The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017065	Lactobacillus casei strain LC5 chromosome, complete genome	3132867	784152	889642	3132867	portal,terminase,protease,tRNA,integrase,holin,transposase,tail,head,capsid	Lactobacillus_phage(90.0%)	112	781376:781397	856827:856848
781376:781397	attL	TTTCTGCGACTGCGAACGCGTT	NA	NA	NA	NA
WP_087911750.1|784152_785670_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_087911751.1|785770_786124_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_087911752.1|786098_786296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049172871.1|786736_786931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087911753.1|787688_788231_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_075760706.1|788681_790382_+	APC family permease	NA	NA	NA	NA	NA
WP_087911754.1|790616_791825_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087911755.1|791827_792856_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087911756.1|792868_793888_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_087911757.1|794022_795195_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010493839.1|795361_795637_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_087911758.1|796132_798229_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.1	2.3e-153
WP_025013988.1|798530_798992_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_087911759.1|804788_805916_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.7	2.0e-212
WP_087911760.1|806023_806287_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	42.4	3.8e-10
WP_005714766.1|806425_806647_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
WP_005686889.1|806906_807584_-	hypothetical protein	NA	A0A2D1GPN7	Lactobacillus_phage	100.0	5.7e-90
WP_087911762.1|807645_808320_-	XRE family transcriptional regulator	NA	O64370	Lactobacillus_phage	98.7	2.8e-121
WP_087911763.1|808481_808727_+	helix-turn-helix transcriptional regulator	NA	B4XYR7	Lactobacillus_phage	97.5	1.5e-37
WP_087911764.1|808723_809494_+	phage antirepressor KilAC domain-containing protein	NA	O64368	Lactobacillus_phage	92.5	1.9e-81
WP_191981862.1|809490_809640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564805.1|809636_809837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087911765.1|809911_810268_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	96.6	7.7e-62
WP_005712709.1|810352_810505_+	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	100.0	2.4e-20
WP_087911766.1|810509_810713_+	hypothetical protein	NA	B4XYS2	Lactobacillus_phage	88.1	5.4e-28
WP_087911767.1|810731_811217_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	99.4	2.6e-81
WP_087911768.1|811217_811925_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	98.3	4.1e-131
WP_087911769.1|811928_812486_+	DUF669 domain-containing protein	NA	A8YQL6	Lactobacillus_phage	97.8	1.8e-102
WP_087911770.1|812500_813310_+	replication protein	NA	Q6J1V6	Lactobacillus_phage	60.4	3.4e-73
WP_087911771.1|813296_814079_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	89.6	6.1e-128
WP_064520376.1|814075_814408_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	86.4	5.1e-44
WP_087911772.1|814404_814854_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	88.5	6.5e-66
WP_087911773.1|814856_815240_+	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	94.5	3.0e-64
WP_087911774.1|815258_815714_+	phage N-6-adenine-methyltransferase	NA	A0A2P0ZL79	Lactobacillus_phage	60.4	1.2e-48
WP_087911775.1|815733_816198_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	95.0	1.7e-13
WP_016386784.1|816237_816501_+	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	97.7	6.5e-42
WP_016386783.1|816497_817022_+	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	52.2	3.3e-37
WP_160162859.1|817018_817177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087911776.1|817166_817529_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	51.2	4.9e-24
WP_087911777.1|817580_818168_+	HNH endonuclease	NA	A0A2H4PB31	Lactobacillus_phage	60.2	1.3e-53
WP_087911778.1|818164_818452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087911779.1|818448_818709_+	hypothetical protein	NA	C1KFT6	Lactobacillus_virus	84.9	4.9e-34
WP_087911780.1|818720_818930_+	hypothetical protein	NA	A0A2D1GPJ8	Lactobacillus_phage	85.5	1.9e-28
WP_087911781.1|818913_819285_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	57.1	6.4e-35
WP_087911783.1|819459_819678_+	hypothetical protein	NA	U5U734	Lactobacillus_phage	93.1	2.7e-33
WP_003575624.1|819679_819898_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IK26	Lactobacillus_phage	94.4	1.1e-31
WP_087911784.1|819971_820415_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	94.6	1.2e-75
WP_087911786.1|820771_821041_+	hypothetical protein	NA	Q8LTA5	Lactobacillus_phage	82.9	1.6e-11
WP_021354321.1|821012_821660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087911787.1|822276_823494_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	98.3	1.0e-238
WP_087911788.1|823480_823873_+	ribonucleoside-diphosphate reductase	NA	A0A0P0HRM1	Lactobacillus_phage	52.7	1.8e-27
WP_042745761.1|823874_824198_+	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	93.5	1.8e-49
WP_005688561.1|824416_825226_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	97.7	2.1e-147
WP_005686963.1|825421_825877_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	98.0	6.7e-79
WP_033573339.1|825898_827611_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	98.6	0.0e+00
WP_003661399.1|827622_827814_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_020752179.1|827818_829072_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	98.3	6.5e-233
