The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	364717	425029	4974147	terminase,tail,head,holin,portal,integrase,capsid,protease,tRNA	Enterobacterial_phage(37.74%)	81	355215:355230	433985:434000
355215:355230	attL	GCTTCCAGCAGCGGTT	NA	NA	NA	NA
WP_032103856.1|364717_365830_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022650804.1|365870_366344_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022650805.1|366343_367006_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032609009.1|367123_368374_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	2.3e-20
WP_032609010.1|368449_368695_+	YmjA family protein	NA	NA	NA	NA	NA
WP_032609011.1|368699_370199_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_071524166.1|370323_370416_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|370788_371037_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|371090_371165_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|371165_371264_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032609012.1|371309_372338_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	2.2e-13
WP_023315857.1|372650_372905_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|372985_373291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857886.1|373291_373636_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032609014.1|373786_374494_+	CTP synthase	NA	NA	NA	NA	NA
WP_022650812.1|374525_375713_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_022650813.1|375812_376604_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|376587_377034_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023315858.1|377140_379177_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_044596273.1|379192_380524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650816.1|380933_381434_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032103854.1|381653_382796_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	6.4e-94
WP_022650818.1|382770_383034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032103852.1|383066_383336_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	6.9e-31
WP_032103851.1|383402_383687_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	46.1	3.4e-20
WP_032103849.1|383686_384265_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	49.0	5.1e-31
WP_045332633.1|384261_384678_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	44.7	4.2e-11
WP_045332634.1|384958_385480_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	55.0	1.8e-22
WP_045332635.1|385466_386501_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	93.9	3.8e-178
WP_045332674.1|386500_386914_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	1.8e-54
WP_022648914.1|387368_387827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634713.1|388288_388945_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
WP_032634882.1|389044_389242_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
WP_032634711.1|389267_389738_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_072044687.1|389978_390164_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
WP_045332645.1|390147_391101_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	92.7	7.8e-170
WP_045332646.1|391097_391592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332647.1|391591_392251_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.3	1.3e-99
WP_022650831.1|392247_392475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332648.1|392471_392792_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	1.4e-43
WP_045332649.1|392788_393178_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	87.3	1.4e-61
WP_045332650.1|393193_393919_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	2.2e-55
WP_045326200.1|393915_394905_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	85.7	1.7e-167
WP_045332651.1|394917_395496_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	4.3e-46
WP_032103826.1|395651_396047_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	96.9	3.8e-62
WP_032103824.1|396033_396315_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	2.8e-43
WP_032665385.1|396314_396944_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	9.3e-103
WP_032666079.1|396951_397221_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
WP_045332652.1|397177_397357_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	7.8e-15
WP_128747562.1|397414_398020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332654.1|398077_399535_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	89.9	2.3e-266
WP_045332655.1|399672_399906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332656.1|400070_400661_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	81.1	7.9e-96
WP_045332657.1|400660_401017_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.1	2.8e-48
WP_080338021.1|401145_401682_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_045332660.1|401837_402311_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
WP_016063095.1|402310_404047_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
WP_045332662.1|404046_405351_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.1	3.4e-232
WP_045332663.1|405364_406213_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	4.1e-138
WP_032104393.1|406222_407434_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	5.2e-195
WP_045332665.1|407476_407803_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_045286830.1|407811_408150_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	8.6e-39
WP_006809157.1|408146_408596_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	100.0	2.0e-75
WP_045332667.1|408592_408940_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	96.5	5.5e-57
WP_006809155.1|408999_409443_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_040117541.1|409451_409835_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_045332668.1|409843_410128_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	94.4	1.7e-40
WP_072044688.1|410214_410556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332670.1|410613_414105_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.2	0.0e+00
WP_045332671.1|414107_414446_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	1.6e-37
WP_006809150.1|414442_415201_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_045332672.1|415203_415914_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.4	6.6e-97
WP_022650859.1|415913_416498_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	7.4e-54
WP_087920837.1|416550_420111_+|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	70.5	0.0e+00
WP_045332873.1|420155_420470_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_006809145.1|420470_421142_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_017694300.1|421249_421483_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.9	3.0e-30
WP_063161866.1|421542_422841_+	hypothetical protein	NA	G8C7K5	Escherichia_phage	71.3	1.3e-170
WP_154232874.1|422935_423175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332621.1|423162_423483_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	2.3e-25
WP_032665944.1|423745_425029_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
433985:434000	attR	GCTTCCAGCAGCGGTT	NA	NA	NA	NA
>prophage 2
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	1049870	1102627	4974147	terminase,tail,plate,holin,head,portal,integrase,capsid,protease,lysis	Erwinia_phage(24.32%)	62	1062536:1062550	1103912:1103926
