The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	0	71343	5439290	holin,tRNA,coat,terminase,tail	Salmonella_phage(17.31%)	81	NA	NA
WP_043906915.1|301_640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906916.1|674_1784_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.2	2.5e-183
WP_043906917.1|1796_4907_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.7	1.3e-293
WP_023282477.1|5044_5200_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|5208_5400_-	YebW family protein	NA	NA	NA	NA	NA
WP_040243782.1|5886_6090_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
WP_043906918.1|6138_6945_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_040243778.1|6941_7790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040243776.1|7960_8356_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
WP_040243773.1|8460_8694_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_043906919.1|8696_9233_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	3.6e-63
WP_071887734.1|9320_9509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906920.1|9523_10432_+	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_032417026.1|10434_11184_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286280.1|11191_11527_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_043906921.1|11519_12311_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.2e-64
WP_043906922.1|12303_12921_+	ead/Ea22-like family protein	NA	A6N3G8	Burkholderia_virus	52.1	3.7e-19
WP_032429364.1|12917_13097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077264308.1|13093_13570_+	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
WP_040241897.1|13728_13956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|14678_16163_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004184503.1|16241_16475_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|16581_16830_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_016946309.1|16864_17461_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|17669_17966_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_043906923.1|17962_18319_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	2.0e-41
WP_023287514.1|18434_19256_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_017145563.1|19944_20340_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|20326_20608_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|20607_21237_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_043906925.1|21244_21520_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	1.6e-14
WP_043906926.1|21755_22040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304730.1|22172_22445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906927.1|22758_23004_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	50.6	4.5e-13
WP_043906928.1|23072_24068_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	42.9	6.5e-34
WP_043906929.1|24045_25350_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	2.2e-146
WP_043906930.1|25354_26779_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	7.5e-193
WP_043906931.1|26762_27875_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	53.2	1.8e-109
WP_043906932.1|28051_28291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906933.1|28409_29174_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	3.9e-79
WP_043906934.1|29261_30398_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	74.6	2.6e-156
WP_086893487.1|30447_30741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906936.1|30744_31155_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	1.6e-10
WP_043906937.1|31156_31540_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	49.6	1.5e-23
WP_043906938.1|31541_32093_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.1	7.0e-30
WP_043906939.1|32089_32482_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_043906940.1|32505_33678_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.4e-22
WP_043906941.1|33732_34215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146193.1|34352_34550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906942.1|34726_35257_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_050486020.1|35338_35836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602982.1|35881_36244_+	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_043906943.1|36339_39906_+|tail	lambda family phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.7	4.2e-83
WP_032423794.1|39905_40370_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	6.1e-59
WP_043906944.1|40550_41033_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	92.5	3.8e-80
WP_004190616.1|41042_41423_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_043906945.1|41419_44482_+	kinase	NA	A0A286S259	Klebsiella_phage	94.1	0.0e+00
WP_043906946.1|44558_46712_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
WP_043906947.1|46727_47462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071887730.1|47473_47803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194556.1|47839_48169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906948.1|48718_49084_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	2.6e-25
WP_002914069.1|49276_51076_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|51091_52066_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|52315_52996_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|52992_53898_+	GTPase Era	NA	NA	NA	NA	NA
WP_002914062.1|53909_54647_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004180923.1|54658_55390_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|55389_55770_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004144350.1|55782_56043_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_004144349.1|56099_56948_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180922.1|57161_57797_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004890375.1|57826_58369_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_087741187.1|58365_59982_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004185139.1|60156_64044_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914044.1|64633_66055_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004180916.1|66063_66771_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004180914.1|66757_68095_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914032.1|68160_68499_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002914028.1|68573_69764_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914027.1|70089_71343_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 2
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	86590	92911	5439290		Faustovirus(20.0%)	8	NA	NA
WP_002913992.1|86590_87805_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
WP_002913991.1|87831_88218_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913979.1|88235_88559_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_004174835.1|88633_89149_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004149343.1|89164_91015_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_002913956.1|91016_91352_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002913954.1|91353_91554_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004180902.1|91624_92911_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	5.8e-35
>prophage 3
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	103423	103855	5439290		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|103423_103855_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 4
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	112954	140864	5439290	tail,integrase	Morganella_phage(35.71%)	27	112707:112727	132771:132791
112707:112727	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004213157.1|112954_114208_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|114303_115311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|115441_115660_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|115659_116094_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|116107_116710_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|116709_116889_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|116885_117851_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|117847_118351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|118347_118557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|118553_119180_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|119189_119540_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|119532_122295_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|122634_123081_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077252710.1|123094_123445_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|123449_123923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|124276_124603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|124610_127676_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
WP_022615614.1|128279_128651_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	53.4	1.8e-29
WP_004213179.1|129861_130755_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	38.9	1.0e-33
WP_004213180.1|130751_131408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213181.1|131409_131847_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	61.4	9.1e-41
WP_043906950.1|132908_133988_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
132771:132791	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004144303.1|134037_134256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174856.1|134239_135631_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|135789_137256_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|137323_138901_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004180884.1|138995_140864_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 5
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	144633	144825	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_002913843.1|144633_144825_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 6
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	151236	152912	5439290		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004145656.1|151236_151878_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_004180872.1|151874_152912_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.8e-71
>prophage 7
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	156451	159458	5439290	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_002913824.1|156451_157738_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_071527881.1|157836_158538_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_004180868.1|158534_159458_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 8
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	166103	166817	5439290		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|166103_166817_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 9
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	201720	205297	5439290		Paenibacillus_phage(50.0%)	5	NA	NA
WP_002913639.1|201720_202593_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
WP_002913637.1|202804_203230_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913635.1|203216_203666_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913630.1|203727_204303_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004180831.1|204397_205297_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	5.0e-25
>prophage 10
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	208650	210775	5439290		Planktothrix_phage(50.0%)	2	NA	NA
WP_043906955.1|208650_209745_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.1e-29
WP_004145610.1|209863_210775_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
>prophage 11
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	214384	312395	5439290	transposase,holin,tRNA,terminase,integrase,protease,capsid,portal,head,tail	Klebsiella_phage(41.27%)	109	247945:247967	289640:289662
WP_004180827.1|214384_216112_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_002913505.1|216156_216414_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004180826.1|216794_217766_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_004174922.1|217942_218704_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_085353186.1|218937_219996_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004180820.1|220065_222081_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
WP_002913440.1|222082_222301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913439.1|222297_223296_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004180817.1|223384_224311_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	7.0e-06
WP_004145598.1|225053_226472_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|226523_226916_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|226919_227273_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|227777_229949_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|229997_231200_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|231546_232788_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|232845_233205_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004180796.1|233335_234328_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004174935.1|234508_236170_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|236166_237402_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|237665_238631_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|238684_239422_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|239433_241131_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913372.1|241513_242728_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|242798_242870_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004180792.1|243208_244405_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004180790.1|244401_244860_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
WP_004180788.1|244992_245901_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180785.1|245910_246792_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|247160_247643_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
247945:247967	attL	ATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_060618154.1|248161_249331_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	4.0e-200
WP_060618153.1|249363_250299_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	7.5e-08
WP_077255880.1|250314_250500_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
WP_060618152.1|250507_251182_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	47.9	8.3e-41
WP_042936714.1|251178_251391_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	1.8e-10
WP_053067518.1|251387_251840_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_023328761.1|251836_252043_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
WP_060618151.1|252039_252450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048270909.1|252577_253363_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	7.6e-62
WP_040149782.1|253362_253662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184745.1|253749_254673_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
WP_032408726.1|255430_256078_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|256182_256380_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|256405_256867_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_071557781.1|257104_257317_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_060618150.1|257273_258188_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_040186313.1|258184_258994_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
WP_000779146.1|259003_259381_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_060618149.1|259393_260374_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.9e-134
WP_032412066.1|260387_260966_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	9.9e-51
WP_071887732.1|261278_261536_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	3.7e-42
WP_031280381.1|261441_261888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304726.1|262058_263105_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_017145563.1|263549_263945_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|263931_264213_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|264212_264842_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_060618148.1|264849_265125_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	6.8e-10
WP_123618920.1|265436_265649_+	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	71.4	7.8e-22
WP_022065473.1|266083_266329_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_071887731.1|266400_266607_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	100.0	2.7e-35
WP_060618147.1|266678_266969_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	1.2e-52
WP_044067371.1|266981_267191_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	65.2	3.4e-17
WP_004143905.1|267313_267748_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_060618146.1|267757_269290_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
WP_017880221.1|269292_270570_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004216821.1|270575_271256_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880222.1|271267_272431_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
WP_044067369.1|272467_272710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042346263.1|272657_272984_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	97.2	3.7e-55
WP_060618145.1|273044_273242_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	95.4	5.4e-25
WP_060618144.1|273243_273576_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	7.6e-56
WP_060618143.1|273568_274108_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	1.0e-94
WP_060618142.1|274104_274470_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	3.3e-60
WP_040221233.1|274526_275018_+|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_040174785.1|275061_275415_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	80.3	1.3e-48
WP_032717793.1|275447_275711_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_071887738.1|275707_276139_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	4.4e-64
WP_060618140.1|276201_278628_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	84.6	0.0e+00
WP_004899614.1|278627_279107_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|279093_279576_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|279585_279966_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_060618139.1|279962_283031_+	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_060618138.1|283106_285260_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.5	1.9e-54
WP_004899608.1|285272_286007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194558.1|286018_286348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194556.1|286384_286714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|287418_288903_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023284987.1|288976_289216_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
WP_032447769.1|289172_289544_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	9.2e-26
WP_004149224.1|289750_290680_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
289640:289662	attR	ATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|290969_291731_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|291792_293121_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004180782.1|293488_293773_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913358.1|293932_295243_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004180780.1|295242_297387_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|297596_298082_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|298102_298654_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|298821_299754_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004180777.1|299795_300881_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
WP_004174960.1|300883_301708_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|301707_302517_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|302516_303065_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|303096_303378_+	YfcL family protein	NA	NA	NA	NA	NA
WP_004180775.1|303439_305428_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|305586_306807_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_043906956.1|307016_308195_+	MFS transporter	NA	NA	NA	NA	NA
WP_004180772.1|308281_309259_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002913228.1|309369_310506_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|310569_311583_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913226.1|311582_312395_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	316946	318464	5439290		Mollivirus(100.0%)	1	NA	NA
WP_004180758.1|316946_318464_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	7.7e-87
>prophage 13
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	322757	323531	5439290		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|322757_323531_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 14
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	335933	336533	5439290		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|335933_336533_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 15
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	364562	365504	5439290	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_004180717.1|364562_365504_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 16
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	368619	369825	5439290		Oenococcus_phage(100.0%)	1	NA	NA
WP_004175029.1|368619_369825_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 17
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	379204	389801	5439290		Pseudomonas_phage(40.0%)	6	NA	NA
WP_002913017.1|379204_379459_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004140835.1|379458_380589_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913016.1|380690_382976_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_002913014.1|383320_384049_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_043906960.1|384195_386829_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	9.3e-96
WP_004180704.1|386960_389801_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
>prophage 18
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	393941	397339	5439290		Enterobacteria_phage(50.0%)	3	NA	NA
WP_043906961.1|393941_395045_+	OmpK36 porin	NA	Q1MVN1	Enterobacteria_phage	60.3	4.4e-116
WP_004180700.1|395148_396201_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_004180699.1|396274_397339_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
>prophage 19
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	401257	402418	5439290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004151114.1|401257_402418_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 20
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	408784	409792	5439290		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|408784_409792_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 21
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	414028	420115	5439290		Vibrio_phage(33.33%)	5	NA	NA
WP_004144263.1|414028_415786_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
WP_002912977.1|415933_416653_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002912975.1|416649_417846_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912974.1|418177_418522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180652.1|418525_420115_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 22
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	425870	430182	5439290		Clostridioides_phage(50.0%)	4	NA	NA
WP_002912967.1|425870_426440_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
WP_004180648.1|426866_427574_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004180647.1|427617_428595_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004180646.1|428715_430182_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.9e-45
>prophage 23
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	438014	438869	5439290		Catovirus(100.0%)	1	NA	NA
WP_087741188.1|438014_438869_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	2.0e-23
>prophage 24
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	443268	447175	5439290		Acinetobacter_phage(50.0%)	3	NA	NA
WP_002912926.1|443268_445242_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
WP_004151123.1|445312_446146_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002912924.1|446506_447175_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 25
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	450939	452460	5439290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004175074.1|450939_452460_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 26
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	464063	464834	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004180621.1|464063_464834_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	1.2e-48
>prophage 27
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	469108	469663	5439290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|469108_469663_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 28
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	476197	483251	5439290	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_004175098.1|476197_477145_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.5e-24
