The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	0	13435	5418909		Cronobacter_phage(25.0%)	14	NA	NA
WP_004151262.1|590_1268_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1443_2199_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|2201_2456_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|2749_3220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|3236_3596_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|3695_3866_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|3855_4569_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|4634_5420_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|5547_6051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|6143_9590_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|9689_10109_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|10108_10579_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|10575_10971_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|10957_13435_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 2
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	17902	20021	5418909		Pseudomonas_phage(33.33%)	3	NA	NA
WP_022644740.1|17902_19387_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151791.1|19464_19704_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
WP_002892355.1|19703_20021_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
>prophage 3
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	31494	32415	5418909		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|31494_32415_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 4
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	38638	41963	5418909	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_004151795.1|38638_40114_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892491.1|40445_41963_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 5
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	50204	56005	5418909		Amsacta_moorei_entomopoxvirus(50.0%)	5	NA	NA
WP_004142660.1|50204_51689_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
WP_002892599.1|51699_52731_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151798.1|52914_53523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151799.1|53570_54575_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004199626.1|54604_56005_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
>prophage 6
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	62627	63425	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|62627_63425_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 7
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	78207	79323	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|78207_79323_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 8
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	122225	124940	5418909		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004151826.1|122225_124940_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 9
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	129473	130836	5418909	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|129473_130836_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 10
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	135343	140023	5418909		Streptococcus_phage(50.0%)	5	NA	NA
WP_002893182.1|135343_136807_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
WP_002893184.1|137048_137900_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893187.1|137947_138589_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893189.1|138603_139269_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151676.1|139261_140023_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
>prophage 11
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	143093	144621	5418909		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151674.1|143093_143798_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
WP_004151673.1|143784_144621_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
>prophage 12
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	149178	155092	5418909	holin	Catovirus(50.0%)	4	NA	NA
WP_004142489.1|149178_150843_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_002893471.1|150856_152329_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004151671.1|152342_152930_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004142478.1|153058_155092_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 13
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	161795	163340	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002893593.1|161795_163340_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 14
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	174732	179473	5418909		Tupanvirus(50.0%)	2	NA	NA
WP_004151663.1|174732_178614_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
WP_002893737.1|178678_179473_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 15
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	191815	196236	5418909		Burkholderia_phage(50.0%)	5	NA	NA
WP_002893905.1|191815_192220_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
WP_002893907.1|192194_192497_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893908.1|192680_193424_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004151660.1|193481_194570_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004151659.1|194733_196236_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 16
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	213347	227062	5418909		Cedratvirus(20.0%)	12	NA	NA
WP_002894255.1|213347_214376_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
WP_002894256.1|214418_215360_-	sugar kinase	NA	NA	NA	NA	NA
WP_032408629.1|215371_216376_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147555.1|216372_217362_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894349.1|217358_218909_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
WP_002894353.1|218905_219886_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151652.1|220294_222604_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894357.1|222711_223254_-	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_002894359.1|223250_223940_-	acireductone synthase	NA	NA	NA	NA	NA
WP_002894362.1|224066_225227_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004151651.1|225227_225854_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_002894369.1|225838_227062_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
>prophage 17
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	230197	232268	5418909		Bacillus_virus(50.0%)	2	NA	NA
WP_002894398.1|230197_231763_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894401.1|231839_232268_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 18
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	236358	237019	5418909		Morganella_phage(50.0%)	2	NA	NA
WP_002439184.1|236358_236568_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
WP_002894459.1|236635_237019_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 19
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	241897	244384	5418909		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002894539.1|241897_243097_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
WP_004147579.1|243235_244384_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 20
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	251428	259394	5418909	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_002894696.1|251428_254011_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
WP_002894699.1|254237_254720_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002894701.1|254765_256559_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
WP_002894704.1|256624_258295_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894706.1|258668_259394_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 21
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	265398	266445	5418909		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|265398_266445_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 22
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	270485	272150	5418909		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|270485_272150_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 23
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	276903	280705	5418909	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_004147599.1|276903_278859_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
WP_002894753.1|279037_280705_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 24
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	285393	286167	5418909		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|285393_286167_-	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 25
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	292993	300423	5418909		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004152227.1|292993_295042_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
WP_004152226.1|295062_296742_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020323459.1|296741_296831_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_002894847.1|297140_297347_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_004152225.1|297530_298973_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_002894917.1|298944_300423_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	8.4e-46
>prophage 26
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	306232	307024	5418909		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|306232_307024_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 27
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	331347	334858	5418909		Vibriophage(33.33%)	4	NA	NA
WP_004151689.1|331347_332067_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
WP_004147641.1|332063_333008_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_002895084.1|333125_333491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895086.1|333805_334858_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 28
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	339219	345742	5418909		Tupanvirus(33.33%)	7	NA	NA
WP_002895150.1|339219_340236_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
WP_002895152.1|340445_341918_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895154.1|341985_342774_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895156.1|342926_343076_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004151692.1|343218_343992_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895159.1|343991_344681_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002895161.1|344683_345742_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 29
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	350587	351322	5418909		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151694.1|350587_351322_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 30
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	361414	367037	5418909		Catovirus(50.0%)	4	NA	NA
WP_002895420.1|361414_362941_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
WP_004147672.1|363039_364422_+	amino acid permease	NA	NA	NA	NA	NA
WP_002895575.1|365200_365677_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_002895578.1|365747_367037_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 31
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	370840	371563	5418909		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|370840_371563_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 32
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	378060	378966	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|378060_378966_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 33
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	389133	390873	5418909		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|389133_390873_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 34
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	396078	404043	5418909		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_002895753.1|396078_396924_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
WP_002895757.1|396923_397916_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004151702.1|398130_399486_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895819.1|399673_401842_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
WP_002895821.1|401871_402840_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895822.1|402949_403210_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895824.1|403495_403762_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176771.1|403782_404043_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 35
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	408117	413269	5418909		Planktothrix_phage(33.33%)	6	NA	NA
WP_004142040.1|408117_408840_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
WP_002895837.1|408836_409496_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002895839.1|409621_410368_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895841.1|410776_411280_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895842.1|411517_412405_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895845.1|412756_413269_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 36
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	417270	418647	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|417270_418647_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 37
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	421656	423249	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|421656_423249_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 38
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	431228	433661	5418909		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|431228_433661_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 39
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	437904	439764	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|437904_439764_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 40
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	451469	453469	5418909		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004151716.1|451469_452672_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
WP_004151717.1|452710_453469_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 41
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	458544	510030	5418909	head,lysis,terminase,tail,plate,capsid,integrase,portal	Salmonella_phage(73.33%)	60	458452:458470	495952:495970
458452:458470	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|458544_459597_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|460015_461500_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|461598_462543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|462554_463433_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|463578_463800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|463832_464342_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|464349_464550_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|464513_464855_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|464922_465156_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|465155_465383_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|465379_466237_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|466233_468648_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|468801_468990_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|469000_469234_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|469348_470026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|470301_472044_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|472105_473131_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|473130_474897_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|475039_475873_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|475889_476948_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|476951_477602_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|477697_478162_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|478161_478365_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|478368_478584_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|478564_479074_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|479078_479462_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|479458_479887_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|479982_480414_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|480406_480853_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|480849_481542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|481636_482209_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|482205_482568_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|482554_483463_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|483455_484055_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|484056_487008_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|487011_487743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|487739_487943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|487972_489049_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|489187_490360_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|490369_490885_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|490937_491237_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|491251_491371_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|491363_493991_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|493987_494473_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|494469_495570_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|495661_495880_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|496099_497785_-	transporter	NA	NA	NA	NA	NA