WP_022651351.1|1049870_1050917_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
WP_017384219.1|1051169_1051931_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_023314251.1|1051927_1052518_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003856794.1|1052554_1053430_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|1053527_1054148_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003856787.1|1054144_1055026_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_071524153.1|1055165_1055210_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032609352.1|1055304_1056867_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_032609354.1|1056866_1058462_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	1.2e-50
WP_032609355.1|1058465_1059824_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
WP_003856780.1|1059834_1061028_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032609356.1|1061027_1061837_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_032609358.1|1062011_1063223_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
1062536:1062550	attL	GAAAATGACGAAAGT	NA	NA	NA	NA
WP_003856774.1|1063219_1063453_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003856769.1|1063739_1064372_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_032609359.1|1064654_1065059_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003856765.1|1065084_1065828_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_023324803.1|1065841_1066381_+	septation protein A	NA	NA	NA	NA	NA
WP_032609360.1|1066561_1068748_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_023314256.1|1068846_1069242_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_017384230.1|1069280_1070009_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_003856755.1|1070230_1070527_+	YciI family protein	NA	NA	NA	NA	NA
WP_032609363.1|1070670_1071147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609364.1|1071203_1072094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609365.1|1072210_1072432_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.9	6.0e-25
WP_032609366.1|1072508_1073678_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	76.9	4.0e-160
WP_032609367.1|1073674_1074139_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	4.2e-60
WP_032609369.1|1074151_1076599_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.1	4.6e-283
WP_032609370.1|1076588_1076711_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.0e-13
WP_032609371.1|1076743_1077046_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_032609372.1|1077102_1077621_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	8.5e-78
WP_032609374.1|1077633_1078827_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	8.3e-185
WP_032609376.1|1079201_1079717_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	36.8	4.4e-18
WP_032609378.1|1081572_1082103_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.5e-90
WP_032609381.1|1082095_1083004_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	83.1	3.2e-136
WP_023338715.1|1083009_1083360_-	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	69.8	1.5e-38
WP_032609382.1|1083356_1083998_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.1	1.6e-97
WP_032609384.1|1084129_1084861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609386.1|1084930_1085380_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.5	2.6e-51
WP_032609387.1|1085372_1085840_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	6.5e-61
WP_072163335.1|1085802_1086048_-|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_038421124.1|1085935_1086361_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.1	9.2e-46
WP_032609391.1|1086357_1086867_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.7e-78
WP_032609392.1|1086850_1087072_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_032609394.1|1087062_1087266_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	76.1	6.1e-24
WP_032609395.1|1087265_1087772_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.2	7.1e-61
WP_038421123.1|1087871_1088627_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	65.3	7.5e-75
WP_032609400.1|1088630_1089698_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	3.9e-170
WP_032609401.1|1089753_1090608_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	72.2	1.0e-112
WP_032609402.1|1090774_1092544_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	1.1e-302
WP_032609403.1|1092545_1093571_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	2.1e-168
WP_032609405.1|1093898_1095098_+	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	32.6	3.4e-53
WP_032609407.1|1095100_1095619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609409.1|1096300_1096855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609411.1|1097002_1097287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609413.1|1097283_1099581_-	replication endonuclease	NA	Q858T4	Yersinia_virus	75.5	0.0e+00
WP_014884151.1|1099582_1099846_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_014884152.1|1099868_1100087_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_014884153.1|1100153_1100654_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.9	7.4e-71
WP_014884154.1|1100820_1101096_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	6.8e-42
WP_014884155.1|1101220_1101520_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.9e-38
WP_032609415.1|1101616_1102627_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	1.2e-147
1103912:1103926	attR	GAAAATGACGAAAGT	NA	NA	NA	NA
>prophage 3
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	1373906	1385573	4974147	terminase	Salmonella_phage(22.22%)	14	NA	NA
WP_003859661.1|1373906_1374623_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
WP_032609555.1|1374786_1375257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651459.1|1375262_1376189_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859653.1|1376218_1376542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817219.1|1376631_1376994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609556.1|1377293_1377653_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
WP_032609557.1|1377649_1378189_-	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
WP_023295991.1|1378169_1378400_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.0	2.9e-22
WP_023295990.1|1378549_1378912_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
WP_032609558.1|1378908_1379850_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	5.5e-160
WP_032609559.1|1379846_1381328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048859468.1|1381357_1383604_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
WP_087920839.1|1383624_1385235_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
WP_032609561.1|1385231_1385573_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
>prophage 4
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	1495053	1503903	4974147		Escherichia_phage(28.57%)	7	NA	NA
WP_032609643.1|1495053_1496058_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
WP_032609644.1|1497532_1498699_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
WP_023294999.1|1498952_1500359_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_023295000.1|1500494_1501043_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_032609645.1|1501053_1501944_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
WP_032609646.1|1501956_1502823_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