WP_004180609.1|477128_477866_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912762.1|477840_477954_-	protein YohO	NA	NA	NA	NA	NA
WP_043907001.1|478183_479872_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.0	1.2e-258
WP_004180606.1|479865_480585_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912756.1|480631_481102_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_004195370.1|481217_483251_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 29
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	510266	517171	5439290	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|510266_511130_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|511140_511914_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|512154_513048_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|513293_514655_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|514973_515696_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|515692_517171_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 30
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	534291	541057	5439290		Catovirus(25.0%)	5	NA	NA
WP_002912442.1|534291_534933_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|535023_535605_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_043906970.1|535635_537483_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151147.1|537817_539401_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_001741945.1|540166_541057_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
>prophage 31
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	558658	576708	5439290	transposase	Ostreococcus_lucimarinus_virus(11.11%)	14	NA	NA
WP_004180507.1|558658_560065_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.6e-38
WP_043906709.1|560309_561725_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.4	8.1e-54
WP_004180505.1|561747_563118_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	2.4e-31
WP_000704907.1|563281_564448_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_032422715.1|564871_564994_-	small membrane protein	NA	NA	NA	NA	NA
WP_004180504.1|565394_566399_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_002912373.1|567444_568212_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912371.1|568211_568952_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_032428509.1|568967_570863_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004180502.1|570878_572033_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.2	5.5e-77
WP_004180501.1|572029_572923_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000019473.1|574016_574997_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_104889077.1|574978_575269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180499.1|575391_576708_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.5	7.1e-12
>prophage 32
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	582955	583855	5439290		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|582955_583855_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 33
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	588362	595456	5439290		Streptococcus_phage(33.33%)	4	NA	NA
WP_004180492.1|588362_590465_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.2e-63
WP_004180490.1|590682_592107_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_072157874.1|592281_593451_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.5	1.7e-182
WP_004152765.1|593971_595456_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 34
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	610881	611718	5439290		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|610881_611718_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 35
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	619025	620111	5439290		Wolbachia_phage(100.0%)	1	NA	NA
WP_001593456.1|619025_620111_+	cGAMP-activated phospholipase CapV	NA	A0A1B2LRS3	Wolbachia_phage	31.5	3.4e-20
>prophage 36
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	625783	631322	5439290		Caulobacter_phage(50.0%)	3	NA	NA
WP_032737973.1|625783_626731_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.7	5.6e-51
WP_001593448.1|627034_627814_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_016240611.1|627797_631322_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	25.5	8.8e-17
>prophage 37
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	647913	648099	5439290		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|647913_648099_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 38
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	655667	680323	5439290	integrase	Bacillus_phage(40.0%)	8	660652:660667	680994:681009
WP_043906714.1|655667_665159_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
660652:660667	attL	AGATCGATGGCGGCAA	NA	NA	NA	NA
WP_040210963.1|665246_671354_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140406.1|671544_672504_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098391.1|672670_674473_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_040210958.1|674459_676262_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_001593428.1|676254_677535_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703034.1|677562_678867_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001593427.1|679060_680323_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.5	7.4e-75
680994:681009	attR	TTGCCGCCATCGATCT	NA	NA	NA	NA
>prophage 39
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	697915	706358	5439290		Burkholderia_phage(40.0%)	8	NA	NA
WP_002911596.1|697915_699061_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|699599_699881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|699923_700631_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_022631353.1|700674_702108_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.1e-101
WP_002911592.1|702088_702583_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_004180449.1|702557_703469_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|703652_704564_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004180448.1|704678_706358_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 40
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	712959	713712	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|712959_713712_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 41
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	730318	731833	5439290		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|730318_731833_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 42
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	738770	802640	5439290	tRNA,coat,terminase,integrase,head	Cronobacter_phage(16.95%)	84	745166:745188	792489:792511
WP_004151452.1|738770_740504_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_004180441.1|740739_741309_+	VOC family protein	NA	NA	NA	NA	NA
WP_004180440.1|741385_742129_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004151451.1|742210_743215_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|743211_743955_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|743994_744390_-	membrane protein	NA	NA	NA	NA	NA
WP_043906717.1|744442_745222_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
745166:745188	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_043906718.1|745218_746478_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
WP_023283988.1|746520_746766_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_043906719.1|746769_746988_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.5	1.6e-09
WP_043906720.1|746984_747749_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.8	2.5e-70
WP_020805516.1|747745_748018_-	hypothetical protein	NA	Q716F1	Shigella_phage	64.7	2.8e-24
WP_060618136.1|748014_748239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906973.1|748235_748763_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_043906721.1|748791_749415_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	4.0e-58
WP_008807812.1|749411_750158_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_043906722.1|750174_750459_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_043906723.1|750466_751438_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
WP_019704100.1|751525_751720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906724.1|752232_752931_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_043906725.1|752930_753251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077264309.1|753296_754019_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.7	1.1e-75
WP_004194000.1|754087_754315_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|754353_754575_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_032453659.1|754708_755437_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.9	9.3e-38
WP_043906727.1|755433_756210_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
WP_043906728.1|756209_756512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906729.1|756508_756898_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.3	4.1e-16
WP_032458656.1|756894_757803_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A140XFY9	Salmonella_phage	81.0	1.3e-145
WP_043906730.1|757799_758486_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	50.6	3.8e-33
WP_032428632.1|758658_758946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906731.1|758945_759203_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
WP_043906732.1|759298_759895_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	3.6e-56
WP_043906975.1|759900_760071_+	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	6.3e-14
WP_043906733.1|760063_760702_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	69.8	9.8e-76
WP_043906734.1|760698_761340_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	1.1e-34
WP_040218297.1|761336_761477_+	YlcG family protein	NA	NA	NA	NA	NA
WP_043906735.1|761473_762163_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	8.4e-57
WP_029884058.1|762906_763221_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
WP_043906736.1|763223_763727_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
WP_043906737.1|763723_764101_+	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
WP_043906738.1|764632_765235_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
WP_043906739.1|765234_766707_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	9.0e-250
WP_043906740.1|766719_768183_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	1.1e-149
WP_061403453.1|768115_769117_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.2e-115
WP_023339708.1|769109_769310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906742.1|769387_770743_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.3	1.3e-130
WP_016529582.1|770742_771204_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040027496.1|771200_772256_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_029884066.1|772288_772528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178849.1|772530_772911_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_043906743.1|772910_773084_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	4.1e-13
WP_043906744.1|773083_773446_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
WP_043906745.1|773448_773817_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	8.5e-48
WP_043906746.1|773813_774197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906747.1|774199_774421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906748.1|774480_775245_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.2	3.3e-38
WP_043906749.1|775313_776027_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.7e-63
WP_043906750.1|776243_776795_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	91.4	1.8e-86
WP_077264310.1|777153_777513_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	1.1e-15
WP_043906976.1|777986_778457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906752.1|778528_781792_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	59.7	2.9e-232
WP_085820418.1|781891_782311_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.6e-29
WP_043906753.1|782310_782781_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	5.6e-28
WP_043906754.1|782777_783173_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	3.6e-36
WP_043906755.1|783159_785637_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	3.9e-197
WP_043906756.1|785723_787907_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.4	3.0e-92
WP_043906757.1|787919_788654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071887730.1|788665_788995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194556.1|789031_789361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|790065_791550_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_043906812.1|791627_791867_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	51.3	7.2e-16
WP_043906811.1|791866_792184_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	5.3e-22
WP_004145564.1|792580_793147_-	hydrolase	NA	NA	NA	NA	NA
792489:792511	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_002911479.1|793414_795202_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004180439.1|795203_795647_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911459.1|795674_796415_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911456.1|796449_796971_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911454.1|797050_797662_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004148860.1|797670_798681_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_004180438.1|798744_799530_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002911449.1|799529_800282_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_004180437.1|800360_801305_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911444.1|801320_802640_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
>prophage 43
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	806565	808041	5439290		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|806565_808041_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 44
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	815466	816435	5439290		Pseudoalteromonas_phage(50.0%)	2	NA	NA
WP_043906809.1|815466_816126_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	30.7	4.9e-14
WP_002911406.1|816204_816435_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
>prophage 45
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	820159	820813	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_004180432.1|820159_820813_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
>prophage 46
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	828320	830369	5439290		Moraxella_phage(100.0%)	1	NA	NA
WP_004145536.1|828320_830369_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 47
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	835604	835814	5439290		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|835604_835814_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 48
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	843254	844814	5439290		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|843254_844814_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 49
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	848716	856078	5439290	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_004180428.1|848716_850072_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
WP_004180427.1|850160_850340_+	YoaH family protein	NA	NA	NA	NA	NA
WP_002910910.1|850340_850685_-	RidA family protein	NA	NA	NA	NA	NA
WP_004175456.1|850816_852727_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_004180426.1|852872_853568_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002910904.1|854392_856078_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 50
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	871703	872315	5439290		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|871703_872315_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 51
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	889491	891786	5439290		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004180412.1|889491_891786_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.4e-159
>prophage 52
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	895647	906393	5439290		Staphylococcus_phage(40.0%)	11	NA	NA
WP_004148803.1|895647_896523_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|896519_897239_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|897244_898138_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|898421_900065_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|900114_900591_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|900691_901618_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|901921_903217_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004175495.1|903231_904038_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|904012_904912_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|905021_905504_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|905694_906393_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
>prophage 53
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	916581	919618	5439290		Microcystis_phage(66.67%)	3	NA	NA
WP_004180403.1|916581_917472_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.9	2.0e-10
WP_004180402.1|917655_918549_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	26.9	3.7e-12
WP_015874922.1|918724_919618_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	5.7e-13
>prophage 54
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	936360	939112	5439290		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_020324125.1|936360_938040_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910407.1|938164_939112_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 55
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	942324	948038	5439290		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002910403.1|942324_943407_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_004180387.1|943406_944255_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004145428.1|944254_944647_+	SirB family protein	NA	NA	NA	NA	NA
WP_002910395.1|944650_945463_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910393.1|945502_946357_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910392.1|946443_947544_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910389.1|947807_948038_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
>prophage 56
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	953549	954338	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|953549_954338_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 57
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	970831	972367	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|970831_972367_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 58
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	976840	983113	5439290		Synechococcus_phage(25.0%)	7	NA	NA
WP_004151854.1|976840_977683_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_002910109.1|977725_978184_-	YchJ family protein	NA	NA	NA	NA	NA
WP_004180379.1|978296_979199_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910107.1|979288_980302_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910105.1|980499_981402_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_043906801.1|981523_981934_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910100.1|982495_983113_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 59
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	991371	994267	5439290		Planktothrix_phage(33.33%)	3	NA	NA
WP_004151853.1|991371_992385_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
WP_002910083.1|992381_993386_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_002910080.1|993439_994267_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 60
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1003925	1011094	5439290	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002910026.1|1003925_1005854_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
WP_004189469.1|1005857_1006400_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|1006492_1006690_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1006740_1007097_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1007220_1007265_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_002909105.1|1007403_1008387_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_004180374.1|1008402_1010790_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909098.1|1010794_1011094_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 61
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1018160	1026129	5439290		Brazilian_cedratvirus(25.0%)	7	NA	NA
WP_002909083.1|1018160_1018910_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
WP_002909082.1|1018991_1019456_+	lipoprotein	NA	NA	NA	NA	NA
WP_004180370.1|1019569_1021012_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.7	4.4e-55
WP_002909070.1|1021041_1021269_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_004180369.1|1021376_1022423_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
WP_002909061.1|1022577_1023411_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909055.1|1023750_1026129_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 62
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1036108	1036870	5439290		Indivirus(100.0%)	1	NA	NA
WP_002909000.1|1036108_1036870_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 63
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1053361	1054582	5439290		environmental_halophage(100.0%)	1	NA	NA
WP_002908867.1|1053361_1054582_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 64
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1064502	1065252	5439290		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004180353.1|1064502_1065252_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	4.8e-05
>prophage 65
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1072689	1074653	5439290		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004180342.1|1072689_1073640_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.6e-34
WP_004180340.1|1073636_1074653_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
>prophage 66
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1085285	1089567	5439290		Bacillus_virus(50.0%)	3	NA	NA
WP_002908439.1|1085285_1086059_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
WP_004180325.1|1086167_1088240_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004180324.1|1088745_1089567_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 67
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1109089	1110160	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_043906795.1|1109089_1110160_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	3.1e-26
>prophage 68
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1127467	1128091	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004180281.1|1127467_1128091_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	4.7e-06
>prophage 69
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1152030	1152861	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004180245.1|1152030_1152861_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 70
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1162441	1165887	5439290	transposase	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004180232.1|1162441_1163206_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	36.6	2.6e-30
WP_004180231.1|1163291_1163717_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|1165182_1165887_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 71
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1171477	1173426	5439290		Klosneuvirus(50.0%)	2	NA	NA
WP_004180184.1|1171477_1172449_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
WP_004180183.1|1172445_1173426_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
>prophage 72
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1178610	1179381	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_004180180.1|1178610_1179381_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 73
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1184857	1185742	5439290		Burkholderia_virus(100.0%)	1	NA	NA
WP_004180176.1|1184857_1185742_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 74
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1189708	1197806	5439290		Enterococcus_phage(25.0%)	8	NA	NA
WP_004180173.1|1189708_1190287_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	1.3e-18
WP_004180172.1|1190427_1190664_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004148609.1|1190839_1192213_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907792.1|1192442_1193078_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_002907788.1|1193114_1194263_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_004196034.1|1194555_1195737_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_004180170.1|1195849_1196854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907778.1|1196780_1197806_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 75
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1201077	1201950	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|1201077_1201950_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 76
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1206137	1207625	5439290		Indivirus(50.0%)	2	NA	NA
