The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	991540	1003194	5380979	integrase	Enterobacteria_phage(70.0%)	13	979674:979688	1002731:1002745
979674:979688	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|991540_993874_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|993885_994206_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|994202_994430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|994426_994984_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|994980_995247_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|995788_996526_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|996522_996768_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|996785_997352_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|997920_998346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|998345_999296_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|999283_1000474_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1000826_1002080_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1002090_1003194_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1002731:1002745	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	1212749	1258024	5380979	integrase,lysis,tRNA,head	Escherichia_phage(26.42%)	63	1215632:1215678	1264766:1264812
WP_004143010.1|1212749_1214135_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1214180_1214393_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1214394_1215261_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1215632:1215678	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1215691_1216855_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1216731_1217067_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1217068_1217284_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1217285_1217504_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1217500_1218268_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1218264_1218921_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1218917_1219076_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1219072_1219753_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1219749_1220595_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1220610_1220895_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1220983_1221178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1221277_1221493_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1221843_1222533_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1222660_1222894_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1222934_1223156_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|1223380_1224280_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|1224269_1225700_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|1225699_1225993_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1225989_1226496_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1226602_1227445_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|1227617_1228265_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1228765_1229221_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1229220_1229391_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1229383_1230019_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1230015_1230153_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1230145_1230676_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1230672_1231362_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1232271_1232520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|1232522_1233053_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1233049_1233514_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1233619_1233949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1234319_1234922_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1234921_1236394_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1236406_1237828_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1237802_1238807_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1238848_1239325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1239397_1240783_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1240786_1241215_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1241226_1242321_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1242331_1242571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1242573_1242954_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1242953_1243127_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1243126_1243489_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1243491_1243917_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1243913_1244306_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1244374_1245127_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1245179_1245857_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1246032_1246788_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1246790_1247045_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1247338_1247809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1247825_1248185_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1248284_1248455_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1248444_1249158_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1249223_1250009_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1250136_1250640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1250732_1254179_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|1254278_1254698_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|1254697_1255168_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1255164_1255560_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1255546_1258024_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
1264766:1264812	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	1703134	1740470	5380979	terminase,integrase,head,lysis,capsid,portal,tail,plate	Salmonella_phage(84.62%)	46	1703042:1703060	1740542:1740560
1703042:1703060	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1703134_1704187_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|1704605_1706090_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1706188_1707133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1707144_1708023_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1708168_1708390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1708422_1708932_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1708939_1709140_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1709103_1709445_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1709512_1709746_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1709745_1709973_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1709969_1710827_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1710823_1713238_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1713391_1713580_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1713590_1713824_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1713938_1714616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1714891_1716634_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1716695_1717721_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1717720_1719487_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1719629_1720463_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1720479_1721538_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1721541_1722192_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1722287_1722752_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1722751_1722955_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1722958_1723174_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1723154_1723664_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1723668_1724052_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1724048_1724477_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|1724572_1725004_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1724996_1725443_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1725439_1726132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1726226_1726799_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1726795_1727158_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1727144_1728053_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1728045_1728645_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1728646_1731598_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1731601_1732333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1732329_1732533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1732562_1733639_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1733777_1734950_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1734959_1735475_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1735527_1735827_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1735841_1735961_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1735953_1738581_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1738577_1739063_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1739059_1740160_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1740251_1740470_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1740542:1740560	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	1774886	1784350	5380979	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1774886_1776002_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1775998_1777939_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1778015_1778237_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1778562_1778880_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1778910_1781190_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1781310_1781529_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1781882_1782584_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1782628_1784350_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	2172379	2230195	5380979	terminase,integrase,transposase,holin,tail	Enterobacteria_phage(20.75%)	67	2164357:2164372	2187196:2187211