WP_032103484.1|1502838_1503903_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 5
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	1921742	2071969	4974147	terminase,tail,plate,transposase,holin,lysis,head,portal,coat,integrase,capsid,tRNA	Escherichia_phage(30.77%)	160	2031070:2031087	2063631:2063648
WP_003860666.1|1921742_1922468_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_003860668.1|1922600_1923404_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_003860669.1|1923465_1924446_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003860670.1|1924436_1925075_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_022651600.1|1925200_1926478_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_003860673.1|1926478_1927618_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_003860675.1|1927790_1928213_+	DoxX family protein	NA	NA	NA	NA	NA
WP_003860678.1|1928266_1929520_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
WP_032665849.1|1929824_1931015_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003860685.1|1931091_1931430_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003860687.1|1931510_1932848_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	2.0e-09
WP_003860689.1|1932844_1933597_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_032610263.1|1933593_1935027_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	27.9	6.8e-16
WP_032609857.1|1935559_1939447_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
WP_022651605.1|1939714_1941265_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_022651606.1|1941152_1941692_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_032609859.1|1941716_1942352_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_032609861.1|1942355_1943720_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003860700.1|1943729_1944626_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003860702.1|1944744_1945593_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860704.1|1945649_1945910_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_003860706.1|1945906_1946287_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860707.1|1946286_1947018_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860708.1|1947093_1947801_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003860709.1|1947818_1948724_-	GTPase Era	NA	NA	NA	NA	NA
WP_003860711.1|1948720_1949401_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860712.1|1949624_1950599_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|1950614_1952420_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_045332601.1|1952602_1952917_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.9	6.6e-17
WP_001067855.1|1952941_1953646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032645732.1|1954070_1954652_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.2	1.6e-77
WP_026080692.1|1956859_1957825_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	8.2e-58
WP_044901854.1|1957826_1961438_-|tail	phage tail protein	tail	G8C7R4	Escherichia_phage	85.0	0.0e+00
WP_044704690.1|1961493_1962093_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	94.5	1.6e-99
WP_044704688.1|1962080_1962812_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	96.3	7.6e-149
WP_044704685.1|1962824_1963595_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	96.9	1.9e-145
WP_022651622.1|1963594_1963945_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	2.6e-54
WP_127341916.1|1964030_1964417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044901855.1|1964473_1967629_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	75.4	0.0e+00
WP_016247126.1|1967628_1967916_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_044704682.1|1967933_1968272_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	93.8	9.5e-54
WP_045332809.1|1968336_1969149_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	49.6	1.4e-50
WP_044704679.1|1969292_1970225_-|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	99.0	7.9e-167
WP_025759418.1|1970271_1970718_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	90.6	5.1e-71
WP_044704674.1|1970707_1971307_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	90.5	3.5e-99
WP_039270143.1|1971308_1971662_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	1.2e-51
WP_044704672.1|1971663_1972146_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.0	2.1e-83
WP_044704671.1|1972148_1972382_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	68.8	1.8e-19
WP_044704670.1|1972421_1973558_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.3	1.1e-194
WP_044704667.1|1973574_1974327_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	94.4	3.4e-128
WP_022651635.1|1974434_1974644_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_044704664.1|1974647_1975754_-	phage Mu F like family protein	NA	G8C7P5	Escherichia_phage	89.9	2.8e-187
WP_044704662.1|1975755_1977159_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.1	9.8e-254
WP_022651638.1|1977163_1978468_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	59.6	1.3e-146
WP_044901856.1|1978445_1979444_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.7	5.2e-39
WP_022651640.1|1979581_1979842_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	79.1	8.1e-29
WP_022651641.1|1979971_1980253_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	95.7	8.7e-45
WP_044901857.1|1980306_1980822_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	90.1	4.5e-79
WP_022651643.1|1980818_1981355_-	lysozyme	NA	H6WRZ4	Salmonella_phage	86.4	2.0e-90
WP_022651644.1|1981354_1981657_-	hypothetical protein	NA	O64361	Escherichia_phage	66.3	2.7e-31
WP_044704659.1|1981881_1982691_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.5	5.3e-111
WP_022651646.1|1982687_1982828_-	YlcG family protein	NA	NA	NA	NA	NA
WP_022651647.1|1982824_1983181_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	95.7	1.2e-62
WP_022651648.1|1983177_1983459_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	7.2e-47
WP_044704657.1|1983461_1983662_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	65.2	1.1e-20
WP_017693509.1|1983667_1984267_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	87.8	2.7e-99
WP_044704654.1|1984671_1984905_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	79.2	1.2e-26
WP_044901858.1|1985048_1986932_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	3.0e-197
WP_044704651.1|1986928_1987675_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	2.6e-67
WP_044704649.1|1987677_1988082_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	74.0	7.5e-13
WP_022651653.1|1988081_1988414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704647.1|1988410_1988671_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	74.7	6.2e-29
WP_044704646.1|1988674_1989361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704644.1|1989377_1990130_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	82.8	1.9e-115
WP_044704642.1|1990126_1991110_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	81.6	5.3e-129
WP_044704641.1|1991209_1991752_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	8.7e-49
WP_044704637.1|1992105_1992519_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	1.4e-06
WP_044704632.1|1993120_1996540_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	67.8	0.0e+00
WP_044704699.1|1996551_1997664_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	78.3	9.8e-164
WP_032682190.1|1997698_1997938_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.5	5.5e-24