WP_087911789.1|829025_829655_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	99.5	1.2e-115
WP_087911790.1|829696_830899_+|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	93.5	3.2e-205
WP_005712764.1|830916_831156_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	97.5	1.6e-31
WP_003564855.1|831166_831526_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.6e-59
WP_087911791.1|831515_831845_+|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	96.3	4.4e-56
WP_087911792.1|831844_832231_+	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	97.7	6.6e-67
WP_087911793.1|832230_832617_+|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	96.1	4.1e-69
WP_087911794.1|832650_833259_+|tail	phage tail protein	tail	A0A2D1GPC8	Lactobacillus_phage	95.5	1.0e-106
WP_087911795.1|833285_833501_+	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	86.4	1.4e-18
WP_003661382.1|833571_833985_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_087911796.1|834107_838970_+|tail	phage tail tape measure protein	tail	B4XYQ3	Lactobacillus_phage	95.8	0.0e+00
WP_087911797.1|838970_840893_+|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	74.9	1.4e-274
WP_087911798.1|840893_843329_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	74.2	0.0e+00
WP_003582527.1|843330_843621_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	1.1e-18
WP_003581984.1|843800_844076_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_087911799.1|844090_844504_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	94.9	2.7e-42
WP_087911800.1|844514_845699_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	89.3	4.6e-204
WP_087911802.1|846192_848025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087911803.1|848535_851043_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_087911804.1|851102_852140_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_087911805.1|852136_853183_+	DUF916 domain-containing protein	NA	NA	NA	NA	NA
WP_087911806.1|853213_853369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012484.1|853475_854378_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_087911807.1|854661_855309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010489553.1|855488_856673_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.5	1.9e-141
WP_087911808.1|856971_858465_+	MFS transporter	NA	NA	NA	NA	NA
856827:856848	attR	TTTCTGCGACTGCGAACGCGTT	NA	NA	NA	NA
WP_049169105.1|858628_859120_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087911809.1|859240_860719_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_087911810.1|860715_861441_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_087911811.1|861522_862197_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_049169101.1|862733_865145_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.2	0.0e+00
WP_025012494.1|865649_867293_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_087913234.1|867297_868008_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_087911812.1|868160_868985_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_087911813.1|868981_869482_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_087911814.1|869846_870320_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_087911815.1|870425_871631_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_087911816.1|871751_873080_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010489536.1|873281_873548_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_087911817.1|873580_874924_+	PFL family protein	NA	NA	NA	NA	NA
WP_087911818.1|875060_876128_+	competence protein	NA	NA	NA	NA	NA
WP_025012499.1|876373_877009_-	DsbA family protein	NA	NA	NA	NA	NA
WP_087911819.1|877078_877672_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_049169090.1|877835_878513_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_010489527.1|878514_879312_+	NAD kinase	NA	NA	NA	NA	NA
WP_087911820.1|879311_880214_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_087913235.1|880332_881391_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_087911821.1|881608_882244_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_087911823.1|883596_884637_-	lactonase family protein	NA	NA	NA	NA	NA
WP_010489512.1|884907_885282_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|885378_885648_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_025012505.1|885764_886754_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.9	4.8e-138
WP_010489474.1|886936_887884_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_087911824.1|887950_888793_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_025012508.1|889132_889642_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017065	Lactobacillus casei strain LC5 chromosome, complete genome	3132867	1132575	1167304	3132867	portal,terminase,integrase,holin,tail,head,capsid	Lactobacillus_phage(85.0%)	45	1121552:1121568	1160705:1160721
1121552:1121568	attL	TTGTTTCCGCCGCTGGT	NA	NA	NA	NA
WP_081528605.1|1132575_1133760_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
WP_060611504.1|1133849_1134053_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	97.0	5.5e-33
WP_087911959.1|1134076_1134502_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
WP_019892391.1|1134771_1135542_-	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	27.6	4.3e-17
WP_003574520.1|1135622_1136324_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	36.9	2.2e-20
