The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	531314	573772	5172197	terminase,integrase,holin,portal,head,tail,capsid	Salmonella_phage(26.53%)	57	532269:532283	576593:576607
WP_023299884.1|531314_532598_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
532269:532283	attL	AGCGCCCTGAAGCTG	NA	NA	NA	NA
WP_022650865.1|532855_533176_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_022650864.1|533175_533415_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
WP_047727415.1|533497_534793_-	hypothetical protein	NA	G8C7R8	Escherichia_phage	51.9	1.7e-95
WP_047727417.1|534854_535823_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.8	3.8e-55
WP_047727419.1|535826_538625_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	71.7	0.0e+00
WP_023296815.1|538624_539023_-	hypothetical protein	NA	S4TR39	Salmonella_phage	82.6	7.0e-64
WP_047727420.1|539029_539614_-	hypothetical protein	NA	S4TND4	Salmonella_phage	84.5	2.8e-93
WP_047727422.1|539613_540207_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	83.2	1.3e-93
WP_047727490.1|540344_541151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126313537.1|541161_541458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727426.1|541500_543993_-|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	52.3	2.2e-203
WP_047727428.1|544411_544714_-	hypothetical protein	NA	Q9MCU7	Escherichia_phage	62.2	2.1e-28
WP_032104576.1|544698_545079_-|tail	phage tail assembly protein	tail	K7PJU9	Enterobacteria_phage	78.2	4.8e-46
WP_047727429.1|545132_545624_-|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	72.2	1.2e-62
WP_047727432.1|545679_546045_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	69.4	2.1e-46
WP_047727434.1|546041_546581_-	HK97 gp10 family phage protein	NA	Q9MCV1	Escherichia_phage	83.2	3.0e-78
WP_047727435.1|546573_546906_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	85.5	3.1e-49
WP_047727437.1|546907_547120_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	64.3	3.6e-11
WP_047727438.1|547189_547516_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	61.1	1.0e-28
WP_047727440.1|547512_548556_-	hypothetical protein	NA	S4TNN1	Salmonella_phage	80.1	5.5e-92
WP_047727442.1|548552_549911_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.2	4.1e-257
WP_047727445.1|550114_552049_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.3	0.0e+00
WP_087924271.1|552107_553769_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
WP_047727448.1|553765_554260_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	99.4	3.8e-83
WP_047727450.1|554366_554735_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	87.7	2.9e-56
WP_047727451.1|554727_555309_-	hypothetical protein	NA	S4TR53	Salmonella_phage	70.9	5.2e-76
WP_164913335.1|555302_555884_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	1.1e-14
WP_047727453.1|555942_557400_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.0	5.6e-276
WP_047727455.1|557543_557807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727457.1|557840_558023_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	84.1	2.1e-15
WP_047727459.1|557979_558258_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	76.1	9.0e-26
WP_047727461.1|558475_559105_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	5.1e-101
WP_047727463.1|559104_559383_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.0	1.3e-37
WP_047727464.1|559372_559762_-	membrane protein	NA	G8C7V8	Escherichia_phage	96.9	2.9e-62
WP_047727466.1|560348_560927_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	2.1e-45
WP_047727467.1|560939_561929_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	90.0	3.3e-179
WP_047727491.1|561925_562642_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.2	1.4e-54
WP_045326198.1|562666_563056_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.2e-62
WP_047727469.1|563052_563373_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	76.4	1.9e-43
WP_047727470.1|563592_564252_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	7.7e-100
WP_047727472.1|564251_564746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727473.1|564742_565621_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.0	7.7e-39
WP_032619902.1|565610_565790_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_023315870.1|565953_566508_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_071842884.1|566536_566788_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_047727474.1|566822_567575_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.6	2.0e-80
WP_047727475.1|567676_568219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727476.1|568206_568983_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_047727477.1|569009_569207_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	2.2e-18
WP_047727492.1|569926_570340_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	1.4e-54
WP_045617025.1|570339_571167_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	86.3	2.8e-123
WP_047727478.1|571163_571889_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	40.8	7.1e-30
WP_045617028.1|571885_572023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045617030.1|572089_572359_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	80.9	6.6e-34
WP_022650818.1|572391_572655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727479.1|572629_573772_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.9e-93
576593:576607	attR	AGCGCCCTGAAGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	879690	909409	5172197	terminase,integrase,holin,portal,head,tail,capsid	Cronobacter_phage(89.66%)	37	877742:877763	909481:909502
877742:877763	attL	ATGGGTTTTTTGTTGCCTGAAA	NA	NA	NA	NA
WP_128754872.1|879690_881367_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.7	7.0e-206
WP_087924275.1|881369_881918_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.4	8.2e-63
WP_087924276.1|881889_882615_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.5	7.0e-62
WP_080397725.1|882604_883147_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.8	5.3e-22
WP_058656847.1|885216_885804_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	7.6e-91
WP_087924277.1|885796_886981_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.0	5.3e-176
WP_042863239.1|886977_887307_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.5	3.5e-37
WP_087924278.1|887303_889577_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.8	1.9e-214
