The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021654	Aeromonas salmonicida strain O23A chromosome, complete genome	4811606	758787	853210	4811606	portal,tail,head,capsid,holin,terminase,integrase,plate,tRNA	Aeromonas_virus(68.89%)	100	806634:806693	843481:843592
WP_017412019.1|758787_759369_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_005320158.1|759576_761814_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_058394191.1|761831_763481_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005320154.1|763724_764543_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	3.6e-14
WP_011898554.1|764628_765339_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011898555.1|765528_766848_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_085946280.1|766872_767406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087755357.1|767707_768610_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_087755358.1|768619_770020_+	amino acid permease	NA	NA	NA	NA	NA
WP_087757288.1|770096_771008_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_087755359.1|771216_771966_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	4.4e-35
WP_085941440.1|771949_772930_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_087757289.1|772999_773854_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058394184.1|774290_775424_+	GGDEF domain-containing protein	NA	A0A2D0WBV8	Bordetella_phage	42.7	1.2e-07
WP_087755360.1|775434_776769_-	MFS transporter	NA	NA	NA	NA	NA
WP_087755361.1|776796_778254_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_021139640.1|778250_778841_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_005320129.1|779071_779467_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_087755362.1|779699_780461_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087757290.1|780514_781201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755363.1|781259_782651_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_087755364.1|782662_784054_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_087755365.1|784387_785338_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_087755366.1|785461_786391_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	25.6	6.1e-10
WP_042467293.1|786455_787115_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_087755367.1|787289_789362_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.9	1.6e-42
WP_058394175.1|789743_790817_+	porin	NA	NA	NA	NA	NA
WP_087755368.1|791101_791977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058394173.1|792150_793341_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_087755369.1|793429_794941_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	47.5	1.9e-85
WP_011898563.1|795101_795587_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_087757292.1|795583_796096_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_087757291.1|796057_798325_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_021139624.1|798741_800511_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	1.5e-57
WP_087755370.1|800510_801506_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005320086.1|801648_801837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320083.1|801833_802613_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005320080.1|802826_803471_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_087755371.1|803601_805455_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005320074.1|805639_806194_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
806634:806693	attL	GATTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCATTA	NA	NA	NA	NA
WP_087757293.1|806943_808026_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.5	6.8e-37
WP_087755372.1|808052_808988_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_157666768.1|809174_809579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755373.1|809752_810196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755374.1|810369_811983_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	76.7	7.9e-247
WP_087755375.1|811979_812540_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	77.0	4.7e-66
WP_087757294.1|812536_812986_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	61.1	2.7e-40
WP_087755376.1|813269_815189_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	56.7	1.5e-98
WP_087755377.1|815185_815869_-|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	73.5	7.3e-85
WP_087755378.1|815861_817049_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	82.6	2.4e-184
WP_087755379.1|817045_817369_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	90.7	1.8e-49
WP_087755380.1|817365_819138_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	77.0	8.3e-266
WP_087755381.1|819329_819590_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	84.9	5.8e-35
WP_157666769.1|819586_819766_-	hypothetical protein	NA	A5X9I6	Aeromonas_virus	78.0	1.5e-21
WP_087755382.1|819713_820157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755383.1|820153_820615_-	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	87.5	2.4e-76
WP_005892368.1|820601_820928_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	61.4	3.6e-26
WP_042871617.1|820953_821163_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	69.7	4.7e-19
WP_087755384.1|821166_821622_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	83.4	7.5e-70
WP_087755385.1|821625_822750_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	82.6	6.0e-177
WP_087755386.1|822754_823441_-	phage virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	91.7	4.8e-113
WP_087755387.1|823437_823950_-|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	86.5	1.2e-84
WP_087755388.1|823955_824417_-|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	90.8	9.3e-68
WP_087755389.1|824532_825261_-|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	96.3	3.4e-133
WP_087755390.1|825264_826332_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	84.2	1.1e-172
WP_087755391.1|826341_827214_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	68.2	9.5e-106
WP_087755392.1|827390_829211_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	88.8	0.0e+00
WP_087755393.1|829207_830224_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	91.4	3.9e-183
WP_087755394.1|830282_830534_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	89.2	9.2e-38
WP_087757295.1|830706_831339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087755395.1|831562_831985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755396.1|832085_832457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666770.1|832525_833515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755397.1|833893_834406_-	hypothetical protein	NA	A5X9G5	Aeromonas_virus	74.5	7.6e-63
WP_087755398.1|834407_836687_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	80.8	0.0e+00
WP_087755399.1|836683_836941_-	hypothetical protein	NA	A5X9G3	Aeromonas_virus	42.4	6.8e-12
WP_087755400.1|836986_837244_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	66.7	2.8e-21
WP_087755401.1|837240_837450_-	hypothetical protein	NA	A5X9G1	Aeromonas_virus	84.1	4.8e-24