WP_019892389.1|1136383_1136977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019892387.1|1137023_1137470_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003607004.1|1137470_1137902_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	39.9	9.4e-22
WP_016369986.1|1138037_1138280_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	54.4	2.7e-10
WP_003582323.1|1138276_1138432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016371378.1|1138428_1138656_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_003594175.1|1138743_1138890_+	hypothetical protein	NA	A0A0P0IJX2	Lactobacillus_phage	97.9	1.3e-20
WP_003582311.1|1138955_1139504_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
WP_003582309.1|1139482_1139704_+	helix-turn-helix domain-containing protein	NA	A0A0P0ID64	Lactobacillus_phage	100.0	1.4e-37
WP_087913243.1|1139944_1140352_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	97.0	1.7e-73
WP_072672149.1|1140364_1141231_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	94.4	9.7e-151
WP_087911960.1|1141211_1142012_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.5	5.2e-143
WP_087911961.1|1142027_1142879_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	92.1	6.0e-105
WP_019892357.1|1142865_1143648_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.5	2.4e-132
WP_087911962.1|1143644_1143977_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	78.2	2.6e-40
WP_087911963.1|1143973_1144423_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	97.3	8.7e-71
WP_012491444.1|1144469_1144724_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	100.0	2.6e-40
WP_003607027.1|1144720_1145086_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
WP_087911964.1|1145315_1145603_+	hypothetical protein	NA	Q8LTB3	Lactobacillus_phage	93.7	4.4e-44
WP_161492242.1|1145660_1145828_+	hypothetical protein	NA	A0A0N7IR95	Lactobacillus_phage	78.2	7.3e-15
WP_087911966.1|1146045_1146474_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_087911967.1|1148003_1149221_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	97.3	7.3e-237
WP_019892312.1|1149356_1149890_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	95.6	3.2e-64
WP_019892310.1|1149867_1151223_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	58.4	2.7e-147
WP_019892308.1|1151227_1152655_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	94.5	1.0e-250
WP_087911968.1|1152620_1153613_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	96.1	3.3e-179
WP_087911969.1|1153737_1154394_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	79.5	9.5e-58
WP_087911970.1|1154409_1155423_+|capsid	capsid protein	capsid	A0A0A7RVZ1	Clostridium_phage	26.5	2.4e-23
WP_087911971.1|1155650_1156025_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	79.0	4.3e-47
WP_087911972.1|1156029_1156332_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	90.0	2.6e-47
WP_016373306.1|1156328_1156694_+|head,tail	phage-related head tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	5.3e-58
WP_003575579.1|1156694_1157099_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_016373305.1|1157110_1157743_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	89.5	1.6e-99
WP_016383085.1|1157829_1158162_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	97.3	1.1e-51
WP_016373369.1|1158260_1158614_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	96.6	8.1e-56
WP_087911973.1|1158606_1161696_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	88.1	2.9e-258
1160705:1160721	attR	TTGTTTCCGCCGCTGGT	NA	NA	NA	NA
WP_087911974.1|1161696_1163694_+|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	77.5	1.9e-282
WP_016381085.1|1166130_1166421_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	1.1e-18
WP_003581984.1|1166600_1166876_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_087911975.1|1166890_1167304_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	94.2	4.0e-46
>prophage 3
NZ_CP017065	Lactobacillus casei strain LC5 chromosome, complete genome	3132867	2361498	2418088	3132867	bacteriocin,tRNA,transposase,protease	Streptococcus_phage(16.67%)	56	NA	NA
WP_087912690.1|2361498_2362680_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	49.7	1.7e-97
WP_162494869.1|2362856_2363834_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	22.9	4.8e-05
WP_087912692.1|2364802_2365489_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087912693.1|2365485_2366541_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087912694.1|2367164_2367767_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.3	1.2e-06
WP_087912695.1|2367735_2369238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912696.1|2369244_2369772_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_087912697.1|2369778_2370060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047105543.1|2370238_2370397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912698.1|2370424_2370622_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087912699.1|2371088_2371343_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087912700.1|2371344_2371764_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	35.9	4.2e-11
WP_191981857.1|2371809_2372085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087912701.1|2372297_2374088_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.0	2.3e-21
WP_087912702.1|2374226_2374697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087912703.1|2375156_2375657_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	46.4	2.4e-29