2164357:2164372	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004140269.1|2172379_2173189_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2173190_2174183_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2174182_2175073_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|2175249_2176437_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|2176644_2177307_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2177303_2177732_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2177728_2178409_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2178410_2178698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2178694_2179540_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2179555_2179840_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2179928_2180123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2180551_2180755_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2180836_2181913_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|2182058_2182178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|2182200_2182899_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2183010_2183238_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2183278_2183500_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2183585_2184446_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2184442_2185291_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2185287_2185590_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2185645_2185891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2186098_2187127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|2187647_2188115_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
2187196:2187211	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004243010.1|2188095_2188263_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2188259_2188928_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2188920_2189559_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2189555_2189696_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2189695_2190385_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|2191034_2191334_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2191330_2191870_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|2191866_2192211_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2192207_2192483_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2193441_2193687_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2194549_2195554_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|2195531_2196839_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|2196838_2198239_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|2198222_2199335_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004217351.1|2199865_2200651_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2200661_2201615_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217348.1|2201936_2202332_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|2202333_2202588_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|2202597_2202831_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2202817_2203201_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|2203202_2203754_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|2203750_2204143_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2204166_2205339_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2205392_2205875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|2206012_2206219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2206295_2206652_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|2206876_2207068_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|2207329_2210227_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|2210310_2210646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2210960_2211425_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2211605_2212088_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2212097_2212478_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2212474_2215543_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|2215619_2218574_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|2218577_2219309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2219533_2220133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2220374_2222318_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2222566_2223271_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|2223863_2224286_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|2225183_2226668_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2226747_2227167_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2227168_2228434_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2228509_2229337_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2229523_2230195_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 6
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	2263128	2302900	5380979	terminase,integrase,transposase	uncultured_Caudovirales_phage(35.42%)	57	2261209:2261223	2270149:2270163
2261209:2261223	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2263128_2263890_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2264106_2265639_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2265837_2266386_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2266582_2267764_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2267744_2267987_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2268165_2268645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2268641_2268854_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2268850_2269075_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2269064_2269775_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2269780_2270299_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2270149:2270163	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2270403_2271231_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2271227_2271422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2271418_2271844_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2271840_2272059_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2272030_2272285_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2272277_2272643_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2272812_2273001_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2272993_2273308_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2273478_2274147_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2274244_2274466_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2275042_2276701_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2276702_2277665_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2277661_2278138_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2278134_2278917_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2279322_2279571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2279573_2280104_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2280100_2280490_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2280724_2281045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2281146_2281899_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2281849_2283250_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2283487_2284939_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2284994_2285543_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2285594_2286797_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2286800_2287295_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2287306_2288248_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2288287_2288569