495952:495970	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|498051_498435_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|498441_498705_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|498907_499195_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|500016_500919_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|501007_501487_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|501835_502948_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|503111_504245_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|504255_505209_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|505205_506051_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|506108_506597_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|506638_507766_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|507844_508561_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|508557_510030_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 42
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	513130	517480	5418909		Planktothrix_phage(50.0%)	4	NA	NA
WP_002896392.1|513130_513859_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|514085_514601_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|515478_516618_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|516649_517480_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 43
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	530296	560427	5418909	tRNA,protease	uncultured_Mediterranean_phage(13.33%)	22	NA	NA
WP_002896440.1|530296_531412_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|531408_533349_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|533425_533647_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|533972_534290_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|534320_536600_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|536720_536939_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|537292_537994_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|538038_539760_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898017.1|539760_541527_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004141839.1|541641_542637_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_000228469.1|543142_543637_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004150846.1|543772_548026_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_002898132.1|548148_548760_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002898137.1|548768_550112_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898139.1|550202_551495_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898141.1|551695_554134_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_004150845.1|554144_554762_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004150844.1|554763_555627_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004147798.1|555638_555785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150843.1|555901_557050_+	MFS transporter	NA	NA	NA	NA	NA
WP_002898145.1|557212_557953_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_002898148.1|558144_560427_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 44
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	564477	565566	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|564477_565566_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 45
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	569739	574282	5418909		Bacillus_phage(100.0%)	3	NA	NA
WP_002898165.1|569739_570027_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
WP_002898168.1|570232_572497_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002898170.1|572533_574282_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 46
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	591645	594718	5418909	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
WP_002898204.1|591645_592620_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.2	1.4e-89
WP_002898206.1|593317_594718_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 47
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	600801	605924	5418909		Agrobacterium_phage(33.33%)	3	NA	NA
WP_002898217.1|600801_602004_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
WP_002898220.1|602330_604946_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_004150838.1|605150_605924_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 48
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	614689	616597	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|614689_616597_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 49
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	629316	631371	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|629316_631371_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 50
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	636313	636973	5418909	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|636313_636973_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 51
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	661111	664630	5418909		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898708.1|661111_661285_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_004199515.1|661446_662385_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002898810.1|662791_664114_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_002898812.1|664135_664630_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 52
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	681194	682253	5418909		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|681194_682253_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 53
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	690172	690700	5418909		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|690172_690700_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 54
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	699051	699972	5418909		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|699051_699972_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 55
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	703213	703465	5418909		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|703213_703465_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 56
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	722620	723802	5418909		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002899294.1|722620_723355_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|723565_723802_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 57
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	727081	727723	5418909		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|727081_727723_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 58
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	747447	753513	5418909		Planktothrix_phage(33.33%)	6	NA	NA
WP_002900798.1|747447_748149_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
WP_002900801.1|748148_749393_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004150816.1|749441_750353_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176563.1|750367_751198_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_002900906.1|751288_751633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150815.1|751884_753513_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
>prophage 59
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	757945	759082	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|757945_759082_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 60
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	765647	864652	5418909	head,terminase,tail,portal,holin,capsid,integrase,tRNA	Klebsiella_phage(40.0%)	102	768170:768185	793429:793444
WP_004150804.1|765647_767018_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
WP_004140557.1|767021_767663_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004150803.1|767717_768824_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
768170:768185	attL	CCGGCTGCGCCGGCAG	NA	NA	NA	NA
WP_004150802.1|768880_769339_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|769355_770006_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|770246_771497_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_087749609.1|771614_772742_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_012542206.1|772722_772968_-	excisionase	NA	NA	NA	NA	NA
WP_087749610.1|773020_775159_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	41.9	3.6e-98
WP_014228879.1|775300_775645_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|775687_775882_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|776272_776587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542200.1|776934_777324_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_012542199.1|777425_777641_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_014907826.1|777643_778198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071359304.1|778249_779233_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	9.9e-43
WP_032428181.1|779225_779690_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.7e-61
WP_069345711.1|779703_780144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069345710.1|780365_782447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418036.1|782856_783090_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	69.7	6.4e-25
WP_077253879.1|783101_783392_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_032418037.1|783432_783825_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	1.0e-11
WP_032418039.1|784024_785056_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.6	3.6e-96
WP_032418040.1|785068_785422_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	6.4e-53
WP_072031996.1|785418_786471_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	40.9	6.8e-66
WP_032418041.1|786483_788265_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087749611.1|789488_789704_+|holin	holin	holin	A5LH82	Enterobacteria_phage	85.9	2.3e-29
WP_023279523.1|789703_790201_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017898986.1|790197_790548_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_017898990.1|792297_792660_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_014228902.1|792611_792929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898991.1|792925_793357_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
WP_012542168.1|793606_794041_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
793429:793444	attR	CTGCCGGCGCAGCCGG	NA	NA	NA	NA
WP_021462603.1|794040_795762_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_017898992.1|795755_795935_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_012542166.1|795934_797194_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_032429388.1|797230_798151_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_017898995.1|798228_799515_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
WP_014907814.1|799573_799834_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_064171978.1|799814_800132_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_014228910.1|800128_800467_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_032432816.1|800447_800837_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|800833_801235_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|801266_801728_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|801785_802151_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032429392.1|802383_805719_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
WP_014228916.1|805718_806057_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_032429393.1|806053_806809_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	7.9e-125
WP_023317958.1|806810_807521_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	2.5e-136
WP_032429394.1|807553_807901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023159867.1|807952_808546_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
WP_087749612.1|808608_821154_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	45.3	0.0e+00
WP_032429396.1|821215_822712_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_004892953.1|822866_823019_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004150799.1|823291_824005_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|824001_824394_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|824386_824710_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|825146_825374_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|825486_826680_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|827301_827487_+	general stress protein	NA	NA	NA	NA	NA
WP_004150794.1|827577_828072_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|828098_828605_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|828621_829509_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004150793.1|829564_830971_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|830967_831978_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|832093_832291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|832857_833490_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153233540.1|833468_833657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|834106_834793_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|835103_836612_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|836732_837623_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150787.1|837629_839414_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150785.1|839487_840696_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|840998_842042_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|842703_843618_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|843707_844346_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|844476_844740_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|844799_844925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|845042_845117_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|845116_845218_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|845275_846289_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150780.1|846589_846829_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|846818_847175_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150778.1|847161_847671_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|847816_848509_+	CTP synthase	NA	NA	NA	NA	NA
WP_004150777.1|848540_849725_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|849826_850618_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|850601_851048_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|851164_851665_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004150776.1|851908_853048_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002901096.1|853218_853461_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004152765.1|854078_855563_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901192.1|855641_856061_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152360.1|856063_857329_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_004140447.1|857335_858241_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901225.1|858407_859157_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004152361.1|859153_860371_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152362.1|860546_861428_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901229.1|861685_861997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|862118_862601_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901231.1|862759_863323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|863368_864652_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 61
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	867926	868781	5418909		Indivirus(100.0%)	1	NA	NA
WP_002901238.1|867926_868781_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
>prophage 62
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	872465	873719	5418909		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|872465_873719_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 63