WP_022651668.1|1997984_1998269_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_023295223.1|1998246_1999476_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	97.8	1.4e-240
WP_003860716.1|1999907_2000384_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|2000380_2001334_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_032609863.1|2001333_2001984_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|2002015_2002591_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_003860722.1|2003017_2004637_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_032609866.1|2004621_2005359_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|2005491_2006820_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|2006872_2007256_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860729.1|2007571_2008261_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_023314680.1|2008300_2009386_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|2009590_2010010_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|2010080_2010779_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_022651672.1|2010814_2013478_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_032609868.1|2013587_2014943_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|2014988_2015312_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|2015308_2016616_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|2016767_2017220_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_032609871.1|2022870_2025444_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_003863167.1|2025573_2026305_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003863165.1|2026301_2027282_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|2027413_2028151_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|2028418_2028760_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|2028865_2028913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314685.1|2029020_2030181_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_032609874.1|2030177_2031050_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
2031070:2031087	attL	AAAAGCCAGCAATGCTGG	NA	NA	NA	NA
WP_044596285.1|2031249_2031642_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.2	9.7e-26
WP_023323577.1|2031687_2031909_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_032609875.1|2031985_2033155_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	7.9e-172
WP_032609877.1|2033151_2033616_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	7.2e-60
WP_032609878.1|2033626_2036077_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.9	9.3e-300
WP_017382998.1|2036066_2036189_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032609880.1|2036221_2036545_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	4.4e-24
WP_023295232.1|2036602_2037121_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032609883.1|2037133_2038327_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	4.1e-184
WP_032609885.1|2038701_2039133_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	55.1	5.3e-17
WP_032609887.1|2039134_2041483_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	47.0	8.8e-114
WP_032609889.1|2041494_2042025_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	1.4e-91
WP_023323586.1|2042017_2042926_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.8	8.3e-137
WP_023323587.1|2042931_2043282_-	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	72.4	8.1e-40
WP_032609890.1|2043278_2043920_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.7	5.6e-95
WP_032609891.1|2044126_2044639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609892.1|2044717_2046091_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_032609893.1|2046065_2046623_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_032609894.1|2046874_2047327_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	5.7e-46
WP_023295244.1|2047319_2047787_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
WP_072163360.1|2047749_2047995_-|holin	holin	holin	S4TNY4	Salmonella_phage	75.3	1.1e-27
WP_032609895.1|2047882_2048299_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	3.5e-42
WP_032609896.1|2048298_2048730_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	77.6	1.8e-57
WP_032609897.1|2048726_2049239_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.8	2.3e-83
WP_014170137.1|2049222_2049444_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_017382979.1|2049434_2049638_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032609900.1|2049637_2050144_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_032609901.1|2050243_2050999_-|terminase	terminase endonuclease subunit	terminase	A0A0M4QWM0	Salmonella_phage	69.3	2.2e-74
WP_023295252.1|2051002_2052070_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_032609903.1|2052125_2052980_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	74.6	7.6e-116
WP_032609904.1|2053145_2054915_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.1	6.1e-301
WP_032609906.1|2054916_2055942_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	2.7e-168
WP_032610267.1|2056334_2056673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048859478.1|2056773_2057310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609909.1|2057716_2058181_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	54.9	4.4e-41
WP_032609910.1|2058186_2060472_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.9	0.0e+00
WP_032609912.1|2060461_2060737_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	59.3	9.8e-25
WP_044704157.1|2060753_2060969_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_032609913.1|2061034_2061535_-	hypothetical protein	NA	M1SV55	Escherichia_phage	88.6	2.5e-82
WP_032609915.1|2061525_2061705_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	66.7	8.1e-12
WP_023295263.1|2061707_2061980_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032610269.1|2062139_2062433_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	68.0	4.2e-34
WP_032609917.1|2062502_2063483_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.1	4.4e-152
WP_022649060.1|2063671_2064793_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
2063631:2063648	attR	AAAAGCCAGCAATGCTGG	NA	NA	NA	NA
WP_006811632.1|2064803_2065874_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_003863151.1|2066086_2066461_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863149.1|2066614_2067151_+	YfiR family protein	NA	NA	NA	NA	NA
WP_032609921.1|2067143_2068364_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863144.1|2068376_2068862_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032609922.1|2068864_2070235_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863141.1|2070273_2070678_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|2070810_2071158_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|2071201_2071969_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	2081349	2135283	4974147	holin,integrase,terminase,tail	Enterobacteria_phage(27.78%)	61	2081602:2081616	2142620:2142634
WP_003863115.1|2081349_2081832_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
2081602:2081616	attL	ACCCGCACCCGTAAG	NA	NA	NA	NA
WP_013096351.1|2082555_2082795_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
WP_123906383.1|2082881_2083307_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_071886176.1|2084067_2084421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077870385.1|2084674_2085802_-|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