WP_004180168.1|1206137_1207034_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
WP_022631271.1|1207103_1207625_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	1.1e-51
>prophage 77
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1216130	1217405	5439290	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|1216130_1217405_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 78
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1228660	1230031	5439290		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|1228660_1230031_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 79
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1235586	1237637	5439290		Escherichia_phage(50.0%)	3	NA	NA
WP_002907640.1|1235586_1236114_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
WP_002907563.1|1236218_1236494_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_004180155.1|1236518_1237637_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	6.2e-33
>prophage 80
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1244462	1247103	5439290		Moumouvirus(100.0%)	2	NA	NA
WP_004175893.1|1244462_1245968_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
WP_004180152.1|1246014_1247103_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.5	4.1e-05
>prophage 81
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1257534	1259496	5439290		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|1257534_1259496_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 82
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1266444	1267458	5439290		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004180140.1|1266444_1267458_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 83
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1283150	1285241	5439290		Salmonella_phage(100.0%)	1	NA	NA
WP_004220069.1|1283150_1285241_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 84
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1289819	1290371	5439290		Leuconostoc_phage(100.0%)	1	NA	NA
WP_004180132.1|1289819_1290371_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 85
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1296309	1297089	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|1296309_1297089_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 86
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1306527	1307229	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004180111.1|1306527_1307229_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.8e-31
>prophage 87
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1312633	1314178	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_004148517.1|1312633_1314178_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 88
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1320285	1321785	5439290		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|1320285_1321785_+	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 89
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1328264	1329038	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004180092.1|1328264_1329038_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 90
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1340309	1341926	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_004180080.1|1340309_1341926_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	5.6e-19
>prophage 91
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1345514	1350250	5439290		Tupanvirus(66.67%)	4	NA	NA
WP_002906221.1|1345514_1346525_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
WP_004180075.1|1346777_1347377_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_004180074.1|1347544_1348498_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180073.1|1348534_1350250_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	4.7e-32
>prophage 92
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1356103	1358441	5439290		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_020953426.1|1356103_1356976_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
WP_004143718.1|1357674_1357860_+	general stress protein	NA	NA	NA	NA	NA
WP_004143717.1|1358225_1358441_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 93
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1363248	1363653	5439290		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|1363248_1363653_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 94
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1373670	1376283	5439290		Rathayibacter_phage(100.0%)	1	NA	NA
WP_050885129.1|1373670_1376283_+	family 78 glycoside hydrolase catalytic domain	NA	A0A1P8VV88	Rathayibacter_phage	21.3	4.1e-11
>prophage 95
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1382444	1383125	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004180032.1|1382444_1383125_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 96
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1398521	1400602	5439290		Bacillus_phage(100.0%)	2	NA	NA
WP_004180014.1|1398521_1399262_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
WP_004180013.1|1399258_1400602_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.0e-10
>prophage 97
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1405366	1409484	5439290		Klosneuvirus(50.0%)	4	NA	NA
WP_002905540.1|1405366_1406752_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
WP_004180008.1|1407058_1407994_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004180004.1|1408018_1408759_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004180001.1|1408755_1409484_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	3.7e-18
>prophage 98
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1415478	1416735	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_043906781.1|1415478_1416735_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.1	1.0e-20
>prophage 99
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1442861	1443599	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_004179947.1|1442861_1443599_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 100
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1459209	1460262	5439290		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|1459209_1460262_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 101
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1474935	1475718	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002904975.1|1474935_1475718_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 102
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1489127	1489646	5439290		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_043906779.1|1489127_1489646_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	38.2	4.4e-26
>prophage 103
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1510005	1511382	5439290		Streptomyces_phage(50.0%)	2	NA	NA
WP_004179847.1|1510005_1510329_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	3.2e-14
WP_004179846.1|1510356_1511382_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.0	4.4e-25
>prophage 104
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1515437	1516994	5439290		Catovirus(100.0%)	1	NA	NA
WP_004179837.1|1515437_1516994_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	1.5e-16
>prophage 105
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1524356	1525532	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004179831.1|1524356_1525532_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 106
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1535961	1536942	5439290	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|1535961_1536942_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 107
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1552521	1553901	5439290		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004179808.1|1552521_1553901_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	6.9e-18
>prophage 108
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1564394	1565186	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_002904635.1|1564394_1565186_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 109
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1577572	1578946	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_065785739.1|1577572_1578946_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 110
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1584394	1585156	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|1584394_1585156_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 111
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1589679	1590630	5439290		Catovirus(100.0%)	1	NA	NA
WP_004179770.1|1589679_1590630_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.7	7.3e-35
>prophage 112
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1595707	1596082	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|1595707_1596082_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 113
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1599327	1600833	5439290		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004179759.1|1599327_1600026_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	3.6e-15
WP_002904321.1|1600035_1600833_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 114
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1604984	1620879	5439290		Escherichia_phage(70.0%)	15	NA	NA
WP_043906775.1|1604984_1606088_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.6	3.4e-100
WP_002904247.1|1606236_1606635_-	rhodanese	NA	NA	NA	NA	NA
WP_004176251.1|1606702_1607800_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004205985.1|1607768_1607984_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004176252.1|1608036_1608477_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004176254.1|1608731_1609796_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	1.5e-65
WP_004179756.1|1609992_1613100_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|1613154_1614420_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|1614450_1615539_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|1615625_1615886_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|1616183_1617044_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|1617064_1617826_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|1618086_1618989_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|1619000_1620266_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_043906774.1|1620258_1620879_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
>prophage 115
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1630025	1637998	5439290		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_043906773.1|1630025_1630700_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	4.8e-81
WP_004179738.1|1630750_1631593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085806868.1|1631614_1632007_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_043906772.1|1632084_1634130_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.8	7.1e-19
WP_002903733.1|1634260_1635010_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_002903730.1|1635101_1635788_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002903728.1|1635838_1636270_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_004195998.1|1636534_1637998_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	2.3e-43
>prophage 116
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1642334	1646907	5439290		Escherichia_phage(100.0%)	4	NA	NA
WP_004190280.1|1642334_1644770_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.0e-215
WP_004152235.1|1644780_1645398_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002903710.1|1645399_1646257_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004179727.1|1646298_1646907_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	6.4e-24
>prophage 117
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1664031	1664991	5439290		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|1664031_1664991_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 118
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1674434	1677212	5439290		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004179710.1|1674434_1677212_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	1.1e-65
>prophage 119
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1696558	1697074	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004176326.1|1696558_1697074_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 120
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1708317	1709619	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|1708317_1709619_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 121
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1722457	1725985	5439290		Salmonella_phage(50.0%)	6	NA	NA
WP_004151566.1|1722457_1722661_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
WP_032422225.1|1722730_1723249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179665.1|1723446_1723800_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_004179663.1|1723903_1725112_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903233.1|1725108_1725342_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_004179661.1|1725592_1725985_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	37.6	1.5e-18
>prophage 122
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1738165	1739371	5439290		Klosneuvirus(100.0%)	1	NA	NA
WP_004176366.1|1738165_1739371_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 123
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1748057	1752695	5439290		Bacillus_phage(50.0%)	2	NA	NA
WP_004151576.1|1748057_1748732_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
WP_004179644.1|1748792_1752695_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	5.0e-53
>prophage 124
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1778896	1779886	5439290		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004176391.1|1778896_1779886_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	3.3e-70
>prophage 125
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1785004	1792119	5439290	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_004176397.1|1785004_1786129_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
WP_002902432.1|1786272_1786485_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902424.1|1786575_1787001_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902422.1|1787234_1788170_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|1788215_1789589_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|1790113_1791097_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004179590.1|1791375_1792119_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
>prophage 126
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1799727	1800741	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_032422215.1|1799727_1800741_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	2.2e-29
>prophage 127
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1824255	1828596	5439290	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000019473.1|1824255_1825236_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004179562.1|1827498_1828596_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
>prophage 128
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1833890	1839057	5439290		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004179552.1|1833890_1836410_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
WP_004179550.1|1836402_1839057_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	2.9e-97
>prophage 129
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1847043	1849554	5439290		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_043906763.1|1847043_1848576_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	4.4e-21
WP_004179531.1|1848792_1849554_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.4e-20
>prophage 130
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1862040	1867816	5439290		Hokovirus(50.0%)	3	NA	NA
WP_004179502.1|1862040_1864734_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	5.8e-61
WP_004179501.1|1864723_1866922_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_004152141.1|1866946_1867816_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
>prophage 131
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1898504	1900308	5439290		Planktothrix_phage(50.0%)	2	NA	NA
WP_004140266.1|1898504_1899497_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1899498_1900308_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 132
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1904938	1906873	5439290		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004179478.1|1904938_1906873_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
>prophage 133
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1912463	1913066	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|1912463_1913066_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 134
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1917906	1923272	5439290	protease	Tupanvirus(50.0%)	5	NA	NA
WP_004179471.1|1917906_1920504_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	3.7e-89
WP_002901761.1|1920910_1921162_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|1921209_1922256_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004148112.1|1922300_1922516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196459.1|1922510_1923272_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
>prophage 135
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1933408	1936366	5439290		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004148109.1|1933408_1935004_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
WP_004179455.1|1935007_1936366_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 136
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1948609	1949287	5439290		Cyanophage(100.0%)	1	NA	NA
WP_004179437.1|1948609_1949287_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 137
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1956581	1962315	5439290		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_002901621.1|1956581_1957343_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
WP_002901611.1|1957434_1958025_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004151918.1|1958160_1959552_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_004140343.1|1959611_1959944_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_002901554.1|1960056_1962315_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 138
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1968579	1969407	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|1968579_1969407_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 139
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1976090	1977311	5439290		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|1976090_1977311_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 140
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1983368	1984001	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004176522.1|1983368_1984001_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 141
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1989303	1991250	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004148065.1|1989303_1991250_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 142
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	1997805	1999870	5439290		Tupanvirus(50.0%)	2	NA	NA
WP_004179391.1|1997805_1998447_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.4e-18
WP_002901255.1|1998616_1999870_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 143
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2003553	2004408	5439290		Indivirus(100.0%)	1	NA	NA
WP_004176538.1|2003553_2004408_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	4.7e-17
>prophage 144
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2007682	2091382	5439290	tRNA,plate,integrase,capsid,portal,head,tail	Enterobacteria_phage(42.86%)	93	2025893:2025914	2062099:2062120
WP_004152363.1|2007682_2008966_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901231.1|2009011_2009575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|2009733_2010216_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_004179388.1|2010337_2010649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179386.1|2010906_2011788_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179384.1|2011963_2013181_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901225.1|2013177_2013927_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004179382.1|2014093_2014999_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179379.1|2015005_2016271_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.4	2.9e-196
WP_002901192.1|2016273_2016693_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152765.1|2016771_2018256_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901096.1|2018873_2019116_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004179376.1|2019286_2020426_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004179374.1|2020669_2021170_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|2021286_2021733_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|2021716_2022508_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|2022609_2023794_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|2023825_2024518_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|2024663_2025173_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|2025159_2025516_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|2025505_2025745_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2025893:2025914	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|2026009_2026261_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|2026304_2027444_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|2027598_2028771_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|2028770_2029286_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|2029331_2029649_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|2029648_2029807_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_050885124.1|2029793_2032769_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	6.1e-221
WP_050885123.1|2032784_2033276_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.5	4.8e-54
WP_077265366.1|2033868_2036610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050885122.1|2037120_2038218_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	28.2	2.7e-09
WP_031593568.1|2038202_2038418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050885121.1|2038414_2041444_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023328061.1|2041433_2042357_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.2	6.4e-52
WP_017898624.1|2042358_2042709_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_050885120.1|2042705_2043293_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.5	5.7e-54
WP_050885119.1|2043289_2043925_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	4.6e-57
WP_023328065.1|2043921_2044389_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
WP_032435858.1|2044389_2044665_-	hypothetical protein	NA	B6SD31	Bacteriophage	35.3	2.3e-05
WP_050885139.1|2044570_2044900_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_050885118.1|2044911_2045457_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.6	9.7e-32
WP_032432781.1|2045453_2045738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|2045728_2045929_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023328069.1|2045928_2046444_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	2.2e-41
WP_023328070.1|2046556_2047414_-	hypothetical protein	NA	A0A0A7NPX9	Enterobacteria_phage	60.9	8.3e-70
WP_023328071.1|2047463_2048498_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_050885117.1|2048507_2049347_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
WP_004213105.1|2049503_2051231_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_050885116.1|2051224_2052286_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.0	9.1e-143
WP_050885115.1|2052892_2053753_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_050885114.1|2053749_2054997_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_020324116.1|2057245_2058181_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_031593599.1|2058413_2058980_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
WP_020324115.1|2058976_2059201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|2059278_2059542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|2059557_2059935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|2059950_2060169_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|2060189_2060468_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|2060588_2060888_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|2061003_2061987_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004179366.1|2062251_2063265_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
2062099:2062120	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|2063322_2063424_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|2063423_2063498_+	protein YoaJ	NA	NA	NA	NA	NA