WP_010492225.1|2375755_2376295_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_010492226.1|2376297_2377080_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_025013696.1|2377048_2377480_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_087912704.1|2377476_2378883_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	8.0e-54
WP_087912705.1|2379238_2379499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087912706.1|2379545_2380940_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_087912707.1|2381110_2382604_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_087912708.1|2382749_2383577_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_087913292.1|2383726_2384830_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_087913293.1|2385119_2385896_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_087912709.1|2385921_2386800_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.5	1.8e-35
WP_087912710.1|2387083_2387974_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010492251.1|2388077_2389193_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_010492253.1|2389213_2390578_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_025013302.1|2390597_2391137_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	2.0e-37
WP_025013303.1|2391403_2391694_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_087912711.1|2392136_2393456_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	36.1	1.5e-62
WP_087912712.1|2393584_2394931_+	C1 family peptidase	NA	A0A2H4UU28	Bodo_saltans_virus	28.8	1.4e-47
WP_087912713.1|2395147_2396248_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087912714.1|2396247_2397441_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070650342.1|2397455_2398334_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-11
WP_010492273.1|2398494_2400549_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.5	7.3e-64
WP_087912715.1|2400670_2403301_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	39.0	2.8e-84
WP_087912716.1|2403462_2404050_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087912717.1|2404355_2405027_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_087912718.1|2405205_2406312_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_047105507.1|2406383_2406668_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_087912719.1|2407011_2408262_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	2.9e-55
WP_087912720.1|2408336_2408786_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	1.9e-33
WP_087912721.1|2408815_2409943_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_025013314.1|2410154_2410364_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010492291.1|2410543_2410801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010492293.1|2410903_2411110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013316.1|2411309_2411564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087913294.1|2411907_2413152_+	MFS transporter	NA	NA	NA	NA	NA
WP_087912722.1|2413252_2414509_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.8	2.3e-108
WP_087912723.1|2414600_2415440_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.8e-46
WP_087912724.1|2415717_2416260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912725.1|2416535_2417093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161492247.1|2417320_2418088_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP017065	Lactobacillus casei strain LC5 chromosome, complete genome	3132867	2424458	2447801	3132867	bacteriocin,protease,transposase	Bacillus_phage(50.0%)	26	NA	NA
WP_087912734.1|2424458_2424749_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_155807535.1|2425044_2425212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087912735.1|2425513_2426491_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_087912736.1|2426779_2428135_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_087912737.1|2428248_2429628_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_087912738.1|2429639_2431832_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.6	1.2e-35
WP_191981858.1|2432145_2432292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912739.1|2432459_2433761_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_087912740.1|2433762_2434569_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087912742.1|2436376_2436661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912743.1|2436768_2437065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912744.1|2437169_2437613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912746.1|2438018_2438177_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_087912747.1|2438204_2438402_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087912748.1|2438882_2439266_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087912749.1|2439392_2439602_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087913295.1|2439619_2439811_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087912751.1|2440288_2440630_+|transposase	transposase	transposase	A0A1X9I6F6	Streptococcus_phage	39.3	7.4e-14
WP_087912752.1|2440626_2441250_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087912753.1|2441573_2442194_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_087912754.1|2442272_2442668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162494871.1|2444096_2444855_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049171943.1|2445125_2445296_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087912756.1|2445490_2446039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087912757.1|2446271_2447102_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087912758.1|2447462_2447801_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