WP_032610594.1|2085859_2086093_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
WP_032610595.1|2086200_2086872_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
WP_032610596.1|2086872_2087187_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
WP_032610597.1|2087230_2091028_-|tail	phage tail protein	tail	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
WP_032610598.1|2091082_2091673_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
WP_032610599.1|2091699_2092047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610600.1|2092075_2092786_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
WP_032610602.1|2092787_2093543_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
WP_032610603.1|2093539_2093878_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
WP_052686367.1|2093880_2094837_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	55.2	1.5e-88
WP_032610605.1|2095671_2096145_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	95.5	7.2e-84
WP_032610606.1|2096302_2096653_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	2.7e-51
WP_071886177.1|2096652_2097243_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	76.0	1.2e-88
WP_032610607.1|2097224_2098682_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	92.6	4.0e-274
WP_032610608.1|2098770_2099469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886186.1|2099718_2099988_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
WP_032610613.1|2099995_2100625_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	2.7e-102
WP_017384386.1|2100624_2100903_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_017384387.1|2100892_2101282_-	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_032610617.1|2102278_2103061_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	3.1e-108
WP_032610619.1|2103088_2104468_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	6.4e-173
WP_032610621.1|2104464_2105346_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.4	1.8e-80
WP_087920840.1|2105361_2106171_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	64.1	1.6e-83
WP_048859479.1|2106249_2106465_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_023296237.1|2106618_2107311_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_032610623.1|2107482_2107776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610624.1|2107857_2108247_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	58.8	4.0e-32
WP_032610625.1|2108353_2108575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|2108567_2108975_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_032610626.1|2109164_2109578_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.2	2.0e-45
WP_032610627.1|2109681_2109966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050710.1|2109955_2110165_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
WP_032610629.1|2110119_2111292_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.3	5.0e-211
WP_032609931.1|2111615_2112845_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.6	1.1e-205
WP_032609933.1|2113127_2114684_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	31.0	1.4e-19
WP_032609935.1|2114673_2115570_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032609936.1|2115566_2116457_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_032609938.1|2116547_2116979_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_050596973.1|2117166_2118300_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_071886178.1|2118327_2118930_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_032609940.1|2118926_2120039_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_032609941.1|2120031_2121420_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.7	1.7e-48
WP_032609942.1|2121419_2121692_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_032610271.1|2122099_2123284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609944.1|2123283_2124999_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032609946.1|2125153_2125651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023323125.1|2125814_2126021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596283.1|2126039_2126843_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	30.3	7.6e-17
WP_032609947.1|2127045_2127483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609950.1|2129472_2129859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886179.1|2129883_2130147_+	cell wall-binding protein	NA	NA	NA	NA	NA
WP_032609951.1|2130187_2130616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609952.1|2130710_2131109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609953.1|2131118_2132723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609954.1|2132738_2134064_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032609956.1|2134014_2135283_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2142620:2142634	attR	ACCCGCACCCGTAAG	NA	NA	NA	NA
>prophage 7
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	2640817	2681109	4974147	terminase,tail,head,plate,portal,tRNA,integrase,capsid,lysis	Salmonella_phage(80.49%)	49	2635096:2635126	2686098:2686128
2635096:2635126	attL	GCCGGGTGGCGCTGCGCTTACCCGGCCTACA	NA	NA	NA	NA
WP_032607934.1|2640817_2641831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
WP_001144069.1|2642067_2642283_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003862574.1|2642398_2644144_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_006812010.1|2644296_2646141_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032607936.1|2646241_2646748_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015386379.1|2647084_2647303_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
WP_032610578.1|2647372_2648473_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	5.5e-183
WP_032610580.1|2648469_2648955_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.1	3.0e-69
WP_032610582.1|2648954_2652398_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.4	0.0e+00
WP_007848878.1|2652390_2652510_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_007848877.1|2652524_2652827_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_007848874.1|2652881_2653397_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_032610584.1|2653406_2654579_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	1.6e-209
WP_032610585.1|2654711_2655110_-|tail	phage tail fiber protein	tail	K7PMC4	Enterobacterial_phage	50.0	2.4e-19
WP_032610586.1|2655109_2656846_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	70.5	3.3e-142
WP_032610588.1|2656842_2657448_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	5.2e-111
WP_032610589.1|2657440_2658349_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	8.0e-148
WP_039264785.1|2658335_2658695_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.0	1.5e-52
WP_014884896.1|2658691_2659270_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
WP_014884897.1|2659338_2659785_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_014884898.1|2659777_2660209_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_032610557.1|2660304_2660733_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.7	1.4e-57
WP_032610558.1|2660729_2661245_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	3.1e-72