WP_032415974.1|2063615_2063738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|2063797_2064061_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|2064191_2064830_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|2064919_2065834_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004179363.1|2066495_2067539_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|2067841_2069050_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004179361.1|2069123_2070908_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	7.6e-17
WP_043906813.1|2070914_2071805_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|2071925_2073434_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|2073744_2074431_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153236426.1|2074881_2075070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2075048_2075681_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|2076247_2076445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|2076560_2077571_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|2077567_2078974_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|2079029_2079917_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|2079933_2080440_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|2080466_2080961_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|2081051_2081237_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|2081858_2083052_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|2083164_2083392_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004150797.1|2083841_2084165_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|2084157_2084550_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|2084546_2085260_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150800.1|2085532_2086783_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|2087023_2087674_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|2087690_2088149_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|2088205_2089312_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|2089366_2090008_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|2090011_2091382_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
>prophage 145
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2097945	2099082	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004147966.1|2097945_2099082_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 146
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2103514	2108354	5439290		Catovirus(50.0%)	3	NA	NA
WP_004179343.1|2103514_2105143_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.6	1.7e-15
WP_023283546.1|2105380_2107384_-	transketolase	NA	NA	NA	NA	NA
WP_004147958.1|2107403_2108354_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.5e-13
>prophage 147
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2115615	2119366	5439290		Vibrio_phage(50.0%)	4	NA	NA
WP_004179333.1|2115615_2116446_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	3.1e-21
WP_004179332.1|2116460_2117372_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002900801.1|2117420_2118665_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002900798.1|2118664_2119366_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 148
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2139090	2139732	5439290		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|2139090_2139732_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 149
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2143011	2144193	5439290		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2143011_2143248_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_002899294.1|2143458_2144193_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 150
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2163349	2163601	5439290		Salmonella_phage(100.0%)	1	NA	NA
WP_004179321.1|2163349_2163601_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	50.0	3.0e-12
>prophage 151
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2166842	2167763	5439290		Morganella_phage(100.0%)	1	NA	NA
WP_004140735.1|2166842_2167763_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 152
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2176114	2176642	5439290		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_004176593.1|2176114_2176642_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 153
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2185149	2186208	5439290		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|2185149_2186208_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 154
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2202772	2206292	5439290		Enterobacteria_phage(100.0%)	4	NA	NA
WP_004176611.1|2202772_2203267_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
WP_004179285.1|2203288_2204611_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_004176613.1|2205017_2205956_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002898708.1|2206118_2206292_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 155
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2226830	2233406	5439290		Hokovirus(50.0%)	4	NA	NA
WP_004179266.1|2226830_2229332_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	1.1e-10
WP_043906816.1|2229641_2230718_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004179264.1|2230738_2231059_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004179263.1|2231108_2233406_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
>prophage 156
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2236476	2238669	5439290		Bacillus_phage(50.0%)	2	NA	NA
WP_004179254.1|2236476_2237397_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.9e-14
WP_004179253.1|2237640_2238669_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	1.9e-12
>prophage 157
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2243667	2249186	5439290	protease	Iris_mild_mosaic_virus(50.0%)	3	NA	NA
WP_043906818.1|2243667_2246094_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	5.5e-10
WP_004176629.1|2246604_2248257_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|2248526_2249186_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 158
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2258530	2260678	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004179228.1|2258530_2260678_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.3e-26
>prophage 159
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2271784	2273839	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004179218.1|2271784_2273839_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 160
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2286531	2288439	5439290		Tupanvirus(100.0%)	1	NA	NA
WP_004147848.1|2286531_2288439_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 161
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2297205	2302221	5439290		Bacillus_virus(33.33%)	3	NA	NA
WP_004179191.1|2297205_2297979_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
WP_002898220.1|2298076_2300692_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_002898217.1|2301018_2302221_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 162
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2308283	2311356	5439290	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
WP_002898206.1|2308283_2309684_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
WP_004141771.1|2310276_2311356_+	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
>prophage 163
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2328719	2333262	5439290		Bacillus_phage(100.0%)	3	NA	NA
WP_002898170.1|2328719_2330468_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
WP_004179175.1|2330504_2332769_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002898165.1|2332974_2333262_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 164
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2337435	2338524	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004179173.1|2337435_2338524_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 165
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2342575	2372726	5439290	protease,tRNA	Tetraselmis_virus(13.33%)	22	NA	NA
WP_002898148.1|2342575_2344858_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
WP_002898145.1|2345049_2345790_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_004179169.1|2345952_2347101_-	MFS transporter	NA	NA	NA	NA	NA
WP_004141823.1|2347217_2347364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150844.1|2347375_2348239_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004150845.1|2348240_2348858_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004147794.1|2348868_2351307_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_002898139.1|2351507_2352800_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_043906823.1|2352890_2354234_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2354242_2354854_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_043906824.1|2354976_2359251_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|2359386_2359881_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|2360386_2361382_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|2361496_2363263_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004179158.1|2363263_2364985_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2365029_2365731_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2366084_2366303_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2366422_2368702_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_043906825.1|2368732_2369050_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2369375_2369597_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2369673_2371614_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2371610_2372726_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 166
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2385542	2389892	5439290		Roseobacter_phage(50.0%)	4	NA	NA
WP_004179152.1|2385542_2386373_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004179151.1|2386404_2387544_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_043906826.1|2388421_2388937_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|2389163_2389892_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
>prophage 167
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2393036	2404624	5439290		Bacillus_phage(33.33%)	13	NA	NA
WP_004179135.1|2393036_2394509_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|2394505_2395222_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_004147758.1|2395300_2396428_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|2396469_2396958_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2397015_2397861_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2397857_2398811_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|2398821_2399955_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_004179134.1|2400118_2401231_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2401579_2402059_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2402147_2403050_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_004179133.1|2403164_2403887_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_004179132.1|2403870_2404158_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2404360_2404624_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 168
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2412096	2414096	5439290		Escherichia_phage(50.0%)	2	NA	NA
WP_004151717.1|2412096_2412855_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004191175.1|2412893_2414096_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
>prophage 169
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2425956	2427816	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|2425956_2427816_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 170
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2432059	2434492	5439290		Bacteriophage(100.0%)	1	NA	NA
WP_004179127.1|2432059_2434492_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 171
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2442473	2444066	5439290		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|2442473_2444066_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 172
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2447076	2448453	5439290		Pandoravirus(100.0%)	1	NA	NA
WP_004179118.1|2447076_2448453_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 173
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2452455	2457607	5439290		Escherichia_phage(33.33%)	6	NA	NA
WP_004179116.1|2452455_2452968_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
WP_004179115.1|2453319_2454207_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895841.1|2454444_2454948_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895839.1|2455356_2456103_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895837.1|2456228_2456888_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004142040.1|2456884_2457607_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 174
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2461681	2469633	5439290		Erwinia_phage(20.0%)	8	NA	NA
WP_004179111.1|2461681_2461942_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.6e-05
WP_004179107.1|2461962_2462229_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176772.1|2462514_2462775_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004179105.1|2462883_2463852_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004147693.1|2463881_2466038_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.5e-43
WP_004179103.1|2466225_2467581_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	1.1e-47
WP_002895757.1|2467795_2468788_-	transketolase family protein	NA	NA	NA	NA	NA
WP_002895753.1|2468787_2469633_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 175
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2474838	2476578	5439290		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004179101.1|2474838_2476578_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	5.7e-17
>prophage 176
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2487217	2488123	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004179095.1|2487217_2488123_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.4	1.1e-27
>prophage 177
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2494619	2495342	5439290		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|2494619_2495342_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 178
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2499145	2504234	5439290		Klosneuvirus(50.0%)	3	NA	NA
WP_004195153.1|2499145_2500435_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
WP_043906829.1|2501226_2502609_-	amino acid permease	NA	NA	NA	NA	NA
WP_004179088.1|2502707_2504234_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.2e-81
>prophage 179
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2510832	2518688	5439290		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_004179084.1|2510832_2513520_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.3	2.9e-68
WP_004179083.1|2513571_2514003_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	41.4	2.9e-23
WP_004179082.1|2514536_2515622_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004179081.1|2515622_2518688_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.8	1.3e-21
>prophage 180
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2521797	2522532	5439290		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004176830.1|2521797_2522532_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 181
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2527379	2533902	5439290		Planktothrix_phage(33.33%)	7	NA	NA
WP_004179075.1|2527379_2528438_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
WP_002895159.1|2528440_2529130_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004179074.1|2529129_2529903_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895156.1|2530045_2530195_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004179073.1|2530347_2531136_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004179072.1|2531203_2532676_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895150.1|2532885_2533902_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 182
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2538263	2541774	5439290		Edwardsiella_phage(33.33%)	4	NA	NA
WP_002895086.1|2538263_2539316_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
WP_002895084.1|2539630_2539996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147641.1|2540113_2541058_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_004179069.1|2541054_2541774_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.1	1.3e-23
>prophage 183
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2566100	2566892	5439290		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|2566100_2566892_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 184
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2572701	2580131	5439290		Acinetobacter_phage(33.33%)	6	NA	NA
WP_004142240.1|2572701_2574180_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	4.9e-46
WP_004147610.1|2574151_2575594_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	5.1e-56
WP_002894847.1|2575777_2575984_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020323459.1|2576293_2576383_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004179062.1|2576382_2578062_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004179061.1|2578082_2580131_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.5	6.0e-26
>prophage 185
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2586957	2587731	5439290		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004179050.1|2586957_2587731_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.2e-05
>prophage 186
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2592419	2596221	5439290	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_002894753.1|2592419_2594087_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
WP_004147599.1|2594265_2596221_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 187
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2600974	2602639	5439290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|2600974_2602639_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 188
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2606679	2607726	5439290		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004176871.1|2606679_2607726_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 189
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2613730	2621696	5439290	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_002894706.1|2613730_2614456_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
WP_004179033.1|2614829_2616500_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004179032.1|2616565_2618359_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.5	1.9e-28
WP_002894699.1|2618404_2618887_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_004179029.1|2619113_2621696_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	8.0e-185
>prophage 190
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2628740	2631227	5439290		Synechococcus_phage(50.0%)	2	NA	NA
WP_004147579.1|2628740_2629889_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_002894539.1|2630027_2631227_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 191
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2636102	2636763	5439290		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002894459.1|2636102_2636486_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
WP_002439184.1|2636553_2636763_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 192
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2640853	2642924	5439290		Morganella_phage(50.0%)	2	NA	NA
WP_002894401.1|2640853_2641282_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
WP_004179017.1|2641358_2642924_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	4.9e-44
>prophage 193
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2646059	2659773	5439290		Streptococcus_phage(20.0%)	12	NA	NA
WP_002894369.1|2646059_2647283_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
WP_004151651.1|2647267_2647894_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_004179016.1|2647894_2649055_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004179015.1|2649181_2649871_+	acireductone synthase	NA	NA	NA	NA	NA
WP_002894357.1|2649867_2650410_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_043906834.1|2650517_2652827_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.7	6.1e-83
WP_002894353.1|2653234_2654215_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004179013.1|2654211_2655762_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.5e-16
WP_004147555.1|2655758_2656748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004179011.1|2656744_2657749_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147553.1|2657760_2658702_+	sugar kinase	NA	NA	NA	NA	NA
WP_004179009.1|2658744_2659773_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	9.4e-28
>prophage 194
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2676885	2681306	5439290		Staphylococcus_phage(50.0%)	5	NA	NA
WP_004178988.1|2676885_2678388_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.4e-17
WP_004178987.1|2678551_2679640_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004178986.1|2679697_2680441_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004178984.1|2680624_2680927_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004178982.1|2680901_2681306_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	3.0e-06
>prophage 195
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2693766	2698507	5439290		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_002893737.1|2693766_2694561_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
WP_004178969.1|2694625_2698507_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	1.2e-54
>prophage 196
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2704899	2708592	5439290	transposase	Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_004197603.1|2704899_2706375_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	3.3e-10
WP_004178956.1|2706376_2707465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004178955.1|2707620_2708592_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.2	8.8e-68
>prophage 197
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2718364	2724278	5439290	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_004142478.1|2718364_2720398_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
WP_004151671.1|2720526_2721114_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004178943.1|2721127_2722600_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004142489.1|2722613_2724278_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 198
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2728835	2730363	5439290		Planktothrix_phage(100.0%)	2	NA	NA
WP_004178937.1|2728835_2729672_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-13
WP_004178936.1|2729658_2730363_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
>prophage 199
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2733927	2738607	5439290		Bacillus_virus(50.0%)	5	NA	NA
WP_004151676.1|2733927_2734689_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
WP_004178928.1|2734681_2735347_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002893187.1|2735361_2736003_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004178926.1|2736050_2736902_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004178924.1|2737143_2738607_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.8e-16
>prophage 200
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2742440	2744478	5439290		Planktothrix_phage(50.0%)	2	NA	NA
WP_004178916.1|2742440_2743451_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	7.3e-17
WP_004178914.1|2743440_2744478_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	7.1e-15
>prophage 201
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2754811	2757526	5439290		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_085956510.1|2754811_2757526_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	1.0e-65
>prophage 202
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2784375	2786240	5439290		Escherichia_phage(33.33%)	3	NA	NA
WP_004196125.1|2784375_2784735_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	90.7	1.2e-57
WP_004178884.1|2784738_2785041_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.0	2.2e-17
WP_004178883.1|2785124_2786240_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 203
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2801267	2802065	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004178876.1|2801267_2802065_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 204
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2808687	2814489	5439290		Bacillus_phage(50.0%)	5	NA	NA
WP_004178872.1|2808687_2810088_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	2.5e-15
WP_004177008.1|2810117_2811122_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004178871.1|2811137_2811779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892599.1|2811962_2812994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142660.1|2813004_2814489_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 205
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2823154	2826479	5439290	tRNA	Catovirus(50.0%)	2	NA	NA
WP_002892491.1|2823154_2824672_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|2825003_2826479_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