WP_013097388.1|889764_890025_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.8	2.1e-21
WP_042863242.1|890144_890513_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	1.8e-21
WP_042863243.1|890512_890854_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	1.4e-49
WP_042863244.1|890840_891140_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	51.6	4.4e-18
WP_087924280.1|891149_891605_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	2.7e-59
WP_087924281.1|891601_892729_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.6	3.6e-174
WP_087924282.1|892725_893433_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	6.8e-102
WP_087924283.1|893429_893936_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.9	3.9e-67
WP_128754873.1|893932_894424_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	77.3	3.2e-58
WP_087924285.1|894483_895185_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.7e-85
WP_042863249.1|895188_896211_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.7	3.2e-153
WP_087924286.1|896270_897065_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.4	9.4e-68
WP_087924287.1|897237_899013_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	8.3e-290
WP_063946750.1|899009_900062_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.9	3.1e-159
WP_044158755.1|900058_900382_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	89.4	7.4e-48
WP_013097403.1|900355_900568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128754878.1|900687_902703_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.2	5.1e-304
WP_087924289.1|902704_902917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087924290.1|902913_903780_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	94.3	2.0e-148
WP_013097407.1|903770_904004_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_047743685.1|904070_904472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097409.1|904471_904900_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
WP_013097410.1|904889_905084_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_087924291.1|905093_905597_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	2.9e-59
WP_087924292.1|905629_905851_-	regulator	NA	NA	NA	NA	NA
WP_087924293.1|905976_906543_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	42.2	1.4e-36
WP_063435276.1|906545_907679_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087924294.1|907684_908281_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_087924295.1|908353_909409_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.6	1.2e-105
909481:909502	attR	ATGGGTTTTTTGTTGCCTGAAA	NA	NA	NA	NA
>prophage 3
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	1455784	1464471	5172197	integrase	Enterobacteria_phage(50.0%)	10	1460126:1460139	1466900:1466913
WP_087924307.1|1455784_1457548_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	43.8	2.5e-105
WP_087924308.1|1457544_1457859_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_020686326.1|1457869_1458073_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	54.8	5.8e-14
WP_087924309.1|1458188_1459064_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_087924310.1|1459056_1459245_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032677338.1|1459377_1459569_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_063942705.1|1459617_1460190_-	transporter	NA	A0A1W6JPH8	Morganella_phage	65.1	7.7e-56
1460126:1460139	attL	ATATCATCGCTGCT	NA	NA	NA	NA
WP_087924311.1|1460210_1460423_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	40.7	1.4e-07
WP_087924312.1|1461649_1462864_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.7e-132
WP_017383130.1|1463217_1464471_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	6.2e-98
1466900:1466913	attR	AGCAGCGATGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	1992859	2031968	5172197	integrase,transposase	uncultured_Caudovirales_phage(23.08%)	38	2015804:2015819	2034108:2034123
WP_004115409.1|1992859_1993891_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004115412.1|1993950_1995570_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004115414.1|1995636_1997112_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	31.5	2.6e-47
WP_004115417.1|1997272_1998658_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_025760278.1|1999514_1999766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742914.1|1999840_2001274_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.5	1.1e-103
WP_025760317.1|2001315_2002515_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.1	1.1e-32
WP_077254457.1|2002650_2003247_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	26.6	2.8e-08
WP_053287147.1|2003242_2003470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287146.1|2003486_2004212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742913.1|2004302_2005235_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025760314.1|2005231_2005750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760313.1|2005757_2006723_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001515173.1|2006905_2007229_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_025760312.1|2007231_2008098_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000427619.1|2008592_2009597_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_031591996.1|2010196_2010550_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	6.9e-23
WP_031591995.1|2010597_2010960_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_031591994.1|2010976_2012728_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_031591992.1|2012774_2014064_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	3.5e-173
WP_031591991.1|2014076_2014502_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.1e-50
WP_032742911.1|2014692_2015673_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
2015804:2015819	attL	CTTATTCGCACCTTCC	NA	NA	NA	NA
WP_004729618.1|2016212_2016986_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.0	7.3e-09
WP_001194072.1|2017051_2017753_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_023287189.1|2017818_2018925_-	alkene reductase	NA	NA	NA	NA	NA
WP_008502229.1|2019138_2019468_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000888080.1|2019497_2019836_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|2019840_2020422_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|2020563_2021121_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|2021307_2021892_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	9.7e-22