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2288537_2288957_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2288953_2289460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2289459_2289846_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2289940_2290381_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2290384_2291530_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2291540_2291831_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2291771_2292964_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2293290_2293716_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2293751_2293904_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2293893_2295897_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2295896_2296496_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2296496_2296799_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2296801_2297824_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2297823_2298165_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2298214_2298397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2298439_2299006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2299059_2299713_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2299714_2300068_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2300067_2301264_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2301260_2302034_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2302033_2302900_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	2526270	2537157	5380979		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2526270_2526891_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2526883_2528149_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2528160_2529063_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2529323_2530085_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2530105_2530966_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2531263_2531524_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2531610_2532699_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2532729_2533995_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2534049_2537157_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	3192934	3236033	5380979	transposase,tRNA,plate	Microcystis_virus(25.0%)	40	NA	NA
WP_002910404.1|3192934_3194191_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3194461_3195073_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|3195069_3195921_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3196104_3197052_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3197176_3198856_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3198856_3199903_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3200125_3200401_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3200673_3201258_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3201375_3202467_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3202549_3202759_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3202960_3203875_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3204006_3205422_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3205441_3205885_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3205887_3206424_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|3206404_3207451_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3207450_3209214_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3209347_3212758_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3212741_3213899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3213902_3214169_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|3214466_3214724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|3214912_3215149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3215272_3216253_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3216589_3217480_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3217655_3218549_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|3218724_3219618_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|3219801_3220695_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3220716_3221022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|3221045_3222155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|3222260_3222491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3222536_3223043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3223039_3223369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3223365_3223548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|3223689_3224613_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|3226263_3226773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3227009_3227516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3227512_3228022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3228022_3229378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|3232341_3234039_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3234042_3234696_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3234692_3236033_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	3503721	3511346	5380979		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3503721_3504723_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3504916_3506083_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3506263_3506818_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3506832_3507723_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3507754_3508624_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3508650_3509715_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3509939_3511346_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 10
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	3547913	3554820	5380979	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3547913_3549392_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3549388_3550111_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3550429_3551791_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|3552036_3552930_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3553172_3553946_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3553956_3554820_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	3959968	4039578	5380979	terminase,integrase,head,lysis,capsid,coat,portal,tRNA,tail,plate	Salmonella_phage(71.43%)	86	4004672:4004718	4041239:4041285
WP_002914079.1|3959968_3960706_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|3960837_3962169_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|3962214_3962598_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|3962911_3963601_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|3963658_3964744_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|3964947_3965373_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|3965442_3966141_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|3966175_3968836_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|3968956_3970312_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|3970353_3970677_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|3970680_3971979_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|3977944_3980518_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|3980647_3981379_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|3981375_3982356_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|3982487_3983225_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|3983495_3983831_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|3983937_3983985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|3984085_3985246_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|3985242_3986115_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|3986177_3987299_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|3987308_3988379_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|3988721_3989231_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|3989223_3990447_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|3990460_3990943_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|3990951_3992322_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|3992378_3992837_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3992956_3993304_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|3993343_3994111_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|3994142_3994691_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|3994709_3994958_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|3995217_3996582_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|3996745_3997537_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|3997556_3998843_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|3998962_3999553_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|3999677_4000556_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4000642_4002304_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4002451_4002793_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4002859_4003150_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4003139_4003616_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4003726_4004209_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4004672:4004718	