>prophage 206
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2832702	2833623	5439290		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|2832702_2833623_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 207
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2839105	2841617	5439290	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
WP_004143017.1|2839105_2839972_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|2839973_2840186_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2840231_2841617_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 208
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2850162	2850849	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_032422188.1|2850162_2850849_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	4.6e-31
>prophage 209
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2854030	2859236	5439290		Bacillus_virus(50.0%)	5	NA	NA
WP_004178776.1|2854030_2854708_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_002892258.1|2854848_2855766_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004142979.1|2855762_2856221_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|2856217_2856628_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004178775.1|2856734_2859236_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
>prophage 210
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2869355	2877166	5439290	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_004177228.1|2869355_2871230_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_004178772.1|2871341_2871947_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|2871946_2872279_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004178771.1|2872336_2874244_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_004177230.1|2874336_2874888_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|2875038_2875416_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_004178770.1|2875485_2876013_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|2876025_2876199_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_004183208.1|2876266_2877166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.2e-64
>prophage 211
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2882687	2892078	5439290		Leptospira_phage(33.33%)	10	NA	NA
WP_002892069.1|2882687_2885834_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|2886319_2886694_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|2886720_2886939_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|2887097_2887664_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892026.1|2887796_2888267_+	membrane protein	NA	NA	NA	NA	NA
WP_002892023.1|2888241_2889693_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_004178762.1|2889793_2890492_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|2890488_2890629_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|2890628_2890892_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|2891007_2892078_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 212
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2901252	2902362	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004178760.1|2901252_2902362_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	32.7	5.4e-13
>prophage 213
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2913284	2916828	5439290		Bacillus_phage(100.0%)	2	NA	NA
WP_004178754.1|2913284_2915063_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.9e-37
WP_004178753.1|2915055_2916828_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	5.4e-47
>prophage 214
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2921255	2921957	5439290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|2921255_2921957_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 215
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2925187	2930356	5439290	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|2925187_2925460_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_004151336.1|2925669_2928024_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002891807.1|2928207_2929482_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_002891804.1|2929732_2930356_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 216
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2944662	2946360	5439290		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004178745.1|2944662_2946360_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	3.2e-17
>prophage 217
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2959146	2963806	5439290		Klosneuvirus(33.33%)	6	NA	NA
WP_004147313.1|2959146_2960121_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.6e-08
WP_004178738.1|2960166_2960670_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_004178737.1|2960662_2961634_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_002891356.1|2961705_2962125_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|2962144_2962615_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_004144650.1|2962702_2963806_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
>prophage 218
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2967405	2971744	5439290	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890403.1|2967405_2968377_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
WP_002890400.1|2968387_2970235_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890398.1|2970261_2970594_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_004178735.1|2970616_2971744_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	6.1e-89
>prophage 219
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	2988546	2997066	5439290		Bacillus_phage(60.0%)	6	NA	NA
WP_002890344.1|2988546_2989842_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
WP_002890343.1|2989863_2990553_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_004178728.1|2990735_2991941_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_004178727.1|2991937_2995075_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890286.1|2995148_2996063_-	fructokinase	NA	NA	NA	NA	NA
WP_002890285.1|2996154_2997066_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 220
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3018155	3018923	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_004178719.1|3018155_3018923_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 221
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3029924	3033646	5439290		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151354.1|3029924_3030707_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
WP_002890126.1|3030699_3031395_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_002890108.1|3031511_3031682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178716.1|3032016_3032826_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151355.1|3032827_3033646_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 222
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3042719	3043562	5439290		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|3042719_3043562_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 223
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3049624	3057884	5439290		Streptococcus_phage(50.0%)	4	NA	NA
WP_004144576.1|3049624_3050677_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
WP_004144574.1|3050966_3052070_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_004147253.1|3052080_3053334_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
WP_004178705.1|3054641_3057884_-	DEAD/DEAH box helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	26.9	5.2e-32
>prophage 224
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3070298	3071696	5439290		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004178690.1|3070298_3071696_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	2.8e-43
>prophage 225
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3076347	3077343	5439290		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|3076347_3077343_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 226
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3084875	3086159	5439290		Klosneuvirus(100.0%)	1	NA	NA
WP_004178682.1|3084875_3086159_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	8.4e-34
>prophage 227
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3103318	3103900	5439290		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|3103318_3103900_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 228
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3109407	3113617	5439290		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_004152034.1|3109407_3110139_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
WP_002889686.1|3110203_3110671_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_002889685.1|3110667_3111390_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004145833.1|3111422_3112178_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889632.1|3112249_3113617_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 229
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3117682	3118486	5439290		Indivirus(100.0%)	1	NA	NA
WP_004178664.1|3117682_3118486_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	9.2e-39
>prophage 230
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3125160	3126192	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|3125160_3126192_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 231
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3139176	3143276	5439290		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_043906851.1|3139176_3142659_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	1.2e-207
WP_002889376.1|3142676_3143276_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 232
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3152107	3152866	5439290		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|3152107_3152866_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 233
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3164444	3165878	5439290	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|3164444_3165878_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 234
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3169833	3170178	5439290		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|3169833_3170178_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 235
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3176145	3176943	5439290		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|3176145_3176943_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 236
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3199077	3205848	5439290	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_004177388.1|3199077_3201507_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.5e-39
WP_004177389.1|3201579_3202116_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_002888848.1|3202115_3202832_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002888845.1|3202994_3203450_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004145903.1|3203509_3204391_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071526609.1|3204453_3205848_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 237
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3211252	3217899	5439290		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_002888823.1|3211252_3212179_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
WP_002888821.1|3212363_3213026_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888819.1|3213085_3213622_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888816.1|3213826_3216217_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_004178601.1|3216300_3217899_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
>prophage 238
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3229473	3230898	5439290		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|3229473_3230898_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 239
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3242238	3242802	5439290		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|3242238_3242802_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 240
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3247069	3248113	5439290		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|3247069_3248113_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 241
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3274305	3276030	5439290		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|3274305_3276030_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 242
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3287428	3288184	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004178590.1|3287428_3288184_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	35.2	4.2e-25
>prophage 243
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3296883	3297585	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004178579.1|3296883_3297585_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	1.1e-22
>prophage 244
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3303881	3309333	5439290		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_004178576.1|3303881_3306239_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
WP_043906858.1|3306426_3309333_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 245
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3321791	3323372	5439290		Pseudomonas_phage(50.0%)	2	NA	NA
WP_002888321.1|3321791_3322640_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
WP_002888320.1|3322892_3323372_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 246
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3329713	3330862	5439290		Halovirus(100.0%)	1	NA	NA
WP_004212571.1|3329713_3330862_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	4.1e-48
>prophage 247
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3337428	3347381	5439290	tRNA	Tupanvirus(25.0%)	7	NA	NA
WP_004197931.1|3337428_3340245_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	1.6e-77
WP_002887969.1|3340288_3341227_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887965.1|3341556_3341820_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887961.1|3341939_3342836_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004197936.1|3342890_3344066_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	6.4e-89
WP_002887955.1|3344243_3345377_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_004146997.1|3345464_3347381_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 248
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3351777	3352731	5439290		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|3351777_3352731_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 249
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3369887	3375047	5439290		Bacillus_phage(33.33%)	3	NA	NA
WP_004178553.1|3369887_3371825_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
WP_002887805.1|3372053_3373721_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887802.1|3373814_3375047_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 250
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3381378	3382701	5439290		Geobacillus_virus(100.0%)	1	NA	NA
WP_004178548.1|3381378_3382701_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.7	2.0e-78
>prophage 251
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3387436	3390157	5439290		Salmonella_phage(50.0%)	3	NA	NA
WP_003019081.1|3387436_3387598_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
WP_004146042.1|3387727_3388348_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887711.1|3388567_3390157_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 252
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3403377	3404657	5439290		Salmonella_phage(50.0%)	2	NA	NA
WP_004178536.1|3403377_3403917_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
WP_002887623.1|3403919_3404657_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 253
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3407817	3410985	5439290	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_004178533.1|3407817_3408756_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	1.0e-68
WP_085955639.1|3408895_3409927_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004178529.1|3409923_3410985_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.1e-07
>prophage 254
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3445904	3446831	5439290	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|3445904_3446831_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 255
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3462417	3472102	5439290	tRNA	Bacillus_virus(66.67%)	6	NA	NA
WP_004178475.1|3462417_3463902_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	8.5e-14
WP_085903275.1|3463952_3464939_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004178473.1|3465440_3466448_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004178471.1|3466496_3467891_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.7	6.8e-13
WP_004178470.1|3468293_3469361_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004178468.1|3469357_3472102_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.7e-21
>prophage 256
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3481826	3483933	5439290		Hokovirus(50.0%)	2	NA	NA
WP_004178459.1|3481826_3483260_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.0	2.0e-12
WP_002887273.1|3483249_3483933_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 257
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3487171	3492129	5439290		Leptospira_phage(33.33%)	4	NA	NA
WP_004178451.1|3487171_3490321_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	7.0e-58
WP_004177568.1|3490393_3490741_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887259.1|3490750_3491284_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887258.1|3491400_3492129_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 258
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3524231	3538625	5439290	integrase	uncultured_Mediterranean_phage(25.0%)	5	3532040:3532054	3540838:3540852
WP_004178408.1|3524231_3530552_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	3.3e-46
WP_004196471.1|3530623_3531955_-	type-1 restriction enzyme EcoKI specificity protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	2.2e-16
WP_004178405.1|3531951_3533541_-	type I restriction-modification system methyltransferase	NA	NA	NA	NA	NA
3532040:3532054	attL	TCCAGCTCGCCCAGC	NA	NA	NA	NA
WP_031281057.1|3533612_3537122_-	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
WP_004178403.1|3537359_3538625_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-81
3540838:3540852	attR	GCTGGGCGAGCTGGA	NA	NA	NA	NA
>prophage 259
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3541747	3546573	5439290		Tupanvirus(50.0%)	5	NA	NA
WP_004178400.1|3541747_3542767_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
WP_004178399.1|3542909_3543782_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002886980.1|3543771_3544659_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004178398.1|3544669_3545494_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_004178396.1|3545499_3546573_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
>prophage 260
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3561619	3570669	5439290	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_004178391.1|3561619_3563122_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.7e-84
WP_002886956.1|3563170_3564253_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886955.1|3564252_3565350_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886954.1|3565739_3567251_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886953.1|3567370_3567814_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004178390.1|3567813_3570669_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	3.5e-141
>prophage 261
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3574818	3580877	5439290		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002886928.1|3574818_3575754_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
WP_002886927.1|3575767_3576229_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886926.1|3576381_3576768_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_004152273.1|3576841_3579550_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_004178381.1|3579929_3580877_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	3.3e-11
>prophage 262
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3588634	3591766	5439290		Vibrio_phage(33.33%)	3	NA	NA
WP_004186701.1|3588634_3590773_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
WP_004178375.1|3591013_3591478_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	3.8e-53
WP_004178374.1|3591481_3591766_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	1.4e-26
>prophage 263
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3607516	3614095	5439290		Klosneuvirus(33.33%)	6	NA	NA
WP_002886827.1|3607516_3608515_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
WP_004178367.1|3608557_3609556_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004178366.1|3609542_3610568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004177669.1|3610578_3612081_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_002886769.1|3612204_3613161_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886766.1|3613564_3614095_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 264
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3632516	3633341	5439290		Bordetella_phage(100.0%)	1	NA	NA
WP_004178350.1|3632516_3633341_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.5e-07
>prophage 265
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3652936	3657280	5439290		Lactococcus_phage(50.0%)	3	NA	NA
WP_002885668.1|3652936_3655369_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
WP_002885667.1|3655405_3655831_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885665.1|3655981_3657280_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 266
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3663211	3666434	5439290		Wolbachia_phage(50.0%)	2	NA	NA
WP_004178337.1|3663211_3665071_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
WP_004178335.1|3665081_3666434_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 267
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3671276	3671822	5439290		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|3671276_3671822_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 268
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3679176	3684370	5439290		Tupanvirus(33.33%)	6	NA	NA
WP_004146714.1|3679176_3680154_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
WP_004177727.1|3680429_3682220_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004177729.1|3682212_3682947_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_002885530.1|3682957_3683353_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004178329.1|3683363_3683723_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004178328.1|3683836_3684370_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	49.3	2.5e-40
>prophage 269
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3695096	3700743	5439290		Bacillus_phage(33.33%)	5	NA	NA
WP_004178319.1|3695096_3697220_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.1	4.9e-31
WP_004178318.1|3697233_3698097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152419.1|3698151_3698505_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885441.1|3698765_3700412_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152420.1|3700449_3700743_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 270
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3720813	3724328	5439290		Escherichia_phage(50.0%)	5	NA	NA
WP_004221988.1|3720813_3721497_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
WP_002885338.1|3721642_3722560_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885324.1|3722559_3722865_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004178312.1|3722990_3723362_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	52.8	2.8e-22
WP_004146678.1|3723371_3724328_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 271
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3728692	3730195	5439290		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|3728692_3730195_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 272
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3735555	3737102	5439290		Bacillus_virus(50.0%)	2	NA	NA
WP_004178305.1|3735555_3736314_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.7e-15
WP_002885196.1|3736421_3737102_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 273
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3742482	3744003	5439290		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|3742482_3744003_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 274
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3749944	3756729	5439290		Escherichia_phage(50.0%)	5	NA	NA
WP_012737173.1|3749944_3752092_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
WP_004151733.1|3752321_3753008_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004146659.1|3753044_3754358_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_038989974.1|3754469_3754670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178297.1|3754770_3756729_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	2.3e-91