WP_032742905.1|2022051_2025036_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	9.9e-304
WP_000427619.1|2025114_2026119_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032742903.1|2026730_2027663_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032742901.1|2027768_2028755_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.9	3.8e-50
WP_032742899.1|2028855_2029503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742894.1|2029584_2029950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118087.1|2030045_2030405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742891.1|2031068_2031968_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2034108:2034123	attR	CTTATTCGCACCTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	3359066	3396940	5172197	integrase,transposase	uncultured_Caudovirales_phage(42.86%)	37	3390424:3390438	3401318:3401332
WP_100185530.1|3359066_3359981_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_000900745.1|3360146_3360464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|3360514_3360922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|3361379_3362051_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|3362095_3362401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|3362423_3362741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|3362962_3364309_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000589340.1|3364367_3365171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239970.1|3366698_3367139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|3367156_3367963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125668.1|3368257_3369661_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|3369693_3370398_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|3370484_3370805_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|3370850_3372140_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|3372152_3372578_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|3372637_3373465_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|3373483_3374962_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|3375453_3375729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|3375869_3376067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|3377053_3377311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|3377384_3377699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|3377746_3378643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942328.1|3378645_3379161_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|3379375_3380803_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|3380863_3381031_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	54.5	1.9e-07
WP_000078514.1|3381053_3382373_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|3382652_3383858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|3383854_3384673_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|3385138_3385411_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|3385533_3386649_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|3386906_3387341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071957456.1|3387558_3388788_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.1e-18
WP_031942326.1|3389520_3390195_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	2.5e-130
3390424:3390438	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_046622360.1|3391313_3392105_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845039.1|3392250_3393264_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|3393334_3394039_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|3395935_3396940_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
3401318:3401332	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
>prophage 6
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	3400114	3463536	5172197	integrase,transposase,protease	Escherichia_phage(40.91%)	54	3420014:3420073	3440329:3441150
WP_001120891.1|3400114_3400654_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|3400863_3401724_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|3401906_3402464_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|3403026_3404289_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|3404544_3405420_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|3405466_3405799_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|3408120_3408825_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|3410018_3410561_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|3410573_3411434_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|3411540_3412245_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|3412876_3413707_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3413837_3414392_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3414535_3415240_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|3415841_3416447_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	31.2	1.9e-12
WP_001553819.1|3416541_3419439_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
3420014:3420073	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|3420066_3420771_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199413.1|3421649_3424667_+|transposase	Tn3-like element IS3000 family transposase	transposase	NA	NA	NA	NA
WP_014386481.1|3425239_3425884_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|3426756_3427461_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|3428006_3429020_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|3429175_3429649_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_001144737.1|3429869_3430136_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|3430278_3431043_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|3431303_3432518_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|3432551_3433955_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|3434366_3434573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886840.1|3434577_3435045_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|3435103_3435808_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013851371.1|3435844_3436348_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_031942321.1|3436862_3438062_-	tetracycline efflux MFS transporter Tet(A)	NA	A0A2H4UVM2	Bodo_saltans_virus	22.4	8.2e-07