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4004812_4005190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4005217_4005436_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4005502_4006597_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4006593_4007079_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4007075_4009706_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4009698_4009818_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4009832_4010132_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4010184_4010700_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4010709_4011882_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4012030_4013104_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4013155_4014274_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4014283_4016233_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4016234_4016906_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4016898_4017807_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4017793_4018156_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4018152_4018725_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4018819_4019686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4019708_4020155_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4020147_4020570_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|4020665_4021094_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4021090_4021474_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4021478_4021988_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4021968_4022184_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4022187_4022391_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4022390_4022855_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4022950_4023604_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4023607_4024660_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4024676_4025510_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4025650_4027414_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4027413_4028457_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4028513_4028783_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4029304_4030306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4030305_4031385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4031371_4032055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4032150_4032384_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4032395_4032584_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4032746_4035131_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4035127_4035979_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4035975_4036203_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4036202_4036436_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4036503_4036842_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4036805_4037006_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4037013_4037523_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4037555_4037798_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4037920_4038550_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4038552_4039578_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4041239:4041285	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 12
NZ_CP021751	Klebsiella pneumoniae strain AR_0113 chromosome, complete genome	5380979	4758735	4807578	5380979	terminase,protease,head,capsid,portal,tRNA,tail	uncultured_Caudovirales_phage(66.67%)	54	NA	NA
WP_002918465.1|4758735_4759230_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4759233_4759872_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4760183_4760576_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4760591_4761020_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4761285_4762413_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4762603_4763002_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4763175_4764543_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4764630_4765689_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4765825_4766764_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4767178_4767649_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4768024_4768288_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4768386_4768653_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4768703_4768979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4769058_4771026_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4771031_4771964_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4771971_4772175_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4772306_4773236_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4773271_4774717_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4774805_4778603_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4778640_4780110_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4780112_4780694_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4780701_4781190_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4781189_4782182_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4782252_4783296_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4783601_4785542_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4785621_4785813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4786041_4787043_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4787042_4787651_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4787874_4788327_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4788349_4788817_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4788827_4790177_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4790287_4790530_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4790519_4791971_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4791982_4792864_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4793221_4794187_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4794211_4794508_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4794661_4794853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4794855_4796517_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4796500_4796857_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|4797132_4797576_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4797575_4797875_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4797871_4798207_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4798203_4799445_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4799446_4800007_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4800058_4801225_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4801488_4802001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4802049_4802385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4802727_4804863_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4804862_4805228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4805224_4805593_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4805589_4805904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4805896_4806085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4806077_4806347_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4806798_4807578_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	0	8178	209550	transposase	Enterobacteria_phage(50.0%)	5	NA	NA
WP_071527925.1|480_723_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|1020_2025_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|2428_3439_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|3899_4982_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|5103_8178_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
>prophage 2
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	20199	20751	209550		Wolbachia_phage(100.0%)	1	NA	NA
WP_004152294.1|20199_20751_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
>prophage 3
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	25858	26584	209550		Xanthomonas_phage(100.0%)	1	NA	NA
WP_004152303.1|25858_26584_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
>prophage 4
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	60736	64339	209550		Cronobacter_phage(25.0%)	7	NA	NA
WP_004178064.1|60736_61558_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_004152722.1|62391_62805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|62805_63084_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|63073_63394_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|63474_63699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152718.1|63709_63922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|63982_64339_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 5