WP_042871652.1|837446_837644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755402.1|837816_838080_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042871655.1|838082_838271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755403.1|838337_838796_-	hypothetical protein	NA	A5X9F8	Aeromonas_virus	83.6	3.3e-65
WP_087755404.1|838806_839316_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	70.4	9.9e-63
WP_042067793.1|839308_839578_-	hypothetical protein	NA	Q1I116	Pasteurella_virus	45.8	2.8e-08
WP_041915415.1|839599_839788_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	56.4	3.9e-09
WP_087755405.1|839907_840597_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.6	4.3e-45
WP_087755406.1|840636_841701_+	putative phage abortive infection protein	NA	NA	NA	NA	NA
WP_087755407.1|841755_842802_+|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	58.2	6.3e-112
WP_087755408.1|842773_843259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755409.1|843749_844544_-	hypothetical protein	NA	NA	NA	NA	NA
843481:843592	attR	GATTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCATTAAAATCAAAGACTTACGAAGGCCACTAGCAATAGTGGCCTTTTTGTTTTTGGC	NA	NA	NA	NA
WP_021141035.1|845244_845976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666771.1|846182_846467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755411.1|847099_848008_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058394163.1|848115_848889_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.7e-18
WP_005314534.1|849042_849219_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_017413027.1|849354_849603_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_087755412.1|849683_850448_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_087755413.1|850444_851155_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_059113897.1|851144_851642_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_087757296.1|851833_853210_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.5	8.7e-45
>prophage 2
NZ_CP021654	Aeromonas salmonicida strain O23A chromosome, complete genome	4811606	1803085	1848611	4811606	protease,plate,tRNA	uncultured_Mediterranean_phage(15.38%)	37	NA	NA
WP_042467876.1|1803085_1803844_-|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_005310748.1|1804067_1805588_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_005310746.1|1805609_1806098_-	CvpA family protein	NA	NA	NA	NA	NA
WP_087755863.1|1806285_1807581_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.2	4.4e-91
WP_087755864.1|1807937_1809281_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	1.1e-79
WP_034523846.1|1809399_1810008_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_087755865.1|1810085_1812611_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.6	7.3e-90
WP_005300047.1|1812813_1813305_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_081045651.1|1813455_1813665_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_157666786.1|1813968_1814319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140586.1|1814377_1815328_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.2	3.0e-60
WP_058394663.1|1815385_1816633_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.9e-15
WP_005310731.1|1816735_1817206_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_087755866.1|1817225_1817933_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_087755867.1|1817929_1818646_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|1818714_1818933_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005310727.1|1819001_1821254_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
WP_005310725.1|1821313_1821631_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005300025.1|1821860_1822079_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_087755868.1|1822189_1823053_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	1.8e-27
WP_157666787.1|1824099_1825029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755869.1|1825003_1827586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087755870.1|1827595_1829641_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.7	7.3e-32
WP_042869831.1|1829652_1829940_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	38.3	3.0e-08
WP_087755871.1|1830232_1831669_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087755872.1|1831713_1835211_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_087757350.1|1835252_1836698_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_087755873.1|1836706_1837312_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_087755874.1|1837311_1838850_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_087755875.1|1838852_1841495_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.0	1.6e-92
WP_087757351.1|1841516_1842227_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_005310700.1|1842319_1843654_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059112429.1|1843656_1844172_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_087755876.1|1844171_1845407_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_059112431.1|1845447_1846446_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_087755877.1|1846409_1848176_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_087755878.1|1848179_1848611_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP021654	Aeromonas salmonicida strain O23A chromosome, complete genome	4811606	2824603	2833258	4811606	tRNA,transposase	Escherichia_phage(14.29%)	8	NA	NA
WP_087756364.1|2824603_2825620_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_010676201.1|2826401_2826824_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	5.5e-35
WP_087756366.1|2826827_2828099_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.1	3.4e-128
WP_005311829.1|2828668_2830030_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	76.2	1.7e-165
WP_021140912.1|2830031_2830280_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.5	2.3e-20
WP_087756368.1|2830442_2831516_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	1.1e-23
WP_087757389.1|2831688_2831763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140911.1|2831863_2833258_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.3	4.2e-180
>prophage 4
NZ_CP021654	Aeromonas salmonicida strain O23A chromosome, complete genome	4811606	4730952	4740894	4811606	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_059168279.1|4730952_4731699_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	5.9e-64
WP_005318888.1|4731703_4732321_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_087757474.1|4732323_4732899_+	DedA family protein	NA	NA	NA	NA	NA
WP_058395211.1|4732908_4733955_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
WP_017411567.1|4734002_4734986_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	9.9e-35
WP_087757227.1|4735071_4736085_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.0e-107
WP_005309452.1|4736264_4736480_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_021139213.1|4736495_4736939_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	7.6e-27
WP_021139214.1|4737027_4738815_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	2.6e-73
WP_081045675.1|4739028_4740894_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