WP_013851373.1|3438167_3438809_+	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_078310596.1|3439172_3439370_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_001067855.1|3439630_3440335_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001371925.1|3444244_3444625_+	hypothetical protein	NA	NA	NA	NA	NA
3440329:3441150	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTTTCATCAACCTGCGTAGGGGCAGGCATAACCGGTTGGGAATTGCCCTTCAACTCACAACTGCCCGCTTTCTGGGAACCTTCTTGTCCGATCTCATGCAAATACCGCCCGGTGTCCAGTTTTATGTCGCAAGGCAACTTAACATCCGCTATCCAGAGATCATTTCCCGCTATGCTCAAAGGGAAAACACACGTTGGGAGCACCACGGGCTTATCAGGCAGCACTATAGCTATCATGATTTCGGTGATTTCCCGTGGTCGTTCAGACTGAAGCGATTGCTGTATACCCGTGCATGGCTCAGTAATGAACGCCCCGGACTGATGTTCGATTTTGCCACCGCGTGGTTGCTTCAAAATAAAGTGTTGTTGCCAGCCGCATCCACCCTGACGAGAGTCATTGGTGAAATCCGTGAGCGTGCGACCCGCCGCTTGTGGCGAAAATTGGCCGCGCTGCCAAACCGTTGGCAGACCGCACAACTGGCTGGGTTACTTGAAATCCCCGAAGGACAGCGACTCTCAGTGATGGAGCACCTAAAAAGAGGCCCTGTCACTATCAGCGGCCCCGCGTTCACTGAAGCACTTGAACGTTACACTCGCCTGCGCAGCCTGGAGTTTTCCTGTCTGAATTTCACTGGGCTGCCCGCCATACAGCTCCGCAATCTGGCACGCTATGCCGGAATGGCATCGGTGAAATATATCAGCAGAATGCCAGAAGAACGGCGGCTGGCGATCCTTACCGCATTCGTGAAAGCGCAAGAAATCTC	NA	NA	NA	NA
WP_000490639.1|3444682_3445306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|3445351_3446332_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_000916941.1|3446607_3447063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|3447103_3447340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100635.1|3447365_3447659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|3447836_3448241_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000784387.1|3448847_3449705_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001224686.1|3449720_3450029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278471.1|3450577_3451003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001641519.1|3451255_3452071_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000985909.1|3452083_3452494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|3452594_3452801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088044.1|3452861_3454187_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012477377.1|3454191_3454485_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000083579.1|3454885_3456274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|3456278_3456776_-	membrane protein	NA	NA	NA	NA	NA
WP_000462754.1|3456978_3457635_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000341066.1|3458293_3458686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211823.1|3459606_3460593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|3462531_3463536_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	3628507	3636627	5172197		uncultured_Caudovirales_phage(62.5%)	11	NA	NA
WP_016151342.1|3628507_3629086_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
WP_004206572.1|3629261_3630467_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206574.1|3630477_3630783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007898876.1|3630911_3631610_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_022649397.1|3631695_3632016_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898880.1|3632060_3633350_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_007898882.1|3633362_3633788_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898884.1|3633901_3634180_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|3634510_3634804_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|3634902_3635670_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|3635670_3636627_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
>prophage 8
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	4074955	4084472	5172197	integrase,capsid	Enterobacteria_phage(83.33%)	10	4066613:4066627	4087744:4087758
4066613:4066627	attL	CAGCTCTTCCGGGGT	NA	NA	NA	NA
WP_087924338.1|4074955_4077289_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_087924339.1|4077303_4077624_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_017692848.1|4077620_4077848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059353804.1|4077844_4078402_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.7	5.4e-30
WP_164913349.1|4078398_4078665_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	4.9e-29
WP_087924340.1|4079215_4079959_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_001572531.1|4079961_4080180_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	66.7	5.1e-16
WP_087924341.1|4080208_4080772_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.7	2.8e-58
WP_087924342.1|4081283_4083239_+	AIPR family protein	NA	NA	NA	NA	NA
WP_087924343.1|4083275_4084472_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	3.4e-106
4087744:4087758	attR	CAGCTCTTCCGGGGT	NA	NA	NA	NA
>prophage 9
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	4124917	4180156	5172197	integrase,terminase,holin,tail,tRNA	Salmonella_phage(20.75%)	67	4132493:4132508	4153494:4153509
WP_017383555.1|4124917_4126003_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|4126042_4126732_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|4127047_4127431_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045911879.1|4127483_4128812_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	8.1e-48
WP_017383553.1|4128944_4129682_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_017692868.1|4129666_4131286_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_006176728.1|4131711_4132287_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_015572138.1|4132318_4132969_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
4132493:4132508	attL	GTTATGGCGGCCATTG	NA	NA	NA	NA
WP_003860717.1|4132968_4133922_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572140.1|4133918_4134395_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_006811608.1|4134826_4136056_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_022651668.1|4136033_4136318_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_017692869.1|4136364_4136607_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_032635810.1|4136593_4137205_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.5	4.7e-43
WP_022651666.1|4137239_4138325_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_047727244.1|4138334_4141400_-	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.7	0.0e+00
WP_022651664.1|4141522_4141810_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_022651663.1|4141893_4142052_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_022651662.1|4142061_4142247_-	YebW family protein	NA	NA	NA	NA	NA