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	879411	883470	5418909		Staphylococcus_phage(50.0%)	4	NA	NA
WP_002901272.1|879411_880395_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
WP_002901274.1|880532_881291_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901278.1|881432_882791_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901282.1|882828_883470_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
>prophage 64
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	887344	893358	5418909	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955203.1|887344_888707_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002901387.1|889391_890138_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002901388.1|890363_891407_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901390.1|891411_893358_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 65
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	898660	899293	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|898660_899293_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 66
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	905350	906571	5418909		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|905350_906571_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 67
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	913254	914082	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|913254_914082_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 68
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	920346	926080	5418909		Tupanvirus(50.0%)	5	NA	NA
WP_002901554.1|920346_922605_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
WP_004140343.1|922717_923050_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004151918.1|923109_924501_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002901611.1|924636_925227_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002901621.1|925318_926080_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 69
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	933374	934052	5418909		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|933374_934052_-	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 70
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	946296	949254	5418909		Acinetobacter_phage(100.0%)	2	NA	NA
WP_002901733.1|946296_947655_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_032408681.1|947658_949254_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 71
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	956373	961739	5418909	protease	Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_002901754.1|956373_957135_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
WP_004148112.1|957129_957345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901758.1|957389_958436_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|958483_958735_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|959141_961739_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 72
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	966579	967182	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|966579_967182_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 73
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	972772	974707	5418909		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|972772_974707_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 74
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	979337	981141	5418909		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004140269.1|979337_980147_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|980148_981141_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
>prophage 75
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1011818	1017257	5418909		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004152141.1|1011818_1012688_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218009.1|1012712_1012850_-	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
WP_004152142.1|1012855_1013164_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004176439.1|1013234_1013423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|1013723_1014638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|1014746_1015508_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1015724_1017257_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
>prophage 76
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1025243	1030269	5418909		Cronobacter_phage(50.0%)	2	NA	NA
WP_002902163.1|1025243_1027898_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902166.1|1027890_1030269_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
>prophage 77
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1059195	1060209	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|1059195_1060209_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 78
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1067816	1074963	5418909	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902419.1|1067816_1068560_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
WP_004148192.1|1068839_1069823_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|1070348_1071722_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|1071767_1072703_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_002902424.1|1072936_1073362_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902432.1|1073452_1073665_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902433.1|1073808_1074963_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 79
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1080081	1081071	5418909		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|1080081_1081071_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 80
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1107251	1111889	5418909		Catovirus(50.0%)	2	NA	NA
WP_004198150.1|1107251_1111154_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
WP_004151576.1|1111214_1111889_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 81
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1120575	1121781	5418909		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|1120575_1121781_+	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 82
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1133955	1137483	5418909		Enterobacteria_phage(50.0%)	6	NA	NA
WP_002903231.1|1133955_1134348_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
WP_002903233.1|1134598_1134832_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903234.1|1134828_1136037_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903236.1|1136140_1136494_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002903238.1|1136691_1137210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151566.1|1137279_1137483_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 83
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1150303	1151605	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|1150303_1151605_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 84
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1162848	1163364	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|1162848_1163364_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 85
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1182709	1185487	5418909		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|1182709_1185487_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 86
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1194930	1195890	5418909		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|1194930_1195890_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 87
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1213014	1217029	5418909	transposase	Escherichia_phage(100.0%)	5	NA	NA
WP_004152236.1|1213014_1213623_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
WP_002903710.1|1213664_1214522_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152235.1|1214523_1215141_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_032408694.1|1215151_1215991_-	hypothetical protein	NA	A0A077SK27	Escherichia_phage	49.4	6.9e-61
WP_000019473.1|1216048_1217029_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 88
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1221136	1225273	5418909		uncultured_virus(33.33%)	4	NA	NA
WP_002903722.1|1221136_1221463_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_002903724.1|1221576_1222860_+	MFS transporter	NA	NA	NA	NA	NA
WP_002903726.1|1223113_1224577_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903728.1|1224841_1225273_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
>prophage 89
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1230411	1231086	5418909		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|1230411_1231086_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 90
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1237151	1238132	5418909	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|1237151_1238132_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 91
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1241429	1257324	5418909		Escherichia_phage(70.0%)	15	NA	NA
WP_002210516.1|1241429_1242050_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1242042_1243308_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1243319_1244222_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1244482_1245244_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1245264_1246125_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1246422_1246683_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1246769_1247858_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1247888_1249154_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1249208_1252316_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151614.1|1252512_1253577_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_002904139.1|1253831_1254272_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004205985.1|1254324_1254540_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004198831.1|1254508_1255606_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_002904247.1|1255673_1256072_+	rhodanese	NA	NA	NA	NA	NA
WP_002904248.1|1256220_1257324_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 92
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1261475	1262981	5418909		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_002904321.1|1261475_1262273_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
WP_004151618.1|1262282_1262981_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
>prophage 93
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1266227	1266602	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|1266227_1266602_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 94
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1278550	1279312	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|1278550_1279312_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 95
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1284759	1286133	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_085666577.1|1284759_1286133_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 96
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1299167	1299959	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002904635.1|1299167_1299959_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 97
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1310452	1311832	5418909		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002904785.1|1310452_1311832_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	1.5e-17
>prophage 98
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1337622	1338798	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904836.1|1337622_1338798_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.6e-39
>prophage 99
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1346160	1347717	5418909		Catovirus(100.0%)	1	NA	NA
WP_002904845.1|1346160_1347717_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 100
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1355012	1355786	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|1355012_1355786_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 101
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1369849	1370368	5418909		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002904896.1|1369849_1370368_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 102
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1383780	1384563	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002904975.1|1383780_1384563_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 103
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1395714	1396638	5418909	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_004153456.1|1395714_1396638_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
>prophage 104
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1400302	1401355	5418909		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|1400302_1401355_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 105
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1416956	1417694	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002905293.1|1416956_1417694_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 106
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1424920	1425844	5418909	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_004153456.1|1424920_1425844_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
>prophage 107
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1449955	1451212	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004169988.1|1449955_1451212_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.2e-19
>prophage 108
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1457152	1461269	5418909		Pithovirus(50.0%)	4	NA	NA
WP_002905535.1|1457152_1457881_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.1e-18
WP_004151885.1|1457921_1458617_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002905537.1|1458641_1459577_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002905540.1|1459883_1461269_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 109
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1465404	1467485	5418909		Bacillus_phage(100.0%)	2	NA	NA
WP_004151887.1|1465404_1466748_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	5.2e-10
WP_004176065.1|1466744_1467485_-	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-30
>prophage 110
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1473174	1475460	5418909		Indivirus(100.0%)	1	NA	NA
WP_004151889.1|1473174_1475460_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SD84	Indivirus	26.7	8.5e-13
>prophage 111
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1484006	1484687	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|1484006_1484687_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 112
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1495271	1496812	5418909	transposase	Stx_converting_phage(50.0%)	2	NA	NA
WP_002906035.1|1495271_1495676_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
WP_000019473.1|1495831_1496812_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 113
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1501683	1504020	5418909		Mycobacterium_phage(50.0%)	3	NA	NA
WP_004143717.1|1501683_1501899_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
WP_004143718.1|1502264_1502450_-	general stress protein	NA	NA	NA	NA	NA
WP_020953426.1|1503147_1504020_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 114
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1509869	1514605	5418909		Tupanvirus(66.67%)	4	NA	NA
WP_004170841.1|1509869_1511585_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	3.6e-32
WP_004151239.1|1511621_1512575_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906218.1|1512742_1513342_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_002906221.1|1513594_1514605_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 115
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1518193	1519810	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151237.1|1518193_1519810_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.1e-18
>prophage 116
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1531081	1531855	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151234.1|1531081_1531855_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 117
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1538334	1539834	5418909		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004167624.1|1538334_1539834_-	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	4.6e-31
>prophage 118
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1545941	1547486	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002906546.1|1545941_1547486_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 119