WP_014884902.1|2661225_2661441_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|2661444_2661648_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884903.1|2661647_2662115_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_006777754.1|2662213_2662867_-|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_014884904.1|2662870_2664019_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_032610559.1|2664034_2664862_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	64.3	1.3e-72
WP_032610561.1|2665011_2666775_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.5	6.5e-312
WP_032610563.1|2666774_2667824_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	2.4e-156
WP_057979947.1|2667911_2668118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|2668295_2668529_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_032610566.1|2668541_2668730_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	91.9	5.7e-24
WP_032610567.1|2668891_2671285_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.4	0.0e+00
WP_032610569.1|2671281_2672133_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	72.3	2.8e-118
WP_032610570.1|2672129_2672357_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.5e-34
WP_032610571.1|2672356_2672590_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	2.1e-23
WP_032610572.1|2672657_2672999_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
WP_015386352.1|2672962_2673163_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_015386351.1|2673170_2673680_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386350.1|2673714_2673951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610574.1|2674052_2674667_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.2e-38
WP_087920841.1|2674672_2675578_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032610576.1|2675587_2676601_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_003862593.1|2676978_2678148_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032607938.1|2678148_2678913_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003862595.1|2679058_2679553_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032607942.1|2679549_2681109_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	7.4e-08
2686098:2686128	attR	GCCGGGTGGCGCTGCGCTTACCCGGCCTACA	NA	NA	NA	NA
>prophage 8
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	3788666	3865974	4974147	transposase,protease,integrase	uncultured_Caudovirales_phage(42.11%)	86	3789078:3789092	3854734:3854750
WP_032608281.1|3788666_3789956_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.0	1.0e-84
3789078:3789092	attL	GGCGGCCAGCAGTTG	NA	NA	NA	NA
WP_032608282.1|3789977_3790490_-	signal peptidase II	NA	NA	NA	NA	NA
3789078:3789092	attL	GGCGGCCAGCAGTTG	NA	NA	NA	NA
WP_004364974.1|3790493_3791390_-	cation transporter	NA	NA	NA	NA	NA
WP_029396360.1|3791485_3791893_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016807974.1|3792341_3792812_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_016807973.1|3792872_3793409_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	64.8	9.5e-56
WP_016807972.1|3793473_3793716_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_004115558.1|3793699_3793948_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_044596300.1|3794084_3794750_+	PilL protein	NA	NA	NA	NA	NA
WP_032608284.1|3794746_3795505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608285.1|3795516_3796239_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608286.1|3796217_3796853_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_032608287.1|3796858_3797392_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608288.1|3797391_3797964_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_032608290.1|3797974_3798463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608291.1|3798455_3800555_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_006785966.1|3800547_3801306_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_032610154.1|3801396_3801744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608292.1|3801928_3802276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003029734.1|3802275_3802518_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006785968.1|3802553_3802940_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_004115534.1|3802952_3803309_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_004115533.1|3803305_3803965_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006785972.1|3803964_3804915_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608294.1|3804904_3806407_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016151320.1|3806417_3806786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608297.1|3806785_3807196_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_032608298.1|3807195_3810054_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_032608299.1|3810050_3810428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608300.1|3810512_3811457_-|protease	CAAX amino protease	protease	NA	NA	NA	NA
WP_127341290.1|3811666_3811960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087744867.1|3812208_3813329_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.9e-51
WP_071886161.1|3813362_3814217_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032608304.1|3814425_3814824_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608305.1|3814820_3815813_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608306.1|3815812_3817288_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004115513.1|3817298_3817637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029593071.1|3817639_3819163_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_004115509.1|3819187_3819589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077791480.1|3819789_3820305_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	9.2e-32
WP_029591133.1|3820307_3821579_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.5	8.1e-146
WP_028016388.1|3822929_3823898_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071886162.1|3824279_3824774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048859499.1|3824836_3825508_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006786007.1|3826477_3827377_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_032608310.1|3827443_3828061_-	recombinase family protein	NA	NA	NA	NA	NA
WP_010791757.1|3828256_3829939_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000393453.1|3829941_3830850_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000801210.1|3830846_3832064_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|3832124_3832739_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_001087809.1|3832791_3833028_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|3833024_3833390_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|3833406_3835053_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
3834886:3834900	attR	GGCGGCCAGCAGTTG	NA	NA	NA	NA
WP_000654684.1|3835049_3835295_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
3834886:3834900	attR	GGCGGCCAGCAGTTG	NA	NA	NA	NA
WP_000735441.1|3835297_3835573_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|3835588_3835939_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|3836010_3836445_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|3836544_3837549_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_074422537.1|3837730_3837907_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003100858.1|3837942_3838269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|3838523_3838880_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032608318.1|3840097_3841066_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.2e-45
