368_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|6066371_6067124_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139971.1|6067125_6067632_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_042933674.1|6067858_6071710_+	hypothetical protein	NA	A0A0S4L7E6	Pseudomonas_phage	99.8	0.0e+00
6068402:6068418	attR	GCGACCTACAGCGCGCG	NA	NA	NA	NA
WP_016852452.1|6071709_6072666_+	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	95.0	3.1e-182
WP_042933676.1|6072668_6073592_+	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	98.4	9.5e-181
WP_016852454.1|6073594_6075301_+	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.5	0.0e+00
WP_016852455.1|6075287_6076106_+	DUF2163 domain-containing protein	NA	J9SN93	Pseudomonas_phage	99.3	3.8e-165
WP_003094285.1|6076115_6076346_+	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_016852456.1|6076342_6076573_+	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	94.7	2.7e-36
WP_003094286.1|6076559_6078770_+	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	97.8	0.0e+00
WP_003094288.1|6078766_6079915_+	hypothetical protein	NA	J9SP76	Pseudomonas_phage	92.9	9.0e-213
WP_003094290.1|6079911_6080202_+	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	95.7	2.6e-44
WP_071534095.1|6080340_6080532_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	74.6	3.0e-20
WP_003094291.1|6080501_6081296_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.2	1.8e-143
>prophage 13
NZ_CP021775	Pseudomonas aeruginosa strain Pa58 chromosome, complete genome	7241575	6162128	6197193	7241575	integrase,tRNA,coat	Pseudomonas_phage(64.29%)	37	6167418:6167438	6192473:6192493
WP_003135087.1|6162128_6162677_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|6162707_6163241_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003125348.1|6163240_6163783_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099335.1|6163801_6164590_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023124830.1|6164606_6166979_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003135106.1|6166975_6167923_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
6167418:6167438	attL	TGACCCTGCCGGCCGGCACCT	NA	NA	NA	NA
WP_003135108.1|6167924_6169298_-	MFS transporter	NA	NA	NA	NA	NA
WP_003094982.1|6169577_6170600_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003135111.1|6170596_6171514_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|6171927_6172911_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023094965.1|6173063_6174020_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003135124.1|6174029_6174929_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003135126.1|6174925_6176371_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.4e-45
WP_003099307.1|6176496_6177018_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|6177151_6177949_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003135128.1|6177938_6178697_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003114694.1|6178690_6179521_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003094997.1|6179522_6180605_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	4.3e-07
WP_003095001.1|6180622_6181891_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_087921009.1|6182034_6183807_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|6183811_6184429_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003135132.1|6184430_6185279_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|6185445_6186387_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003095013.1|6186503_6187118_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|6187159_6187744_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|6187784_6188885_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_023094967.1|6189203_6189641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003135135.1|6189687_6190695_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	6.3e-77
WP_004352686.1|6190691_6191984_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_023127811.1|6192213_6193497_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.3	2.7e-234
6192473:6192493	attR	AGGTGCCGGCCGGCAGGGTCA	NA	NA	NA	NA
WP_003114150.1|6193500_6193857_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_003125072.1|6195318_6195567_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|6195579_6195831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|6195843_6195936_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003133730.1|6195952_6196387_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	86.1	8.7e-60
WP_003133732.1|6196521_6196899_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	9.3e-58
WP_031757220.1|6196902_6197193_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	96.9	5.6e-55