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1552767	1553469	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004151229.1|1552767_1553469_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.2e-31
>prophage 120
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1561905	1562685	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|1561905_1562685_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 121
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1573755	1575846	5418909		Salmonella_phage(100.0%)	1	NA	NA
WP_004220069.1|1573755_1575846_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 122
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1591568	1592582	5418909		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004151215.1|1591568_1592582_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 123
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1599453	1601415	5418909		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|1599453_1601415_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 124
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1611847	1614488	5418909		Moumouvirus(100.0%)	2	NA	NA
WP_002907491.1|1611847_1612936_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
WP_004151211.1|1612982_1614488_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
>prophage 125
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1621311	1623363	5418909		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_004143804.1|1621311_1622430_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	8.1e-33
WP_002907563.1|1622454_1622730_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907640.1|1622835_1623363_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 126
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1628914	1630285	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_004151208.1|1628914_1630285_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.8e-67
>prophage 127
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1641540	1642815	5418909	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|1641540_1642815_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 128
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1646151	1647513	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151205.1|1646151_1647513_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 129
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1651319	1652807	5418909		Salmonella_phage(50.0%)	2	NA	NA
WP_002907759.1|1651319_1651841_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	3.1e-51
WP_002907760.1|1651910_1652807_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
>prophage 130
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1656994	1657867	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|1656994_1657867_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 131
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1661138	1672124	5418909		Enterobacteria_phage(20.0%)	11	NA	NA
WP_002907778.1|1661138_1662164_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
WP_002907780.1|1662090_1663095_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907785.1|1663207_1664389_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907788.1|1664681_1665830_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907792.1|1665866_1666502_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_004151201.1|1666731_1668105_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907794.1|1668280_1668631_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_002907796.1|1668771_1669350_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.1	2.0e-19
WP_077250274.1|1670029_1670257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151197.1|1670253_1670715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002907799.1|1671239_1672124_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
>prophage 132
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1677600	1678371	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|1677600_1678371_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 133
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1683555	1685504	5418909		Bacillus_virus(50.0%)	2	NA	NA
WP_004151192.1|1683555_1684536_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
WP_004151191.1|1684532_1685504_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
>prophage 134
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1699545	1700376	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002908132.1|1699545_1700376_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 135
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1710108	1749559	5418909	integrase,holin,tail,terminase	Salmonella_phage(42.22%)	51	1726603:1726620	1754339:1754356
WP_004152707.1|1710108_1710591_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|1710587_1711217_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|1711206_1711512_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|1711498_1711903_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004152705.1|1712187_1713129_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
WP_004152432.1|1714710_1715007_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|1715321_1716011_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|1716096_1716480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|1716622_1719388_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|1719387_1721298_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|1721297_1724129_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|1724139_1724679_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|1724678_1725143_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|1725142_1727641_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
1726603:1726620	attL	GATACGCAGGGGATGCAG	NA	NA	NA	NA
WP_004152440.1|1727640_1728246_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|1728245_1728569_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|1728619_1728961_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|1728971_1729409_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_032413483.1|1729462_1730449_-	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004152445.1|1730463_1731144_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|1731146_1731443_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|1731439_1733122_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|1733136_1733343_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|1734144_1734456_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|1734522_1735998_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|1735994_1736579_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|1736656_1736914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|1736988_1737327_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|1737326_1737566_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|1737558_1738227_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|1738223_1738436_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|1738606_1739350_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|1739346_1739772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|1739768_1739960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|1739943_1740354_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|1740546_1740894_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|1741013_1741799_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|1741795_1742563_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|1742562_1742772_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|1742918_1743152_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|1743305_1743887_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164029.1|1744253_1744553_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|1744549_1745449_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|1745458_1746481_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|1746532_1746781_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|1746890_1747184_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|1747176_1747335_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|1747331_1747925_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|1747921_1748104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|1748100_1748292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|1748308_1749559_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
1754339:1754356	attR	CTGCATCCCCTGCGTATC	NA	NA	NA	NA
>prophage 136
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1757477	1763122	5418909		Leptospira_phage(50.0%)	3	NA	NA
WP_004151177.1|1757477_1760594_-	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.2	1.2e-54
WP_004151176.1|1760631_1761516_-	membrane protein	NA	NA	NA	NA	NA
WP_004151175.1|1762417_1763122_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
>prophage 137
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1775180	1775804	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151165.1|1775180_1775804_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 138
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1780661	1781732	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002908292.1|1780661_1781732_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 139
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1801243	1802065	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002908416.1|1801243_1802065_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 140
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1805580	1806354	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002908439.1|1805580_1806354_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 141
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1817004	1818968	5418909		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004151836.1|1817004_1818021_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
WP_002908597.1|1818017_1818968_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
>prophage 142
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1826405	1827155	5418909		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004151841.1|1826405_1827155_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 143
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1837075	1840288	5418909		environmental_halophage(50.0%)	3	NA	NA
WP_002908867.1|1837075_1838296_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
WP_002908869.1|1838292_1839567_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908876.1|1839541_1840288_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 144
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1854780	1855542	5418909		Indivirus(100.0%)	1	NA	NA
WP_002909000.1|1854780_1855542_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 145
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1865551	1873520	5418909		Hokovirus(25.0%)	7	NA	NA
WP_002909055.1|1865551_1867930_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
WP_087749625.1|1868269_1869103_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909064.1|1869257_1870304_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909070.1|1870411_1870639_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_002909081.1|1870668_1872111_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.1e-56
WP_002909082.1|1872224_1872689_-	lipoprotein	NA	NA	NA	NA	NA
WP_002909083.1|1872770_1873520_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
>prophage 146
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1880586	1887755	5418909	tRNA	Geobacillus_virus(25.0%)	8	NA	NA
WP_002909098.1|1880586_1880886_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_002909101.1|1880890_1883278_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909105.1|1883293_1884277_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|1884415_1884460_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1884583_1884940_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1884990_1885188_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|1885280_1885823_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_002910026.1|1885826_1887755_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 147
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1897412	1900310	5418909		Lactobacillus_phage(33.33%)	3	NA	NA
WP_002910080.1|1897412_1898240_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
WP_002910083.1|1898295_1899300_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_004151853.1|1899296_1900310_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 148
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1908569	1914839	5418909		Citrobacter_phage(25.0%)	7	NA	NA
WP_002910100.1|1908569_1909187_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
WP_002910103.1|1909748_1910156_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910105.1|1910277_1911180_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910107.1|1911377_1912391_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910108.1|1912480_1913383_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910109.1|1913495_1913954_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004151854.1|1913996_1914839_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 149
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1918852	1920388	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|1918852_1920388_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 150
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1929747	1930536	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|1929747_1930536_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 151
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	1936047	1997223	5418909	plate,tRNA,transposase	Microcystis_virus(12.5%)	61	NA	NA
WP_002910389.1|1936047_1936278_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
WP_002910392.1|1936541_1937642_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910393.1|1937728_1938583_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910395.1|1938622_1939435_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910397.1|1939438_1939831_-	SirB family protein	NA	NA	NA	NA	NA
WP_002910402.1|1939830_1940679_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|1940678_1941761_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_002910404.1|1941803_1943060_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|1943330_1943942_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|1943938_1944790_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|1944973_1945921_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|1946045_1947725_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|1947725_1948772_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|1948994_1949270_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|1949542_1950127_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|1950244_1951336_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|1951418_1951628_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|1951829_1952744_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|1952875_1954291_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|1954310_1954754_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|1954756_1955293_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|1955273_1956320_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|1956319_1958083_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|1958216_1961627_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|1961610_1962768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|1962771_1963038_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|1963335_1963593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141232852.1|1963781_1964018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1964141_1965122_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|1965458_1966349_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|1966524_1967418_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|1967593_1968487_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|1968670_1969564_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|1969585_1969891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|1969914_1971024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|1971129_1971360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|1971405_1971912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|1971908_1972238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|1972234_1972417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|1972558_1973482_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|1975132_1975642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|1975878_1976385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|1976381_1976891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|1976891_1978247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|1981210_1982908_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|1982911_1983565_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|1983561_1984902_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910647.1|1985138_1985384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|1985470_1985800_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|1985869_1986454_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|1986479_1987178_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|1987368_1987851_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1987960_1988860_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152314.1|1988834_1989641_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152313.1|1989655_1990951_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_002910715.1|1991254_1992181_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|1992279_1992756_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910719.1|1992805_1994449_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910720.1|1994732_1995626_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910721.1|1995631_1996351_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910722.1|1996347_1997223_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