>prophage 275
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3769014	3770364	5439290		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|3769014_3770364_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 276
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3777893	3778925	5439290		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004178286.1|3777893_3778925_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 277
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3790905	3796212	5439290		Vibrio_phage(33.33%)	3	NA	NA
WP_004178276.1|3790905_3792486_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_004151744.1|3792610_3793135_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004146620.1|3793386_3796212_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 278
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3799394	3801921	5439290		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_004178273.1|3799394_3800474_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	2.4e-26
WP_002884942.1|3800505_3801921_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 279
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3807916	3808525	5439290		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|3807916_3808525_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 280
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3815591	3816701	5439290		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|3815591_3816701_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 281
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3834604	3838288	5439290		Dickeya_phage(100.0%)	1	NA	NA
WP_004178260.1|3834604_3838288_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 282
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3851834	3853424	5439290		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004178254.1|3851834_3853424_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	4.0e-70
>prophage 283
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3858845	3860609	5439290		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|3858845_3859118_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_002884331.1|3859304_3859895_-	YjaG family protein	NA	NA	NA	NA	NA
WP_004152311.1|3859937_3860609_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
>prophage 284
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3869034	3881478	5439290		Bacillus_phage(33.33%)	6	NA	NA
WP_004178221.1|3869034_3870567_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
WP_002884150.1|3870739_3871045_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002884149.1|3871048_3871366_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884148.1|3871408_3872749_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884146.1|3873149_3877373_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_004152306.1|3877449_3881478_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 285
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3885705	3888826	5439290		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|3885705_3886890_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002883524.1|3887875_3888826_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 286
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3898631	3899246	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|3898631_3899246_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 287
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3907963	3911307	5439290		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_002883427.1|3907963_3908743_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
WP_004181653.1|3908745_3909282_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883425.1|3909285_3909537_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004177924.1|3909666_3911307_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 288
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3923308	3926782	5439290	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_004181650.1|3923308_3924229_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
WP_004152056.1|3924273_3924894_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_004152055.1|3924955_3926782_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 289
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3930618	3934463	5439290		Bacillus_phage(50.0%)	3	NA	NA
WP_002883398.1|3930618_3932781_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
WP_002883397.1|3932844_3933561_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883396.1|3933560_3934463_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 290
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3950830	3956972	5439290		uncultured_marine_virus(20.0%)	6	NA	NA
WP_002883310.1|3950830_3951961_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_004146507.1|3951966_3952641_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004181646.1|3952618_3953500_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	4.6e-108
WP_004181645.1|3953518_3954586_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_004181644.1|3954582_3955845_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	2.9e-23
WP_002883297.1|3955841_3956972_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 291
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3961022	3962959	5439290		Indivirus(50.0%)	2	NA	NA
WP_002883224.1|3961022_3961352_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_002883222.1|3961693_3962959_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
>prophage 292
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3967450	3969472	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004181641.1|3967450_3969472_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 293
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3977574	3979221	5439290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|3977574_3979221_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 294
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	3989287	3991126	5439290		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004146288.1|3989287_3991126_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 295
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4005757	4006420	5439290		Cyanophage(100.0%)	1	NA	NA
WP_004181633.1|4005757_4006420_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	7.9e-28
>prophage 296
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4023814	4025149	5439290		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|4023814_4025149_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 297
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4029651	4033155	5439290		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_002882901.1|4029651_4030350_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_002882898.1|4030346_4031720_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_004181626.1|4031787_4032462_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_043906870.1|4032534_4033155_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	6.0e-62
>prophage 298
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4041494	4043006	5439290		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004150373.1|4041494_4043006_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 299
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4060757	4136318	5439290	transposase,tRNA,integrase	Paramecium_bursaria_Chlorella_virus(11.76%)	65	4115209:4115225	4133027:4133043
WP_004181612.1|4060757_4061675_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	29.2	1.3e-17
WP_004178031.1|4061688_4062630_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_002882809.1|4062674_4063112_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_004146232.1|4063108_4063969_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_004151865.1|4063962_4064562_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002882755.1|4064697_4066521_-	ribosome-dependent GTPase TypA	NA	NA	NA	NA	NA
WP_002882753.1|4066899_4068309_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004146229.1|4068497_4069547_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
WP_002882749.1|4069555_4070965_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004152951.1|4071075_4071186_+	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_002882745.1|4071221_4072595_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002882743.1|4072783_4073290_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_002882734.1|4073873_4074506_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_004195596.1|4074853_4077646_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	4.9e-71
WP_002882728.1|4078042_4078942_+	acyltransferase	NA	NA	NA	NA	NA
WP_004146224.1|4078990_4079614_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_004181610.1|4079641_4080628_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002882612.1|4080703_4080973_-	YihD family protein	NA	NA	NA	NA	NA
WP_004181609.1|4081044_4081626_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002882596.1|4081622_4082129_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002882540.1|4087814_4088516_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002882539.1|4088528_4089926_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004187944.1|4089922_4090915_-	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_004195262.1|4090918_4091848_-	ribokinase	NA	NA	NA	NA	NA
WP_002882536.1|4091951_4092842_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
WP_043906872.1|4092869_4093835_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004181605.1|4093840_4095346_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.1	4.4e-18
WP_002882527.1|4095356_4095776_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882520.1|4095961_4097830_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_004151555.1|4098047_4099547_+	ATPase RavA	NA	NA	NA	NA	NA
WP_002882517.1|4099543_4100992_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_002882514.1|4100995_4101988_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
WP_002882510.1|4102139_4102598_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004181604.1|4102697_4103138_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004144989.1|4103519_4105409_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004151554.1|4105524_4106148_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004144991.1|4106764_4107145_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004173838.1|4107152_4107968_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|4108017_4108257_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004107293.1|4108307_4108778_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004144994.1|4108792_4109326_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004144995.1|4109338_4110880_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004144996.1|4110930_4111794_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004144997.1|4111820_4113203_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_001251971.1|4113223_4113643_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004181603.1|4114339_4115710_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
4115209:4115225	attL	GAAAATCGGCGCCGGCT	NA	NA	NA	NA
WP_004150309.1|4115893_4117723_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
WP_001029679.1|4117882_4118704_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_043906873.1|4118690_4120799_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4120795_4122463_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4122465_4123992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4123992_4125609_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|4125839_4126217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4126626_4126998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4127058_4127556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704156.1|4127624_4128149_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|4128243_4128717_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000019473.1|4129345_4130326_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_153236428.1|4130383_4130785_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.1	4.5e-10
WP_000497519.1|4130899_4131226_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|4131413_4131653_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_004150308.1|4132478_4133519_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
4133027:4133043	attR	GAAAATCGGCGCCGGCT	NA	NA	NA	NA
WP_004145004.1|4133647_4134607_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004151547.1|4134606_4135497_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_087741199.1|4135544_4136318_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	1.5e-14
>prophage 300
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4142091	4143429	5439290		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|4142091_4143429_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 301
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4150921	4158451	5439290		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004151536.1|4150921_4151179_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
WP_004151535.1|4151142_4151502_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|4151517_4151658_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151534.1|4152279_4153683_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004145090.1|4153687_4154788_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
WP_004151532.1|4154934_4156008_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004173845.1|4156036_4158451_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
>prophage 302
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4164218	4165367	5439290		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|4164218_4165367_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 303
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4168808	4170728	5439290		Cyanophage(33.33%)	3	NA	NA
WP_004151523.1|4168808_4169222_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_004181593.1|4169338_4169767_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004181592.1|4169903_4170728_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
>prophage 304
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4181738	4187178	5439290		Salmonella_phage(50.0%)	6	NA	NA
WP_004181587.1|4181738_4182923_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
WP_002923296.1|4183098_4183932_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002923294.1|4184000_4184447_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923292.1|4184537_4184627_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923286.1|4185289_4185385_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004181586.1|4185489_4187178_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
>prophage 305
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4199353	4200466	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004181577.1|4199353_4200466_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 306
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4218721	4219885	5439290		Salmonella_phage(100.0%)	1	NA	NA
WP_004197144.1|4218721_4219885_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	7.6e-26
>prophage 307
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4237017	4238067	5439290		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|4237017_4238067_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 308
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4251468	4252860	5439290		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|4251468_4252860_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 309
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4255994	4256846	5439290		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|4255994_4256846_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 310
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4267827	4276118	5439290		Bordetella_phage(25.0%)	7	NA	NA
WP_004150214.1|4267827_4269948_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|4269966_4270242_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|4270296_4270920_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_004181537.1|4271178_4272855_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	3.9e-23
WP_002922654.1|4272860_4273478_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004151501.1|4273753_4275004_+	chloride channel protein	NA	NA	NA	NA	NA
WP_004151500.1|4275059_4276118_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
>prophage 311
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4280887	4283278	5439290	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_000019473.1|4280887_4281868_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_087741200.1|4281849_4282368_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004181533.1|4282360_4283278_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.1e-23
>prophage 312
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4287918	4292661	5439290		Xanthomonas_phage(25.0%)	7	NA	NA
WP_002922593.1|4287918_4288374_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
WP_004188117.1|4288354_4289569_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.1e-43
WP_002922589.1|4289741_4290407_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|4290623_4290860_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|4290880_4291048_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004173907.1|4291183_4291993_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.2e-24
WP_002922501.1|4292181_4292661_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 313
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4305429	4314579	5439290		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_004181522.1|4305429_4306362_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
WP_002922462.1|4306575_4307769_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922461.1|4307781_4308807_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922460.1|4308975_4309764_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922459.1|4309769_4310717_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922458.1|4310720_4311992_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_004152046.1|4312001_4313546_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922436.1|4313791_4314223_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002922429.1|4314327_4314579_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 314
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4329229	4331071	5439290		Tupanvirus(100.0%)	1	NA	NA
WP_004173923.1|4329229_4331071_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 315
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4339045	4340587	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|4339045_4340587_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 316
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4346055	4347051	5439290		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004181515.1|4346055_4347051_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	2.1e-08
>prophage 317
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4350954	4354459	5439290	transposase	Mannheimia_phage(33.33%)	4	NA	NA
WP_004173931.1|4350954_4352001_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004181513.1|4352074_4352227_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_004181512.1|4352528_4354148_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.9	8.1e-26
WP_000014594.1|4354246_4354459_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 318
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4357862	4358834	5439290		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004145219.1|4357862_4358834_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 319
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4363993	4366733	5439290		Escherichia_phage(50.0%)	2	NA	NA
WP_004181510.1|4363993_4366324_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	3.4e-65
WP_004181509.1|4366292_4366733_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.3e-15
>prophage 320
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4377624	4379618	5439290		Planktothrix_phage(50.0%)	2	NA	NA
WP_002921785.1|4377624_4378608_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
WP_002921784.1|4378604_4379618_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
>prophage 321
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4427328	4429371	5439290		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|4427328_4429371_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 322
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4442269	4445516	5439290		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_015058217.1|4442269_4442479_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
WP_015056402.1|4442546_4445516_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
>prophage 323
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4451680	4453315	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015056407.1|4451680_4453315_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.9e-103
>prophage 324
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4457236	4458028	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004181487.1|4457236_4458028_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	1.6e-14
>prophage 325
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4464130	4468237	5439290		Tupanvirus(66.67%)	3	NA	NA
WP_004181482.1|4464130_4465270_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	26.8	2.1e-28
WP_002921035.1|4465271_4466255_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921032.1|4466251_4468237_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 326
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4474537	4478897	5439290		Dickeya_phage(50.0%)	4	NA	NA
WP_002920860.1|4474537_4475203_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
WP_004181480.1|4475409_4475655_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_004181479.1|4475981_4478192_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.8e-113
WP_004181478.1|4478270_4478897_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	59.3	6.1e-30
>prophage 327
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4481981	4487782	5439290		Staphylococcus_phage(25.0%)	5	NA	NA
WP_002920817.1|4481981_4482650_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
WP_004173994.1|4482642_4483698_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|4483967_4484822_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_004181476.1|4484874_4486398_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_004181475.1|4486516_4487782_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.6e-24
>prophage 328
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4495350	4497583	5439290		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920803.1|4495350_4496118_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
WP_004145133.1|4496119_4496833_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_004174006.1|4496996_4497218_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002920800.1|4497214_4497583_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 329
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4501009	4502817	5439290		Planktothrix_phage(50.0%)	2	NA	NA
WP_043906884.1|4501009_4502080_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	4.4e-20
WP_004181472.1|4502076_4502817_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	7.0e-09
>prophage 330
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4520560	4523008	5439290		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|4520560_4523008_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 331
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4526069	4526828	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|4526069_4526828_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 332
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4530173	4532564	5439290		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|4530173_4532564_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 333
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4545390	4549162	5439290		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|4545390_4546110_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_002920333.1|4546106_4547462_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_004181458.1|4547539_4549162_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.1	1.1e-139
>prophage 334
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4563988	4564816	5439290		Vibrio_phage(100.0%)	1	NA	NA
WP_043906886.1|4563988_4564816_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.6	1.4e-69
>prophage 335
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4576217	4585861	5439290		Acinetobacter_phage(25.0%)	9	NA	NA
WP_004181445.1|4576217_4576781_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	1.4e-57
WP_004174049.1|4576871_4578092_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004181443.1|4578081_4580160_-	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_000242758.1|4580211_4580844_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_002920158.1|4581150_4581555_+	OsmC family protein	NA	NA	NA	NA	NA