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	69759	74044	209550		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_004178066.1|69759_71796_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152643.1|71865_72114_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152644.1|72162_72705_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152645.1|73480_74044_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
>prophage 6
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	77181	166214	209550	transposase,protease,integrase	Escherichia_phage(15.62%)	78	73568:73584	104629:104645
73568:73584	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004152754.1|77181_77436_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|77672_78098_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004152753.1|78618_78849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|79082_80567_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|80972_81398_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|81397_82669_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152062.1|85620_86592_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|86591_87758_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|88509_89520_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_001515717.1|90236_90977_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|92120_93068_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|93094_93406_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|93470_94394_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|95066_95324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|95925_97380_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|98362_99640_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|99702_101700_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|102739_103947_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|105375_105807_-	silver-binding protein SilE	NA	NA	NA	NA	NA
104629:104645	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_003032875.1|106057_107533_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|107525_108206_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|108395_109781_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|109809_110163_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|110276_111569_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|111579_114726_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|114812_115253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|115379_117827_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|117867_118065_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|118098_118836_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|119124_119574_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|119807_121625_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|121624_122521_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|122560_122941_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|122945_123875_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|123929_124610_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|124606_126007_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|126223_126658_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|126889_127069_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|128811_129321_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|129370_129868_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|130199_130526_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|130525_131236_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|131244_131790_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|131865_132228_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|134124_134661_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|134693_135119_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|135131_136421_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|136468_138220_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|138237_138600_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|138649_139000_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|139357_139627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|139614_140190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|140220_140715_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|140758_141127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|141160_141364_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|141412_141670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|141745_142000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|142175_142442_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|142429_142912_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|143123_144470_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|146312_147275_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|147261_148011_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|148248_148446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|148445_151241_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|151355_151925_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|151959_152241_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|152484_152748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|152762_153026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|154227_155208_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|156416_157286_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|157279_158290_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|158298_159126_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|159134_159998_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|159994_160822_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_001067855.1|161677_162382_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_044117068.1|163685_164354_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|164543_165359_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|165509_166214_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	169552	188554	209550	transposase,integrase	Escherichia_phage(18.18%)	21	162862:162876	180203:180217
162862:162876	attL	CTGCTGTACCACGAA	NA	NA	NA	NA
WP_001389365.1|169552_170317_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|170543_170849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|170859_172065_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|172220_172424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|172551_173391_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|173384_173732_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|173895_174687_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|174692_174983_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|175094_175592_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|175736_176750_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|176952_177303_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|177428_177989_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|177991_180958_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
180203:180217	attR	CTGCTGTACCACGAA	NA	NA	NA	NA
WP_000656305.1|181024_181402_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|181602_182262_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000333416.1|183878_184151_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004118216.1|184150_185539_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000005560.1|185531_186644_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|186640_187276_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_004114613.1|187832_188210_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004152557.1|188206_188554_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
>prophage 8
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	192376	195065	209550		Planktothrix_phage(50.0%)	2	NA	NA
WP_004118832.1|192376_194110_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|194117_195065_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
>prophage 9
NZ_CP021752	Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence	209550	208540	209308	209550		Bacillus_virus(100.0%)	1	NA	NA
WP_004152282.1|208540_209308_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
>prophage 1
NZ_CP021753	Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence	116187	56544	93861	116187	integrase,transposase	Salmonella_phage(28.57%)	32	56374:56433	92491:94178
56374:56433	attL	ACGTATAGGAAATTGAAAAACCAGTCGATACCATTGTCCACGCCTTATGCCACGTGAGCC	NA	NA	NA	NA