WP_002718009.1|3841247_3841808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|3843647_3844652_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001549890.1|3845520_3845853_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025801347.1|3845858_3846572_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
WP_001549888.1|3846629_3847058_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|3847107_3848391_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|3848486_3848840_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|3849323_3850802_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|3850820_3851648_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
WP_001549953.1|3851719_3852916_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|3853444_3853819_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|3854093_3855242_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118538.1|3855595_3855928_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004118540.1|3856059_3856617_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118541.1|3856777_3859786_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_087920843.1|3859803_3860007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021443905.1|3860097_3860445_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_065187124.1|3860441_3861035_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_011405609.1|3861159_3861813_-	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_011405608.1|3861848_3863558_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
WP_011405607.1|3863745_3864021_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3864034_3864385_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_032608321.1|3864456_3864891_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|3864969_3865974_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP021776	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 chromosome, complete genome	4974147	4667048	4715841	4974147	terminase,tail,head,holin,transposase,integrase	Cronobacter_phage(35.71%)	70	4658073:4658089	4717843:4717859
4658073:4658089	attL	ACAAAACGCTGCTGGCG	NA	NA	NA	NA
WP_025756108.1|4667048_4668212_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.5	1.4e-229
WP_072044686.1|4668088_4668424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032608689.1|4668529_4668760_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	5.7e-34
WP_032608690.1|4668768_4669008_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_032608691.1|4668985_4669297_-	DUF2591 family protein	NA	E5AGF4	Erwinia_phage	47.4	1.0e-14
WP_032608692.1|4669296_4669515_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	4.6e-17
WP_127341288.1|4669793_4669994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608697.1|4669990_4670209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608698.1|4670205_4670757_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	2.2e-55
WP_164088318.1|4670753_4670921_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	92.7	5.6e-23
WP_032608699.1|4670917_4671346_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	1.5e-72
WP_032608700.1|4671342_4672023_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.1	6.9e-128
WP_032608701.1|4672019_4672865_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
WP_032608703.1|4672883_4673168_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	1.9e-47
WP_000607101.1|4673240_4673450_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_023294196.1|4673446_4673605_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	96.2	5.8e-22
WP_044596295.1|4673601_4673796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042862569.1|4674137_4674611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608706.1|4675117_4675315_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	92.2	1.0e-23
WP_025760147.1|4675473_4675830_-	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	90.7	7.7e-54
WP_032608707.1|4675947_4676373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608708.1|4676369_4676828_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	49.3	1.8e-39
WP_032608710.1|4676824_4677070_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	50.0	4.4e-16
WP_016042178.1|4677285_4677975_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_016042179.1|4678085_4678313_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_001514165.1|4678342_4678909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095956.1|4678997_4679165_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_032608714.1|4679151_4680237_+	replication protein	NA	E5AGE9	Erwinia_phage	45.6	2.3e-85
WP_032608716.1|4680233_4681607_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.7	4.9e-165
WP_059555724.1|4681596_4681911_+	hypothetical protein	NA	I6PDF7	Cronobacter_phage	42.3	9.2e-11
WP_032608717.1|4681907_4682342_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	40.5	1.4e-09
WP_032608719.1|4682338_4682524_+	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
WP_032608720.1|4683626_4684082_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	66.9	2.9e-53
WP_032608721.1|4684081_4684252_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	92.9	2.4e-21
WP_032608722.1|4684244_4684880_+	Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	85.4	1.1e-92
WP_032608723.1|4684989_4685679_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.5e-53
WP_032608724.1|4685955_4686357_+	membrane protein	NA	NA	NA	NA	NA
WP_001514184.1|4686353_4686629_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_032608725.1|4686632_4687073_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	4.4e-51
WP_044596275.1|4687069_4687456_+	DUF2570 domain-containing protein	NA	A0A2H4FNE5	Salmonella_phage	44.0	5.5e-05
WP_032608726.1|4687752_4688271_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.3	2.1e-92
WP_003859853.1|4688866_4689097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608731.1|4689316_4689967_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	99.5	9.2e-114
WP_032608733.1|4689963_4691526_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.2	8.8e-304
WP_032608735.1|4691554_4693012_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	9.8e-156
WP_063612943.1|4692938_4693937_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	2.1e-112
WP_032608737.1|4693971_4694388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608738.1|4694459_4695848_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	3.3e-153
WP_017693196.1|4695851_4696286_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_006808954.1|4696296_4697394_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	7.6e-161
WP_032608740.1|4697403_4697769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006808952.1|4697771_4698152_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_032608741.1|4698151_4698325_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	2.7e-12
WP_032608742.1|4698324_4698675_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	8.9e-39
WP_032608743.1|4698677_4699142_+	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	45.5	1.2e-30
WP_032608745.1|4699138_4699522_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_052238023.1|4699621_4700116_+	HNH endonuclease	NA	G0ZNE5	Cronobacter_phage	50.7	1.0e-32
WP_000427623.1|4700297_4701302_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032608746.1|4701565_4702309_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	81.6	2.2e-71