>prophage 152
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2001076	2003371	5418909		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004152312.1|2001076_2003371_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
>prophage 153
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2019493	2020105	5418909		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|2019493_2020105_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 154
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2035730	2043099	5418909	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_002910904.1|2035730_2037416_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|2037621_2038203_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004151443.1|2038241_2038937_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004151444.1|2039082_2040993_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	8.5e-91
WP_002910910.1|2041124_2041469_+	RidA family protein	NA	NA	NA	NA	NA
WP_002910911.1|2041469_2041655_-	YoaH family protein	NA	NA	NA	NA	NA
WP_002910913.1|2041743_2043099_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	1.8e-42
>prophage 155
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2047001	2048561	5418909		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|2047001_2048561_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 156
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2056001	2056211	5418909		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2056001_2056211_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 157
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2061447	2063496	5418909		Moraxella_phage(100.0%)	1	NA	NA
WP_002911383.1|2061447_2063496_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	2.3e-86
>prophage 158
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2071003	2077549	5418909	transposase	Escherichia_phage(50.0%)	9	NA	NA
WP_002911396.1|2071003_2071657_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.7e-54
WP_002911397.1|2071777_2072782_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_002911398.1|2072886_2073030_+	Ecr family regulatory small membrane protein	NA	NA	NA	NA	NA
WP_000019473.1|2073189_2074170_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_015874944.1|2074865_2075207_-	YebY family protein	NA	NA	NA	NA	NA
WP_004151447.1|2075220_2076090_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_004151448.1|2076093_2076468_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_002911406.1|2076580_2076811_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|2076889_2077549_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 159
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2084974	2086450	5418909		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|2084974_2086450_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 160
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2090375	2106922	5418909	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_002911444.1|2090375_2091695_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004199391.1|2091710_2092655_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|2092733_2093486_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_002911451.1|2093485_2094271_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004148860.1|2094334_2095345_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|2095353_2095965_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|2096044_2096566_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|2096600_2097341_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|2097368_2097812_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911479.1|2097813_2099601_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_002911481.1|2099868_2100435_+	hydrolase	NA	NA	NA	NA	NA
WP_002911483.1|2100431_2101250_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|2101302_2101698_+	membrane protein	NA	NA	NA	NA	NA
WP_002911486.1|2101737_2102481_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_004151451.1|2102477_2103482_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911488.1|2103563_2104307_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002911491.1|2104383_2104953_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|2105188_2106922_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 161
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2113860	2115375	5418909		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|2113860_2115375_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 162
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2131983	2132736	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|2131983_2132736_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 163
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2139337	2147781	5418909		Burkholderia_phage(40.0%)	8	NA	NA
WP_002911590.1|2139337_2141017_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|2141132_2142044_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004151459.1|2142227_2143139_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911592.1|2143113_2143608_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_004151460.1|2143588_2145022_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_002911594.1|2145065_2145773_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|2145815_2146097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|2146635_2147781_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 164
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2166221	2171000	5418909	integrase	Stenotrophomonas_phage(50.0%)	3	2160331:2160345	2169820:2169834
2160331:2160345	attL	TTTTAATGCCTCTGC	NA	NA	NA	NA
WP_004151470.1|2166221_2167496_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.2	6.1e-69
WP_004151471.1|2167567_2168956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151472.1|2169149_2171000_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.4	9.4e-103
2169820:2169834	attR	GCAGAGGCATTAAAA	NA	NA	NA	NA
>prophage 165
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2184833	2185253	5418909		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000208713.1|2184833_2185253_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 166
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2191869	2192088	5418909		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002911792.1|2191869_2192088_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	2.5e-07
>prophage 167
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2196061	2196898	5418909		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002911800.1|2196061_2196898_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 168
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2212323	2220871	5418909	transposase	Pseudomonas_phage(25.0%)	5	NA	NA
WP_004152765.1|2212323_2213808_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004148990.1|2214328_2215498_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
WP_002912063.1|2215672_2217097_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_085955203.1|2217238_2218601_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002912106.1|2218768_2220871_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
>prophage 169
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2225368	2226268	5418909		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|2225368_2226268_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 170
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2232979	2248042	5418909		Salmonella_phage(14.29%)	12	NA	NA
WP_004198905.1|2232979_2233960_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	34.8	8.9e-44
WP_004198911.1|2233961_2235422_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	43.6	5.5e-106
WP_004198918.1|2235491_2236700_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.0	1.7e-07
WP_004207471.1|2236795_2237926_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004149004.1|2237938_2238832_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004207468.1|2238828_2239983_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
WP_004207467.1|2239998_2241894_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_002912371.1|2241909_2242650_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_002912373.1|2242649_2243417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152476.1|2244460_2245465_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
WP_004144151.1|2245865_2245988_+	small membrane protein	NA	NA	NA	NA	NA
WP_004230397.1|2246464_2248042_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	45.3	4.4e-117
>prophage 171
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2253790	2261415	5418909		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|2253790_2254792_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|2254985_2256152_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|2256332_2256887_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|2256901_2257792_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|2257823_2258693_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|2258719_2259784_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|2260008_2261415_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 172
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2273988	2280862	5418909		Bacillus_phage(25.0%)	5	NA	NA
WP_014599212.1|2273988_2274879_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	5.6e-45
WP_004151147.1|2275644_2277228_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_004151146.1|2277670_2279518_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|2279548_2280130_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|2280220_2280862_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 173
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2297982	2304889	5418909	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|2297982_2299461_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|2299457_2300180_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|2300498_2301860_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|2302105_2302999_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|2303241_2304015_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|2304025_2304889_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 174
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2331908	2338962	5418909	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_002912753.1|2331908_2333942_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|2334056_2334527_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_002912758.1|2334574_2335294_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912760.1|2335287_2336976_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_002912762.1|2337205_2337319_+	protein YohO	NA	NA	NA	NA	NA
WP_004151128.1|2337293_2338031_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004149083.1|2338014_2338962_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 175
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2345496	2346051	5418909		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|2345496_2346051_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 176
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2362075	2363596	5418909		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|2362075_2363596_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 177
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2367360	2371267	5418909		Cellulophaga_phage(50.0%)	3	NA	NA
WP_002912924.1|2367360_2368029_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|2368389_2369223_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002912926.1|2369293_2371267_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 178
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2375666	2376521	5418909		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|2375666_2376521_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 179
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2382229	2390201	5418909		Pseudomonas_phage(33.33%)	8	NA	NA
WP_002912948.1|2382229_2383009_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	1.4e-39
WP_004151121.1|2383447_2383702_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002912951.1|2383849_2384422_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002912952.1|2384492_2385683_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004151120.1|2385890_2387357_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_004151119.1|2387477_2388455_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004180648.1|2388498_2389206_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|2389631_2390201_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 180
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2395956	2402043	5418909		Planktothrix_phage(33.33%)	5	NA	NA
WP_004151118.1|2395956_2397546_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|2397549_2397894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|2398225_2399422_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_087749618.1|2399418_2400138_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002912978.1|2400285_2402043_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 181
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2406279	2407287	5418909		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|2406279_2407287_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 182
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2413652	2414813	5418909		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004151114.1|2413652_2414813_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 183
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2418733	2422131	5418909		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_002913002.1|2418733_2419798_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
WP_002913003.1|2419871_2420924_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_002913005.1|2421027_2422131_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
>prophage 184
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2426270	2438401	5418909		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913009.1|2426270_2429111_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_002913012.1|2429242_2431876_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
WP_002913014.1|2432022_2432751_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002913016.1|2433095_2435381_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_004140835.1|2435482_2436613_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|2436612_2436867_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_002913018.1|2437330_2438401_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 185
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2450567	2451521	5418909	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002913072.1|2450567_2451521_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 186
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2479547	2480147	5418909		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|2479547_2480147_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 187
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2492549	2493323	5418909		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|2492549_2493323_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 188
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2497614	2499132	5418909		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|2497614_2499132_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 189