WP_000948429.1|56544_57744_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|57753_57942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443938.1|58981_60433_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009309939.1|60425_62468_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022644729.1|62654_68390_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_020802676.1|68851_71749_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|71843_72449_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|73108_74290_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|74716_75031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|75285_75642_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|75631_76033_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|76029_76320_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015065644.1|76394_79361_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|79439_80444_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|80625_80829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|80842_81046_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|81079_81448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802777.1|81491_81986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020317495.1|82016_82592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804424.1|82579_82849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|83285_83975_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|84006_84696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|85248_85467_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001568026.1|85468_85774_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_025380813.1|85978_86338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|86364_86688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315256.1|86684_87701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|87898_88693_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|89148_89328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|89447_90074_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_022644731.1|90706_91582_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	57.1	1.9e-82
WP_000948429.1|92661_93861_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
92491:94178	attR	ACGTATAGGAAATTGAAAAACCAGTCGATACCATTGTCCACGCCTTATGCCACGTGAGCCTTTCTGCTTTTCCCACCACTCCGGTGGTTTCCCTCTCTGTATGGTCGATTTTTATACCGTAACAGGCTGTTTTTTATACTTTCACCGATTCCCGGGCACACTTAGCCTGTGTCAGGCCGGCATATACCTCAGTAGACTGATATCCCGCGCGTTTTTCTTCAGCCCTGATACATTCAGCCCCGCAATGGCCCGGCGGTATACCATCCGGCAGCCACACAGCACGCATTCGAACGGGTCACGACTCAGGAACTGTTTCACCATTTGTGCATAGCACACTTTCGCCACTGGTTCCGGTTTATCCATCCCCAGTGCACGGTACACCTGCGGCAGCTTCTCTCCACACACACGGTTGGCAAGGAACCCGAAGTACCTCACCATCTTAAAAAACTTCTCCGGGATGTGCTGTTTCAGCCTCGCGACCAGCTCACGCTGTGTCAGCGTTTCCGTCGCCGTTTCTCCCGTTTTGTGGTCCAGGTAACGGAAGCTCAGGCTTGCCCCTCCGTTGTAATGAGCCAGTCGGGAAGCCGCTATTGGTGGCTTCTTCAGATAACGACCTAGGTAGCGTGCCGTATTCCGCCCTCCGGCTGTCTTCTTCGACATGTACACATGCCAGTATTTTCCGCCGGATTTCAGCACCAGGCTTCTCCACTGTGATTCCGTCGTGATATGTGACAACGACTCCGGCATTGCCATCCCCTCTGACCACGCTTTCAGAAGCAGCTGCCGCATATTCCACATCCACCGTGAACGCATCGCGTCTTTCAGGAAGCTCAGCTTTTTCCACTGACCATGCTTATTCAGACCTCCACAGGTTACAGACACATGTACATGCGGATGCCAGTTGAGACGACGGCCATACGTGTGGATGGCGCAGAAGATACCGGGTTCCAGCCCCCGTTTTCGGGCGGCATACAGCAGATTCTCCACCGCCAGACGGCACACGTCATTCAGCAGCCAGCGGTTGCTTTCGAACACCGGCCACAGCGTGTCCGGCAGGGTGAAGACCAGATGTACCCAGTCGCAGTCAGGAAGACGATTCAGCTGTGTTGCTGTCCACAGGTCTGTGGCCTTCTTTCCGCAGGACGGGCAGGCACGGCTGCCGCATGAGTTGGTCAGGTACTTTACGTGCTGACAGTCCGGGTTATCACACCCGAACTCTTTTACACCCAGTATCCGTGTGCCGCAGGCCAGCATTTTGGTGACGGCTTCAACCTCGATATCGCGCAGACCGCCCGCATCCAGGAAGGACGTCCAGCACTGGTTGGCTGTGAACAGACGTTTCAGAGGGCGGGGAGTAAAACCGGACAACATGAGGATGGATTAAACCCCGGTATCCTGTAGCAGGGTAAGGGCTGCTGTATCGCCACGGCGCTTCAGGATGGAGGTCGTCACCATCGCAGGTGGTGGGTCCATGGGTTTGAGCATTTTCATCCAGTCCCATTCTCGTTGTGAGAGCTTCTCAGCACCAACAGAGAGCAGAACTGTATCGATACTTTTGCGGGTCAACATAAGGGGATGAGTCCTTAATAAAACAGGTCCTCAGAGCATACATATTCTGCGGGGCGTGCGGCAACAACAGGACGAACCGGGGCGGTTTTCAATTTGCAGCCGCCAGGCTGCCGTGGTTC	NA	NA	NA	NA
>prophage 2
NZ_CP021753	Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence	116187	110189	115818	116187	transposase	Aeromonas_phage(33.33%)	8	NA	NA
WP_020314639.1|110189_111143_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|111263_111530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|111549_112170_-	resolvase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644718.1|112767_113394_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|113438_113666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|113840_115115_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_046960466.1|115126_115576_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314635.1|115572_115818_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
>prophage 1
NZ_CP021755	Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence	45740	0	3236	45740	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_001217881.1|835_1393_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|1626_2181_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|2531_3236_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP021755	Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence	45740	9100	42257	45740	transposase,integrase	Escherichia_phage(29.41%)	29	2240:2299	32887:33115
2240:2299	attL	CGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAG	NA	NA	NA	NA
WP_000015958.1|9100_9877_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|9934_10192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|10954_11821_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|11997_12267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|12681_13887_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_006797589.1|13883_14861_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|14942_16214_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|16213_16645_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|17053_18538_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001118624.1|21152_22076_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
WP_001039464.1|22215_22602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|23449_26416_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|26419_26980_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|27155_27506_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|27708_28722_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|28888_29731_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|29826_30435_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|30492_31284_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|31545_32805_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|32897_33689_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
32887:33115	attR	CGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAAC	NA	NA	NA	NA
WP_000800531.1|33858_34191_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|35370_36162_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|36630_36876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|36913_37777_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|37922_38162_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067858.1|38234_38939_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|39052_39829_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|40057_41083_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|41504_42257_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
>prophage 1
NZ_CP021756	Klebsiella pneumoniae strain AR_0113 plasmid unitig_5, complete sequence	22632	0	13062	22632	transposase,lysis	Escherichia_phage(50.0%)	13	NA	NA
WP_000072676.1|1759_2023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146176.1|2012_2312_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000312627.1|2373_2751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165971.1|2819_2999_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_004153058.1|3026_3557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152551.1|3563_4295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178196.1|4294_6259_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_004152552.1|7739_7889_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004152553.1|7973_8231_-	cloacin	NA	NA	NA	NA	NA
WP_004178188.1|8240_9926_-	cloacin	NA	NA	NA	NA	NA
WP_001067855.1|10661_11366_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|11716_12271_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|12504_13062_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 2
NZ_CP021756	Klebsiella pneumoniae strain AR_0113 plasmid unitig_5, complete sequence	22632	19137	22207	22632	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_004199214.1|19137_20163_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|20159_20939_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|21325_22207_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