WP_002920153.1|4581609_4582479_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920151.1|4582515_4582734_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_004181442.1|4582730_4583753_-	hydrolase	NA	NA	NA	NA	NA
WP_004174057.1|4583956_4585861_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	8.5e-75
>prophage 336
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4593706	4597075	5439290		Streptococcus_phage(50.0%)	2	NA	NA
WP_002920103.1|4593706_4595821_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
WP_004174069.1|4595890_4597075_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 337
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4616978	4618450	5439290	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_004150007.1|4616978_4617926_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|4617940_4618450_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
>prophage 338
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4645976	4647020	5439290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|4645976_4647020_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 339
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4665070	4666339	5439290		Oenococcus_phage(100.0%)	1	NA	NA
WP_004181428.1|4665070_4666339_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	1.8e-60
>prophage 340
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4673339	4674707	5439290	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004174125.1|4673339_4674707_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 341
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4678652	4679147	5439290	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_002918465.1|4678652_4679147_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 342
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4686592	4687525	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|4686592_4687525_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 343
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4691469	4704400	5439290		Hokovirus(16.67%)	15	NA	NA
WP_002918444.1|4691469_4693809_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
WP_004181418.1|4694042_4694696_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_004144927.1|4694692_4695418_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918431.1|4695481_4695754_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918428.1|4695750_4696605_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004144926.1|4696650_4697139_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918423.1|4697209_4697497_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918420.1|4697519_4698953_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918417.1|4699000_4699726_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918415.1|4699732_4700278_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918413.1|4700246_4700822_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918405.1|4700818_4701385_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918399.1|4701399_4702386_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918397.1|4702400_4703378_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004150950.1|4703587_4704400_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 344
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4708449	4709891	5439290		Vibrio_phage(50.0%)	2	NA	NA
WP_002918381.1|4708449_4708722_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
WP_004144907.1|4708919_4709891_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 345
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4716489	4719366	5439290	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_002918372.1|4716489_4718424_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_002918371.1|4718517_4719366_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 346
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4723630	4730249	5439290		Dickeya_phage(50.0%)	4	NA	NA
WP_004144895.1|4723630_4724974_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_002918364.1|4725566_4726019_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002918252.1|4726046_4727534_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918250.1|4727558_4730249_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 347
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4735663	4737595	5439290		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|4735663_4737595_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 348
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4743288	4751164	5439290		Invertebrate_iridovirus(25.0%)	10	NA	NA
WP_004152864.1|4743288_4743573_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
WP_002918223.1|4743628_4744072_+	YhbP family protein	NA	NA	NA	NA	NA
WP_002918221.1|4744033_4744570_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_004181410.1|4744698_4745346_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_043906890.1|4745421_4746462_+	permease	NA	NA	NA	NA	NA
WP_002918214.1|4746583_4747159_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918211.1|4747168_4747759_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918206.1|4747784_4748171_-	YraN family protein	NA	NA	NA	NA	NA
WP_004181409.1|4748128_4750237_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004144878.1|4750300_4751164_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
>prophage 349
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4756438	4757584	5439290		Streptococcus_phage(100.0%)	1	NA	NA
WP_004181406.1|4756438_4757584_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.6	2.6e-50
>prophage 350
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4774720	4775692	5439290		Escherichia_phage(100.0%)	1	NA	NA
WP_004144845.1|4774720_4775692_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
>prophage 351
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4785255	4786743	5439290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004181393.1|4785255_4786743_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	27.3	1.1e-08
>prophage 352
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4791014	4792394	5439290		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|4791014_4792394_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 353
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4810472	4869215	5439290	tRNA,plate,terminase,integrase,lysis,capsid,portal,head,tail	Salmonella_phage(76.74%)	71	4808018:4808034	4874435:4874451
4808018:4808034	attL	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
WP_002917658.1|4810472_4811276_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
WP_002917655.1|4811328_4811634_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917651.1|4811660_4812236_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_004174235.1|4812506_4813139_+	YfdX family protein	NA	NA	NA	NA	NA
WP_004181365.1|4813229_4816472_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
WP_004174237.1|4816476_4817091_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004181363.1|4817443_4817758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181362.1|4817826_4818099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439000.1|4818720_4819806_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
WP_004144799.1|4819809_4820430_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.5	3.3e-36
WP_004144798.1|4820530_4820767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174275.1|4820801_4821311_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.6	5.4e-77
WP_004205792.1|4821318_4821519_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
WP_004144796.1|4821482_4821821_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_059689717.1|4821888_4822122_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.0e-30
WP_004144794.1|4822121_4822349_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	5.6e-34
WP_059689718.1|4822345_4823233_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.9	3.1e-120
WP_059689720.1|4823213_4825619_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.0	0.0e+00
WP_004144689.1|4825805_4825994_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_059689856.1|4826007_4826241_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.5e-31
WP_023318927.1|4826317_4826575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689722.1|4826869_4827679_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_142758158.1|4827698_4828361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048300108.1|4828370_4829219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689725.1|4829256_4830288_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.6	1.8e-175
WP_049594188.1|4830287_4832051_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
WP_059689727.1|4832191_4833025_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
WP_020324020.1|4833041_4834106_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_059689728.1|4834109_4834760_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	85.2	5.3e-101
WP_059689730.1|4834856_4835321_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	6.0e-75
WP_002896155.1|4835320_4835524_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004144702.1|4835527_4835743_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_059689731.1|4835723_4836233_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	2.5e-82
WP_049594185.1|4836237_4836621_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	9.5e-18
WP_059689733.1|4836617_4837046_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_059689735.1|4837141_4837564_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	3.1e-62
WP_059689737.1|4837556_4838009_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.5	3.1e-52
WP_059689738.1|4838044_4838662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689740.1|4838768_4839341_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	1.6e-77
WP_059689742.1|4839337_4839700_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.2e-48
WP_059689744.1|4839686_4840595_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	69.5	1.2e-111
WP_059689745.1|4840587_4841196_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.6	8.8e-58
WP_059689747.1|4843327_4844068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142290340.1|4844087_4844240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087741202.1|4844209_4845166_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	47.8	3.8e-23
WP_004185685.1|4845304_4846477_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
WP_002896201.1|4846486_4847002_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|4847054_4847354_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|4847368_4847488_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_059689751.1|4847480_4850108_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	5.0e-118
WP_004185683.1|4850104_4850590_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_019704974.1|4850586_4851684_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
WP_004174338.1|4851754_4851973_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|4851985_4852363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|4852690_4853197_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|4853296_4855138_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|4855356_4857102_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|4857213_4857429_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004181358.1|4857666_4858680_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.1e-108
WP_004181356.1|4858724_4860332_-	allantoin permease	NA	NA	NA	NA	NA
WP_002916877.1|4860485_4861103_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_004195728.1|4861111_4861786_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_004181345.1|4861787_4862264_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_004181343.1|4862273_4863977_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_002916872.1|4863969_4864290_-	urease subunit beta	NA	NA	NA	NA	NA
WP_002916871.1|4864299_4864602_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_004181341.1|4864611_4865436_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_004144530.1|4865833_4866451_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004150923.1|4866558_4866942_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004144532.1|4867140_4867962_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002916864.1|4867973_4869215_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
4874435:4874451	attR	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
>prophage 354
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4874326	4881207	5439290		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
WP_004174353.1|4874326_4875760_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	1.5e-39
WP_002916857.1|4875978_4876176_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916856.1|4876211_4876484_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004174356.1|4876861_4877515_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
WP_002916852.1|4877576_4878347_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_004181331.1|4878533_4879325_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004144540.1|4879369_4880530_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.1e-88
WP_004181330.1|4880535_4881207_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.8	4.4e-42
>prophage 355
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4885549	4887445	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|4885549_4887445_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 356
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4890756	4902470	5439290	transposase,integrase	Stx_converting_phage(20.0%)	10	NA	NA
WP_002916833.1|4890756_4891152_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
WP_002916831.1|4891229_4892099_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087741203.1|4892194_4893253_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.4e-05
WP_157663658.1|4893207_4893951_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002916828.1|4894031_4896290_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916826.1|4896481_4897219_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004144547.1|4897302_4898715_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004174383.1|4898838_4901022_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004150920.1|4901079_4901607_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916796.1|4901642_4902470_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 357
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4922177	4923548	5439290		Lactococcus_phage(100.0%)	1	NA	NA
WP_004195693.1|4922177_4923548_-	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 358
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4931887	4933969	5439290		unidentified_phage(100.0%)	1	NA	NA
WP_032408591.1|4931887_4933969_+	RNA-directed DNA polymerase	NA	H7BW53	unidentified_phage	33.1	2.0e-08
>prophage 359
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4941167	4942250	5439290		Geobacillus_virus(100.0%)	1	NA	NA
WP_086530206.1|4941167_4942250_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 360
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4946912	4947722	5439290		Bacillus_virus(100.0%)	1	NA	NA
WP_004181271.1|4946912_4947722_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.9e-18
>prophage 361
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4960592	4961747	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|4960592_4961747_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 362
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4977735	4978968	5439290		Catovirus(100.0%)	1	NA	NA
WP_004181253.1|4977735_4978968_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	2.4e-102
>prophage 363
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	4986911	4989785	5439290		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004181243.1|4986911_4989785_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	7.4e-264
>prophage 364
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5000490	5006573	5439290	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_004144729.1|5000490_5001387_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
WP_002916301.1|5001409_5002123_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004149758.1|5002128_5003862_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_095858446.1|5003947_5005045_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_002916299.1|5005055_5006573_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
>prophage 365
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5011441	5012155	5439290		Clostridium_phage(100.0%)	1	NA	NA
WP_004157874.1|5011441_5012155_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 366
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5016122	5017142	5439290		Klosneuvirus(100.0%)	1	NA	NA
WP_004181227.1|5016122_5017142_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 367
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5020640	5024772	5439290		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916281.1|5020640_5020970_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
WP_004181225.1|5021021_5022314_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.0	5.1e-164
WP_004181224.1|5022323_5022746_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.5e-45
WP_002916277.1|5023218_5024772_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 368
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5039247	5040926	5439290	integrase	Escherichia_phage(100.0%)	2	5033258:5033272	5043047:5043061
5033258:5033272	attL	TTCAGCGTGGTGCCG	NA	NA	NA	NA
WP_002916189.1|5039247_5039856_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
WP_043906903.1|5040320_5040926_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.8	1.8e-50
5043047:5043061	attR	TTCAGCGTGGTGCCG	NA	NA	NA	NA
>prophage 369
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5061521	5064992	5439290		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_002916003.1|5061521_5062283_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
WP_002916001.1|5062578_5064000_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_004181200.1|5063996_5064992_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.2e-13
>prophage 370
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5070755	5071883	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004149643.1|5070755_5071883_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 371
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5077596	5078607	5439290		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|5077596_5078607_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 372
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5084585	5096503	5439290		Staphylococcus_phage(25.0%)	11	NA	NA
WP_002915977.1|5084585_5086745_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
WP_002915976.1|5086737_5087931_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915975.1|5088033_5089074_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915974.1|5089294_5089513_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915973.1|5089636_5090350_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_004143967.1|5090413_5091109_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_020325083.1|5091125_5091338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915936.1|5091791_5092322_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002915935.1|5092334_5094581_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915934.1|5094826_5095702_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915933.1|5095708_5096503_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 373
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5102016	5113696	5439290		Hokovirus(25.0%)	6	NA	NA
WP_004181181.1|5102016_5104902_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.9	8.2e-45
WP_004181180.1|5104898_5108435_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_004181177.1|5108431_5110276_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.6	1.2e-20
WP_002915873.1|5110333_5110654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149616.1|5110883_5112215_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004174538.1|5112442_5113696_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 374
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5146347	5147172	5439290		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004181155.1|5146347_5147172_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	2.5e-07
>prophage 375
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5158914	5165914	5439290	transposase	Burkholderia_virus(33.33%)	4	NA	NA
WP_020325073.1|5158914_5159175_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	31.8	1.6e-05
WP_004181146.1|5159354_5160458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|5161673_5162654_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004181144.1|5163433_5165914_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.4	6.2e-17
>prophage 376
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5173025	5175526	5439290	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_004181136.1|5173025_5173847_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
WP_004142894.1|5173889_5174321_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004174604.1|5174320_5175526_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
>prophage 377
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5187071	5187827	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|5187071_5187827_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 378
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5194231	5195254	5439290		Bacillus_phage(100.0%)	1	NA	NA
WP_004174621.1|5194231_5195254_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
>prophage 379
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5205509	5206355	5439290		Vibrio_phage(100.0%)	1	NA	NA
WP_004181116.1|5205509_5206355_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 380
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5213769	5219235	5439290		Streptococcus_phage(33.33%)	3	NA	NA
WP_002915222.1|5213769_5214909_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
WP_004151066.1|5215066_5217817_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_004181108.1|5217930_5219235_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.9e-34
>prophage 381
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5222777	5228114	5439290		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_004142808.1|5222777_5224415_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
WP_002915213.1|5224496_5225795_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_004181104.1|5225858_5226968_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004181101.1|5227442_5228114_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	4.3e-13
>prophage 382
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5236880	5238913	5439290		Hokovirus(50.0%)	2	NA	NA
WP_004181094.1|5236880_5238308_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.1	1.1e-34
WP_002915158.1|5238307_5238913_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 383
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5241983	5248402	5439290		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004174648.1|5241983_5242745_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
WP_002915108.1|5242738_5243365_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_004149542.1|5243490_5244627_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
WP_002915106.1|5244784_5245777_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915104.1|5245829_5246207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181083.1|5246203_5247406_-	MFS transporter	NA	NA	NA	NA	NA
WP_004181081.1|5247514_5248402_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	1.9e-05
>prophage 384
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5251869	5257033	5439290		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_004151059.1|5251869_5254431_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
WP_008806210.1|5254699_5255047_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004188736.1|5255031_5255481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915094.1|5255492_5255975_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004149516.1|5256253_5257033_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	9.3e-12
>prophage 385
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5268776	5269598	5439290		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004181057.1|5268776_5269598_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 386
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5279963	5281364	5439290		Pandoravirus(100.0%)	1	NA	NA
WP_004181046.1|5279963_5281364_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	4.0e-45
>prophage 387
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5308298	5309264	5439290		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004181025.1|5308298_5309264_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	2.1e-37
>prophage 388
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5315201	5323406	5439290	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_004181011.1|5315201_5315879_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