WP_032645736.1|4142545_4142956_-	helix-turn-helix domain-containing protein	NA	A0A0H5BBV1	Pseudomonas_phage	42.0	1.5e-05
WP_022651660.1|4143071_4143299_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.3	3.8e-14
WP_022651659.1|4143301_4143844_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	53.9	2.6e-45
WP_022651658.1|4143859_4144105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651657.1|4144278_4145271_+	hypothetical protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_022651656.1|4145254_4145947_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	60.0	3.5e-79
WP_022651655.1|4145958_4146645_+	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_047727245.1|4146648_4146909_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	72.3	8.1e-29
WP_047727246.1|4146905_4147391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727247.1|4147393_4148140_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.4	2.6e-67
WP_047727249.1|4148136_4150125_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	5.6e-202
WP_072058988.1|4150299_4151022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006811588.1|4151183_4151417_+	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	79.2	5.2e-27
WP_045911876.1|4151821_4152421_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	87.8	2.7e-99
WP_045911882.1|4152426_4152627_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	68.2	1.3e-21
WP_017692886.1|4152629_4152911_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	98.9	1.6e-46
WP_045343112.1|4152907_4153264_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.1	6.9e-63
WP_017692888.1|4153260_4153398_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.4	1.3e-09
WP_047727253.1|4153394_4154207_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	70.7	6.8e-106
4153494:4153509	attR	GTTATGGCGGCCATTG	NA	NA	NA	NA
WP_006811580.1|4154350_4154722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045911875.1|4155283_4156255_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	3.8e-71
WP_015570936.1|4156433_4156820_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_072052510.1|4156806_4157088_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	43.0	6.5e-16
WP_045911873.1|4157087_4157717_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.1	3.6e-99
WP_023314673.1|4157724_4157994_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.3	9.0e-31
WP_003859853.1|4159089_4159320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045911872.1|4159539_4160514_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.0	1.1e-38
WP_045349479.1|4160515_4161823_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	1.9e-142
WP_045911871.1|4161824_4163213_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.5	1.6e-126
WP_045331452.1|4163214_4164306_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	57.9	6.7e-117
WP_045911870.1|4164392_4165163_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.0	2.2e-69
WP_045911869.1|4165175_4166129_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	9.0e-134
WP_158002220.1|4166080_4166410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045343117.1|4166446_4166929_+	hypothetical protein	NA	A0A2I2L6M9	Escherichia_phage	35.4	4.0e-13
WP_045343118.1|4166930_4167281_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	54.3	3.6e-32
WP_045911868.1|4167282_4167867_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	3.8e-50
WP_045911867.1|4167863_4168274_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	50.0	4.3e-32
WP_045911866.1|4168331_4169003_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.4	3.3e-50
WP_022651271.1|4169064_4169376_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_032654529.1|4169372_4169687_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	8.6e-17
WP_045911864.1|4169683_4172596_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	34.8	1.8e-132
WP_020690998.1|4172670_4173024_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_015570921.1|4173080_4173428_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	7.5e-38
WP_032654526.1|4173424_4174180_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	76.4	6.3e-114
WP_045911863.1|4174181_4174892_+	peptidase P60	NA	K7PJX1	Enterobacterial_phage	97.0	1.0e-142
WP_015570918.1|4174925_4175555_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	1.6e-54
WP_047727257.1|4175607_4179189_+|tail	phage tail protein	tail	Q9MCR7	Enterobacteria_phage	85.2	0.0e+00
WP_045911861.1|4179190_4180156_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	6.3e-58
>prophage 10
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	4653707	4662410	5172197		Organic_Lake_phycodnavirus(14.29%)	8	NA	NA
WP_045910860.1|4653707_4654547_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.8	1.6e-12
WP_023303973.1|4654661_4656068_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_045910859.1|4656157_4657243_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.5	1.1e-98
WP_045910858.1|4657243_4658125_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	4.0e-104
WP_045910857.1|4658364_4659531_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	3.1e-112
WP_045910856.1|4659580_4660585_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_045910855.1|4660778_4661759_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_017693103.1|4661798_4662410_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 11
NZ_CP021749	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0163 chromosome, complete genome	5172197	5038929	5045425	5172197		uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_000847113.1|5038929_5039631_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.4	5.9e-90
WP_006810860.1|5039720_5040041_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	7.0e-22
WP_047727499.1|5040087_5041377_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.0	7.6e-168
WP_006810858.1|5041392_5041818_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	6.8e-49
WP_001273865.1|5041985_5042543_-	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	2.1e-26
WP_006810857.1|5042679_5043096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006810855.1|5043458_5044688_-	hypothetical protein	NA	A0A1W6DWU6	Sphingobium_phage	24.7	4.0e-09
WP_154591465.1|5044653_5044809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006810853.1|5044990_5045425_-	hypothetical protein	NA	B5BTV7	Ralstonia_phage	58.1	1.2e-05