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2505574	2506711	5418909		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|2505574_2506711_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 190
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2515193	2516279	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002913342.1|2515193_2516279_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 191
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2525394	2529977	5418909		Enterobacteria_phage(25.0%)	5	NA	NA
WP_002913363.1|2525394_2526324_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
WP_002913367.1|2526736_2527219_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_004188919.1|2527586_2528468_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913369.1|2528477_2529386_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_002913370.1|2529518_2529977_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
>prophage 192
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2533247	2535694	5418909		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004149230.1|2533247_2534945_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|2534956_2535694_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 193
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2550184	2560111	5418909		Lactobacillus_phage(25.0%)	9	NA	NA
WP_002913438.1|2550184_2551111_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|2551199_2552198_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|2552194_2552413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913442.1|2552414_2554430_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
WP_085354253.1|2554499_2555558_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002913495.1|2555791_2556553_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|2556729_2557701_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|2558081_2558339_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|2558383_2560111_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 194
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2563719	2565844	5418909		Lactococcus_phage(50.0%)	2	NA	NA
WP_002913621.1|2563719_2564631_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
WP_002913623.1|2564749_2565844_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 195
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2569197	2572774	5418909		Pandoravirus(50.0%)	5	NA	NA
WP_004145614.1|2569197_2570097_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|2570191_2570767_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002913635.1|2570828_2571278_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|2571264_2571690_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|2571901_2572774_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 196
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2604665	2679865	5418909	tail,protease,terminase,holin,capsid,integrase,tRNA,transposase	Salmonella_phage(40.38%)	81	2610307:2610324	2677304:2677321
WP_004152006.1|2604665_2606669_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|2606678_2607554_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|2607673_2608387_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|2608602_2609637_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|2609653_2610532_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
2610307:2610324	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004145648.1|2610619_2611252_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|2611255_2611726_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|2611787_2612849_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|2613071_2614535_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|2614544_2614904_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|2615031_2615943_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|2615939_2616641_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|2616739_2618026_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|2618121_2618748_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|2618965_2620399_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|2620408_2621302_-	beta-glucoside kinase	NA	NA	NA	NA	NA
WP_002913836.1|2621565_2622603_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|2622599_2623241_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|2623421_2625482_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|2625485_2627018_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|2627071_2629300_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913843.1|2629652_2629844_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913846.1|2629940_2630828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|2630925_2632158_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|2632451_2633630_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|2633613_2635482_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|2635701_2636184_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|2636180_2636810_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|2636799_2637105_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|2637091_2637496_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_087749619.1|2637780_2640150_-|tail	phage tail protein	tail	A0A2H5BN49	Klebsiella_phage	79.3	4.5e-267
WP_004152453.1|2640688_2640946_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|2640949_2641147_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152455.1|2641527_2642223_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152456.1|2642413_2642596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|2642600_2642999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|2643273_2643888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152459.1|2643897_2647287_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004243852.1|2647286_2650031_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004152461.1|2650043_2650541_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152462.1|2650533_2651004_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152463.1|2651005_2653483_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004153043.1|2653482_2654094_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152465.1|2654142_2654421_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|2654413_2654806_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152467.1|2654815_2655823_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152468.1|2655835_2656234_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152470.1|2656515_2656821_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152471.1|2656817_2658497_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152472.1|2658500_2658704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152473.1|2659409_2659931_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_020314691.1|2659974_2661450_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152523.1|2661446_2662031_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|2662108_2662366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|2662440_2662779_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|2662778_2663018_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|2663010_2663679_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|2663675_2663888_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|2664058_2664802_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|2664798_2665224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|2665220_2665412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|2665395_2665806_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|2665998_2666346_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|2666465_2667251_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|2667247_2668015_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|2668014_2668224_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|2668370_2668604_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|2668757_2669339_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164029.1|2669705_2670005_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|2670001_2670901_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|2670910_2671933_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|2671984_2672233_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|2672342_2672636_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|2672628_2672787_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|2672783_2673377_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|2673373_2673556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|2673552_2673744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|2673760_2675011_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|2675203_2676781_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|2676848_2678315_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
2677304:2677321	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004151981.1|2678473_2679865_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
>prophage 197
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2690185	2690617	5418909		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|2690185_2690617_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 198
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2701129	2707450	5418909		Mycoplasma_phage(20.0%)	8	NA	NA
WP_002913953.1|2701129_2702416_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|2702486_2702687_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|2702688_2703024_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004151987.1|2703025_2704876_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_002913974.1|2704891_2705407_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|2705481_2705805_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|2705822_2706209_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|2706235_2707450_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 199
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2722697	2744765	5418909	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|2722697_2723951_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914028.1|2724276_2725467_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|2725540_2725879_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|2725944_2727282_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_004188854.1|2727268_2727976_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|2727984_2729406_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004185139.1|2729996_2733884_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914046.1|2734059_2735676_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_002914049.1|2735672_2736215_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|2736244_2736880_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914052.1|2737093_2737942_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914053.1|2737998_2738259_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
WP_004144351.1|2738271_2738652_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002914059.1|2738651_2739383_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_002914062.1|2739394_2740132_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|2740143_2741049_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|2741045_2741726_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|2741975_2742950_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|2742965_2744765_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 200
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2749665	2830274	5418909	head,lysis,tail,terminase,portal,tRNA,plate,capsid,integrase,coat,transposase	Salmonella_phage(70.0%)	87	2794369:2794415	2832136:2832182
WP_002914079.1|2749665_2750403_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|2750534_2751866_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|2751911_2752295_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|2752608_2753298_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|2753355_2754441_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|2754644_2755070_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|2755139_2755838_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|2755872_2758533_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|2758653_2760009_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|2760050_2760374_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|2760377_2761676_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|2767641_2770215_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|2770344_2771076_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|2771072_2772053_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|2772184_2772922_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|2773192_2773528_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|2773634_2773682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|2773782_2774943_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|2774939_2775812_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|2775874_2776996_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|2777005_2778076_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|2778418_2778928_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|2778920_2780144_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|2780157_2780640_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|2780648_2782019_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|2782075_2782534_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|2782653_2783001_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|2783040_2783808_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|2783839_2784388_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|2784406_2784655_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|2784914_2786279_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|2786442_2787234_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|2787253_2788540_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|2788659_2789250_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|2789374_2790253_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|2790339_2792001_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|2792148_2792490_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|2792556_2792847_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|2792836_2793313_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|2793423_2793906_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2794369:2794415	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|2794509_2794887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|2794914_2795133_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|2795199_2796294_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|2796290_2796776_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|2796772_2799403_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|2799395_2799515_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|2799529_2799829_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|2799881_2800397_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|2800406_2801579_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|2801727_2802801_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|2802852_2803971_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|2803980_2805930_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|2805931_2806603_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|2806595_2807504_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|2807490_2807853_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|2807849_2808422_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|2808516_2809383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|2809405_2809852_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|2809844_2810267_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|2810362_2810791_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|2810787_2811171_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|2811175_2811685_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|2811665_2811881_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|2811884_2812088_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|2812087_2812552_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|2812647_2813301_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|2813304_2814357_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|2814373_2815207_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|2815347_2817111_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|2817110_2818154_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|2818210_2818480_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|2819001_2820003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|2820002_2821082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|2821068_2821752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|2821847_2822081_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|2822092_2822281_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|2822443_2824828_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|2824824_2825676_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|2825672_2825900_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|2825899_2826133_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|2826200_2826539_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|2826502_2826703_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|2826710_2827220_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|2827252_2827495_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|2827617_2828247_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_062955148.1|2828249_2829248_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_000019473.1|2829293_2830274_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