WP_004149458.1|5315875_5316739_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004181010.1|5316746_5317625_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004181009.1|5317764_5318262_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.4e-29
WP_002914769.1|5318352_5319411_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_004181008.1|5319478_5319979_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914765.1|5320229_5322857_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|5323220_5323406_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 389
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5338124	5343423	5439290		Bacillus_virus(25.0%)	5	NA	NA
WP_002914328.1|5338124_5339327_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|5339683_5340646_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|5340656_5342798_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|5342770_5343181_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|5343177_5343423_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 390
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5348604	5349507	5439290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|5348604_5349507_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 391
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5371666	5373187	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|5371666_5373187_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 392
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5387347	5387830	5439290		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002914164.1|5387347_5387830_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 393
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5403177	5404248	5439290		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|5403177_5404248_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 394
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5411038	5413612	5439290		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|5411038_5413612_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 395
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5419768	5421067	5439290		Burkholderia_virus(100.0%)	1	NA	NA
WP_004144368.1|5419768_5421067_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
>prophage 396
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5426365	5430900	5439290	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_002914091.1|5426365_5426791_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|5426994_5428080_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|5428137_5428827_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_004180937.1|5429139_5429523_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|5429568_5430900_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 397
NZ_CP021708	Klebsiella pneumoniae strain AR_0143, complete genome	5439290	5436915	5438991	5439290	integrase	Salmonella_phage(50.0%)	4	5431691:5431702	5438701:5438712
5431691:5431702	attL	GCTGGCGATCCG	NA	NA	NA	NA
WP_023301229.1|5436915_5438145_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|5438122_5438398_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|5438435_5438675_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_043906914.1|5438682_5438991_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
5438701:5438712	attR	CGGATCGCCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP021709	Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence	186758	36752	77275	186758	transposase	Escherichia_phage(22.22%)	46	NA	NA
WP_000080200.1|36752_38366_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000170087.1|38668_39946_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000039319.1|40030_41827_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001447572.1|41888_42224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018872.1|42488_43028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793769.1|43118_43619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477209.1|43692_44577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|44642_44867_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|44928_45318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|45307_45760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|46097_46289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|46333_46711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|46902_47247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410925.1|47324_47627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|47704_49330_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_015058950.1|49345_49822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093867.1|49895_50450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042274.1|50682_51069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187969.1|51156_53610_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050847.1|53811_54015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|54086_54692_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|54684_54954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|54967_55186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|55259_55817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|55891_56743_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|57201_57588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|57765_59493_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|59479_59758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|59830_60052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|60233_61238_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|61316_64289_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|64291_64849_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001067855.1|65256_65961_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087741208.1|65951_66179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201164.1|66279_67092_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|67095_67461_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_015058923.1|67465_68125_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004193231.1|68951_69827_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|69830_70196_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|70088_70424_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|70417_71257_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|71661_73203_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|74601_75375_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|75355_75637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|75856_76042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|76090_77275_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
>prophage 2
NZ_CP021709	Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence	186758	84156	121461	186758	integrase,transposase	uncultured_Mediterranean_phage(22.22%)	25	96859:96874	123895:123910
WP_001067858.1|84156_84861_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|87315_87750_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|87828_88833_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001326390.1|89448_89850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|89963_90689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|90821_95075_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_001326394.1|95046_95487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|95657_96110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|96125_96728_-	hypothetical protein	NA	NA	NA	NA	NA
96859:96874	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_015056397.1|97094_97916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015056398.1|97905_100059_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015056399.1|100048_101497_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015056400.1|101517_102936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015058217.1|103128_103338_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
WP_015056402.1|103405_106375_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
WP_015056403.1|106374_109014_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
WP_015056404.1|108995_110159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056405.1|110155_111433_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.2	1.3e-13
WP_015056406.1|111429_112545_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015056407.1|112541_114176_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.9e-103
WP_015056408.1|114355_115558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|115882_116164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|116462_116999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|117001_118012_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_021740570.1|118443_121461_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
123895:123910	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	0	1189	214114		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000843497.1|220_418_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|451_1189_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 2
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	6282	57810	214114	protease,transposase	uncultured_Caudovirales_phage(22.22%)	50	NA	NA
WP_001188930.1|6282_6963_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_072280712.1|6959_8246_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000080200.1|8232_9846_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|9876_10227_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|10223_10649_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_004152085.1|11116_11551_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|11782_11962_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|13704_14214_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|14263_14761_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|15092_15419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|15418_16129_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|16137_16683_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|16758_17121_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|19017_19554_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|19586_20012_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|20024_21314_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|21361_23113_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|23130_23493_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|23542_23893_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|24250_24520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|24507_25083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|25113_25608_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|25651_26020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|26053_26257_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|26305_26563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|26638_26893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|27068_27335_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|27322_27805_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|28016_29363_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|31205_32168_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|32154_32904_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|33141_33339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|33338_36134_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|36248_36818_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|36852_37134_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|37377_37641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|37655_37919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|39120_40101_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|41309_42179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|42172_43183_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|43191_44019_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|44027_44891_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|44887_45715_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_001067855.1|46570_47275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138064.1|47497_50464_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_087741209.1|50542_51547_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|51857_52235_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|52435_53095_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_004118832.1|55121_56855_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|56862_57810_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
>prophage 3
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	71285	72445	214114		Bacillus_virus(50.0%)	2	NA	NA
WP_004152282.1|71285_72053_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|72151_72445_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
>prophage 4
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	76194	80473	214114		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004152286.1|76194_77277_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|77398_80473_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
>prophage 5
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	92492	95979	214114	transposase,bacteriocin	Stx2-converting_phage(75.0%)	5	NA	NA
WP_013213996.1|92492_93044_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
WP_099459485.1|93273_93531_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004201219.1|93643_95182_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|95230_95578_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|95574_95979_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
>prophage 6
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	107452	122882	214114		Liberibacter_phage(25.0%)	8	NA	NA
WP_013214044.1|107452_110737_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.3e-66
WP_001459731.1|110789_111473_-	YecA family protein	NA	NA	NA	NA	NA
WP_013214043.1|111469_112744_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013214042.1|112733_114257_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
WP_004199370.1|115389_115986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152380.1|116152_116746_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013214040.1|116817_117543_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	7.1e-06
WP_043907038.1|117623_122882_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
>prophage 7
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	152440	204673	214114	integrase,transposase	Escherichia_phage(12.5%)	47	167573:167589	198634:198650
WP_004178064.1|152440_153262_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_004152722.1|154095_154509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|154509_154788_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|154777_155098_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|155178_155403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152718.1|155413_155626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|155686_156043_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152758.1|156678_157029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152759.1|157025_157298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118124.1|157997_158159_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032448955.1|158230_159280_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_004220208.1|159331_160411_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_000019473.1|160676_161657_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152639.1|162218_162545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152640.1|162541_163270_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152641.1|163266_163698_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152643.1|165870_166119_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_043907040.1|166167_166710_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	4.3e-48
WP_004152645.1|167485_168049_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
167573:167589	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004178068.1|168096_169452_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004198570.1|169503_169734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|169825_170053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118473.1|170834_171152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152754.1|171186_171441_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|171677_172103_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004152753.1|172623_172854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|173087_174572_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|174977_175403_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|175402_176674_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152062.1|179625_180597_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|180596_181763_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|182514_183525_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_001515717.1|184241_184982_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|186125_187073_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|187099_187411_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|187475_188399_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|189071_189329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|189948_191385_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|192367_193645_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|193707_195705_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|196744_197952_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004201219.1|198861_200400_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
198634:198650	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_000612626.1|200448_200796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|200792_201197_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_004178091.1|201842_202274_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|202524_204000_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|203992_204673_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 8
NZ_CP021710	Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence	214114	208046	211193	214114		Leptospira_phage(100.0%)	1	NA	NA
WP_004098958.1|208046_211193_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 1
NZ_CP021711	Klebsiella pneumoniae strain AR_0143 plasmid tig00000856, complete sequence	78638	30723	66165	78638	transposase,protease	Salmonella_phage(21.43%)	35	NA	NA
WP_000616807.1|30723_31377_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|31469_31727_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|31659_32061_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|32197_35095_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_087741211.1|35189_35498_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001067855.1|35443_36148_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|38469_38802_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|38848_39724_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|39979_41242_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|41805_42363_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|42545_43406_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|46166_46871_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|46861_47002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|48812_49094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|49216_49567_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|49569_50532_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|50678_50972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|51048_51732_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|51732_51954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|51967_52402_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|53101_53674_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|53646_54072_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001763816.1|54118_54541_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027493.1|54537_54729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|55766_55997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|56048_57410_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001298559.1|57456_58020_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000290834.1|58886_59414_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|59471_59705_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845953.1|61802_62237_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|62233_62953_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|63232_63391_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000422741.1|63748_64174_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|64170_64521_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|64551_66165_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
>prophage 1
NZ_CP021712	Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence	70457	4883	46866	70457	integrase,transposase	Escherichia_phage(35.0%)	48	12003:12062	46459:47279
WP_040204372.1|4883_5486_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	66.3	3.2e-76
WP_038988891.1|7372_7819_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004098817.1|8254_9469_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|9502_10936_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|11317_11524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|11528_12041_-	restriction endonuclease	NA	NA	NA	NA	NA
12003:12062	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|12065_12770_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001217881.1|14308_14866_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|15099_15654_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|15723_16512_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|16571_17396_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|18095_18956_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_004152334.1|19771_20482_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|20555_20972_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|20968_21199_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000493378.1|21760_22111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|22161_22905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|22901_23678_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|23735_23993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|24760_25627_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|25983_26253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|26667_27873_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|27869_28847_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|28928_30200_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|30199_30631_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|31039_32524_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|32993_33959_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|34438_34870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|34902_35430_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|35689_36145_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|36216_36582_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_043907009.1|36597_36873_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|36900_37326_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|37364_39050_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|39067_39433_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|39429_39666_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_050558936.1|39649_39733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|39815_40520_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157663659.1|40520_40736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|40923_41739_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082320.1|41799_42603_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|42602_43439_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|43410_43950_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|44160_44385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043907045.1|44381_45119_-	resolvase	NA	NA	NA	NA	NA
WP_001044210.1|45604_45745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|45750_46455_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077625454.1|46431_46866_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	4.5e-40
46459:47279	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACAAATACTACCTTGCTTTCTGAAAAAGTAGTTATATACTATGAAAAGCGTGGTAATGCTGAAAACTATATCAAAGAAGCCAAATACGACATGGCGGTGGGTCATCTCTTGCTAAAGTCATTTTGGGCGAATGAAGCCGTGTTTCAAATGATGATGCTTTCATATAACCTATTTTTGTTGTTCAAGTTTGATTCCTTGGACTCTTCAGAATACAGACAGCAAATAAAGACCTTTCGTTTGAAGTATGTATTTCTTGCAGCAAAAATAATCAAAACCGCAAGATATGTAATCATGAAGTTGTCGGAAAACTATCCGTACAAGGGAGTGTATGAAAAATGTCTGGTATAATAAGAATATCATCAATAAAATTGAGTGTTGCTCTGTGGATAACTTGCAGAGTTTATTAAGTATCATTGCAGCAAAGATGAAATCAATGATTTATCAAAAATGATTGAAAGGTGGTTGTAAATAATGTTACAATGTGTGAGAAGCAGTCTAAATTCTTCGTGAAATAGTGATTTTTGAAGCTAATAAAAAACACACGTGGAATTTAGGGACTATTCATGTTGTTGTTATTTCGTATCTTCCAGAATAAGGAATCCCATGGTTAAAAAATCACTGCGCCAGTTCACGCTGATGGCGACGGCAACCGTCACGCTGTTGTTAGGAAGTGTGCCGCTGTATGCGCAAACGGCGGACGTACAGCAAAAACTTGCCGAATTAGAGCGGCAGTCGGGAGGCAGACTGGGTGTGGCATTGAT	NA	NA	NA	NA