WP_032608748.1|4702366_4703056_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.1	3.5e-55
WP_032608750.1|4703050_4703338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608752.1|4703453_4706360_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	39.0	1.3e-127
WP_032608753.1|4706359_4706857_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	3.7e-86
WP_015571561.1|4706856_4707327_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032608754.1|4707340_4707706_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	4.6e-62
WP_032608755.1|4707692_4710170_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.5	0.0e+00
WP_032608756.1|4710228_4712445_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	1.0e-39
WP_032608758.1|4712978_4713365_+|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	56.6	1.3e-17
WP_032608759.1|4713452_4714925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608760.1|4714917_4715841_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.8	1.4e-160
4717843:4717859	attR	ACAAAACGCTGCTGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP021777	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence	70882	296	10696	70882	transposase,integrase	Escherichia_phage(50.0%)	12	NA	NA
WP_045332762.1|296_1073_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	86.8	7.8e-51
WP_023321974.1|1165_1450_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_052687705.1|1497_2151_-	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	45.8	9.2e-45
WP_045332765.1|2698_3574_-	protein RepA	NA	Q71TL8	Escherichia_phage	57.6	1.9e-82
WP_045332766.1|3982_5254_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	1.6e-154
WP_045332768.1|5253_5685_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.0e-28
WP_045332769.1|5900_6857_+	recombinase	NA	A0A222YXF2	Escherichia_phage	56.0	1.6e-98
WP_045332770.1|6861_7251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332771.1|7283_7547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332772.1|7691_8072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043898770.1|8894_9677_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	3.6e-136
WP_045332773.1|9673_10696_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.9	1.0e-175
>prophage 1
NZ_CP021778	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence	71949	0	43434	71949	transposase,integrase	Escherichia_phage(20.0%)	55	26515:26574	34982:35638
WP_015632484.1|1542_1869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644893.1|1865_2594_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632482.1|2590_3022_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644894.1|3066_5067_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_022644895.1|5135_5384_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644896.1|5432_5975_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644897.1|6649_6970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|7005_7260_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644899.1|7453_7645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644900.1|7687_8194_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_032072057.1|8238_8904_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032408983.1|8918_9275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644878.1|9347_10115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644879.1|10168_10588_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|10597_10819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10818_11520_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_072216848.1|11721_11838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|11956_12187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644880.1|12248_12920_-	plasmid stability mediator StbB	NA	NA	NA	NA	NA
WP_001568038.1|12922_13894_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_020805749.1|14126_14558_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_022644881.1|14557_15829_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_022644882.1|15910_16885_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_015632469.1|16884_18090_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_007372134.1|18871_19276_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|19272_19620_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_022644883.1|19668_21207_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_012539983.1|21294_22050_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_032072094.1|22680_22794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408936.1|22922_23180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644886.1|23237_24023_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_022644887.1|24025_24664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072060.1|24712_25033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|25577_25808_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|25804_26221_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|26294_26531_+	AAA family ATPase	NA	NA	NA	NA	NA
26515:26574	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|26577_27282_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_022644888.1|27172_28102_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
WP_004201280.1|28257_28731_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|28951_29218_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|29360_30125_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|30385_31600_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|31633_33037_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|33448_33655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|33659_34148_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|34356_34668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404032.1|34703_35009_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001067855.1|35044_35749_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
34982:35638	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_000427619.1|37645_38650_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|38831_39008_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|39337_40153_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|40213_41017_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|41016_41853_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|41824_42364_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|42573_43434_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 2
NZ_CP021778	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence	71949	46663	47221	71949		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001217881.1|46663_47221_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 3
NZ_CP021778	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence	71949	53296	57867	71949	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_004199214.1|53296_54322_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|54318_55098_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|55416_56298_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|56547_57867_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 4
NZ_CP021778	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence	71949	66263	71758	71949	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_015065592.1|66263_67796_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_162859354.1|68229_70512_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_022644891.1|70717_71758_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