2832136:2832182	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 201
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2845840	2847361	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|2845840_2847361_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 202
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2869519	2870422	5418909		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|2869519_2870422_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 203
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2875603	2880902	5418909		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|2875603_2875849_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|2875845_2876256_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914325.1|2876228_2878370_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|2878380_2879343_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914328.1|2879699_2880902_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 204
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2895620	2903825	5418909	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|2895620_2895806_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914765.1|2896169_2898797_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_002914767.1|2899047_2899548_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|2899615_2900674_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_002914771.1|2900764_2901262_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914773.1|2901401_2902280_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914775.1|2902287_2903151_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004151040.1|2903147_2903825_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.3e-06
>prophage 205
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2909610	2910576	5418909		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|2909610_2910576_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 206
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2937517	2938918	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|2937517_2938918_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 207
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2949283	2950105	5418909		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|2949283_2950105_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 208
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2961849	2967013	5418909		Cedratvirus(50.0%)	5	NA	NA
WP_004151058.1|2961849_2962629_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_002915094.1|2962907_2963390_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004188736.1|2963401_2963851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915096.1|2963835_2964183_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004151059.1|2964451_2967013_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 209
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2970482	2976901	5418909		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_087749621.1|2970482_2971370_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	1.5e-05
WP_004151062.1|2971478_2972681_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915104.1|2972677_2973055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915106.1|2973107_2974100_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915107.1|2974257_2975394_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915108.1|2975519_2976146_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915109.1|2976139_2976901_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 210
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2979971	2982004	5418909		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|2979971_2980577_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_002915159.1|2980576_2982004_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 211
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2990770	2996107	5418909		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|2990770_2991442_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_002915212.1|2991916_2993026_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002915213.1|2993089_2994388_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915214.1|2994469_2996107_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 212
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	2999649	3005115	5418909		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_002915220.1|2999649_3000954_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
WP_004151066.1|3001067_3003818_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|3003975_3005115_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 213
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3012529	3013375	5418909		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|3012529_3013375_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 214
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3023630	3024653	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|3023630_3024653_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 215
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3031057	3031813	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|3031057_3031813_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 216
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3043357	3045858	5418909	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_002915551.1|3043357_3044563_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
WP_004151086.1|3044562_3044994_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|3045036_3045858_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 217
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3050803	3051628	5418909		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|3050803_3051628_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 218
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3084279	3095959	5418909		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_002915870.1|3084279_3085533_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|3085760_3087092_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|3087321_3087642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188670.1|3087699_3089544_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_004151968.1|3089540_3093077_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_002915886.1|3093073_3095959_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 219
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3101472	3113390	5418909		Cronobacter_phage(25.0%)	10	NA	NA
WP_002915933.1|3101472_3102267_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
WP_002915934.1|3102273_3103149_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915935.1|3103394_3105641_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|3105653_3106184_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004143967.1|3106866_3107562_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|3107625_3108339_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|3108462_3108681_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915975.1|3108901_3109942_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915976.1|3110044_3111238_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|3111230_3113390_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 220
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3119368	3120379	5418909		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|3119368_3120379_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 221
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3126093	3127221	5418909		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|3126093_3127221_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 222
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3132984	3136455	5418909		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|3132984_3133980_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|3133976_3135398_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|3135693_3136455_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 223
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3158424	3160104	5418909	integrase	Escherichia_phage(100.0%)	2	3156290:3156304	3166079:3166093
3156290:3156304	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
WP_004151951.1|3158424_3159030_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
WP_002916189.1|3159495_3160104_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
3166079:3166093	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 224
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3174578	3178710	5418909		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916277.1|3174578_3176132_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_002916278.1|3176604_3177027_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916279.1|3177036_3178329_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916281.1|3178380_3178710_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 225
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3181788	3182808	5418909		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|3181788_3182808_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 226
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3186776	3194678	5418909	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|3186776_3187490_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_002916298.1|3187806_3188361_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002916299.1|3188595_3190113_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_095858446.1|3190122_3191221_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004151783.1|3191306_3193040_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_002916301.1|3193045_3193759_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|3193781_3194678_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 227
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3199374	3200808	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|3199374_3200808_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 228
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3205383	3208257	5418909		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|3205383_3208257_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 229
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3216200	3217433	5418909		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|3216200_3217433_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 230
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3234686	3235481	5418909		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|3234686_3235481_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 231
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3249236	3250391	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|3249236_3250391_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 232
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3265265	3266348	5418909		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|3265265_3266348_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 233
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3273894	3274875	5418909		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|3273894_3274875_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 234
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3281574	3283110	5418909		Vibrio_phage(100.0%)	4	NA	NA
WP_004152614.1|3281574_3281835_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
WP_004152613.1|3281975_3282431_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004155677.1|3282509_3282755_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152612.1|3282858_3283110_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
>prophage 235
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3293504	3294872	5418909		Morganella_phage(100.0%)	1	NA	NA
WP_004150873.1|3293504_3294872_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 236
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3316426	3317182	5418909		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|3316426_3317182_-	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 237
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3323462	3324830	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|3323462_3324830_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 238
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3329719	3331090	5418909		Lactococcus_phage(100.0%)	1	NA	NA
WP_004150913.1|3329719_3331090_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 239
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3350799	3360702	5418909		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002916796.1|3350799_3351627_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004150920.1|3351662_3352190_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916798.1|3352247_3354431_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|3354554_3355967_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|3356050_3356788_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_002916828.1|3356979_3359238_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916831.1|3359359_3360229_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|3360306_3360702_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 240
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3364013	3365909	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|3364013_3365909_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 241
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3370251	3377132	5418909		Erwinia_phage(25.0%)	8	NA	NA
WP_002916849.1|3370251_3370923_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_002916850.1|3370928_3372089_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916851.1|3372133_3372925_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|3373111_3373882_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916855.1|3373943_3374597_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916856.1|3374974_3375247_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|3375282_3375480_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916858.1|3375698_3377132_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 242
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3382243	3383485	5418909	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|3382243_3383485_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 243
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3392778	3407138	5418909	tRNA	Moraxella_phage(20.0%)	13	NA	NA
WP_002916879.1|3392778_3393792_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3394029_3394245_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|3394356_3396102_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|3396320_3398162_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|3398261_3398768_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_002917638.1|3399503_3399776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071531177.1|3399844_3400159_-	HdeB family protein	NA	NA	NA	NA	NA
WP_002917647.1|3400511_3401126_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004150925.1|3401130_3404373_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_004150926.1|3404463_3405105_-	YfdX family protein	NA	NA	NA	NA	NA
WP_002917651.1|3405375_3405951_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_002917655.1|3405977_3406283_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917658.1|3406334_3407138_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 244
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3425216	3426596	5418909		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|3425216_3426596_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 245
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3430867	3432355	5418909		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|3430867_3432355_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 246
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3441918	3442890	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|3441918_3442890_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 247
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3459913	3461059	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|3459913_3461059_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 248
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3477165	3486863	5418909		Escherichia_phage(20.0%)	12	NA	NA
WP_002918124.1|3477165_3477939_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
WP_004160302.1|3477973_3478975_-	Fic family protein	NA	NA	NA	NA	NA
WP_004144878.1|3478978_3479842_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_004160309.1|3479905_3482023_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|3481980_3482367_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|3482392_3482983_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|3482992_3483568_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918216.1|3483689_3484730_-	permease	NA	NA	NA	NA	NA
WP_002918218.1|3484805_3485453_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918221.1|3485581_3486118_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|3486079_3486523_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004152864.1|3486578_3486863_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 249
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3492556	3494488	5418909		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|3492556_3494488_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 250
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3499902	3506521	5418909		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_002918250.1|3499902_3502593_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
WP_002918252.1|3502617_3504105_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918364.1|3504132_3504585_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004144895.1|3505177_3506521_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 251
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3510785	3513662	5418909	protease	Pandoravirus(50.0%)	2	NA	NA
WP_002918371.1|3510785_3511634_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|3511727_3513662_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 252
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3520260	3521702	5418909		Indivirus(50.0%)	2	NA	NA
WP_002918380.1|3520260_3521232_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|3521429_3521702_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 253
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3525751	3538682	5418909		Bacillus_virus(16.67%)	15	NA	NA
WP_004150950.1|3525751_3526564_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
WP_002918397.1|3526773_3527751_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|3527765_3528752_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|3528766_3529333_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|3529329_3529905_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|3529873_3530419_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|3530425_3531151_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|3531198_3532632_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|3532654_3532942_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918425.1|3533012_3533501_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|3533546_3534401_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|3534397_3534670_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918435.1|3534733_3535459_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918442.1|3535455_3536109_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|3536342_3538682_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 254
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3542626	3543559	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|3542626_3543559_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 255
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3551004	3602584	5418909	head,tail,protease,terminase,portal,capsid,integrase,tRNA	uncultured_Caudovirales_phage(68.75%)	57	3586763:3586780	3602758:3602775
WP_002918465.1|3551004_3551499_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|3551502_3552141_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3552452_3552845_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|3552860_3553289_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|3553554_3554682_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|3554872_3555271_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|3555444_3556812_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|3556899_3557958_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|3558094_3559033_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|3559447_3559918_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|3560293_3560557_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|3560655_3560922_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|3560972_3561248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|3561327_3563295_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|3563300_3564233_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|3564240_3564444_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|3564575_3565505_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|3565540_3566986_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|3567074_3570872_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|3570909_3572379_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|3572381_3572963_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|3572970_3573459_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|3573458_3574451_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|3574521_3575565_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|3575870_3577811_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|3577890_3578082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|3578310_3579312_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|3579311_3579920_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|3580143_3580596_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|3580618_3581086_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|3581096_3582446_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|3582556_3582799_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|3582788_3584240_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|3584251_3585133_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|3585490_3586456_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3586480_3586777_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
3586763:3586780	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_004150954.1|3586930_3587122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|3587124_3588786_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|3588769_3589126_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|3589401_3589845_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|3589844_3590144_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|3590140_3590476_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|3590472_3591714_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|3591715_3592276_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|3592327_3593494_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|3593757_3594270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|3594318_3594654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3594996_3597132_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|3597131_3597497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3597493_3597862_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|3597858_3598173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|3598165_3598354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|3598346_3598616_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|3599067_3599847_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_001547839.1|3599857_3600142_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150970.1|3600323_3601265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150971.1|3601357_3602584_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
3602758:3602775	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
>prophage 256
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3618910	3620382	5418909	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_002919144.1|3618910_3619420_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919147.1|3619434_3620382_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 257
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3640285	3643654	5418909		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|3640285_3641470_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|3641539_3643654_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 258
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3651499	3661143	5418909		Tupanvirus(25.0%)	9	NA	NA
WP_002920148.1|3651499_3653404_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
WP_002920149.1|3653607_3654630_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|3654626_3654845_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|3654881_3655751_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|3655805_3656210_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|3656516_3657149_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004151402.1|3657200_3659279_+	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_002920226.1|3659268_3660489_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002920229.1|3660579_3661143_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 259
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3672544	3673372	5418909		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|3672544_3673372_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 260
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3688195	3691967	5418909		Bacillus_phage(66.67%)	3	NA	NA
WP_002920331.1|3688195_3689818_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
WP_002920333.1|3689895_3691251_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_001157751.1|3691247_3691967_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 261
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3704793	3707184	5418909		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|3704793_3707184_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 262
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3710529	3711288	5418909		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|3710529_3711288_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 263
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3715145	3717593	5418909		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|3715145_3717593_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 264
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3735338	3737146	5418909		Enterococcus_phage(50.0%)	2	NA	NA
WP_002920785.1|3735338_3736079_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_002920787.1|3736075_3737146_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 265
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3740572	3742805	5418909		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920800.1|3740572_3740941_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_002920802.1|3740937_3741159_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|3741322_3742036_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920803.1|3742037_3742805_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 266
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3750126	3755927	5418909		Klosneuvirus(25.0%)	5	NA	NA
WP_002920814.1|3750126_3751392_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
WP_004200671.1|3751510_3753034_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|3753086_3753941_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_032408817.1|3754210_3755266_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|3755258_3755927_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 267
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3759011	3763148	5418909		Dickeya_phage(50.0%)	4	NA	NA
WP_002920827.1|3759011_3759638_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004151416.1|3759716_3761927_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920858.1|3762030_3762276_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|3762482_3763148_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 268
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3769448	3773555	5418909		Tupanvirus(66.67%)	3	NA	NA
WP_002921032.1|3769448_3771434_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
WP_002921035.1|3771430_3772414_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|3772415_3773555_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 269
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3779657	3780449	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|3779657_3780449_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 270
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3788990	3791033	5418909		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|3788990_3791033_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 271
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3834762	3840735	5418909		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002921733.1|3834762_3836874_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_002921735.1|3836893_3837685_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_004151436.1|3837686_3838226_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921784.1|3838741_3839755_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|3839751_3840735_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 272
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3845058	3846422	5418909	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3845058_3846422_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 273
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3853241	3855981	5418909		Streptococcus_phage(50.0%)	2	NA	NA
WP_002921915.1|3853241_3853682_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
WP_004152428.1|3853650_3855981_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 274
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3861140	3862112	5418909		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|3861140_3862112_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 275
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3865515	3867446	5418909		Morganella_phage(50.0%)	2	NA	NA
WP_000014594.1|3865515_3865728_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_004152429.1|3865826_3867446_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
>prophage 276
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3871822	3872818	5418909		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|3871822_3872818_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 277
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3878286	3879828	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|3878286_3879828_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 278
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3887801	3889643	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|3887801_3889643_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 279
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3905480	3914630	5418909		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|3905480_3905732_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|3905836_3906268_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004152046.1|3906513_3908058_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|3908067_3909339_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_002922459.1|3909342_3910290_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922460.1|3910295_3911084_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922461.1|3911252_3912278_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922462.1|3912290_3913484_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922463.1|3913697_3914630_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 280
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3927398	3932140	5418909		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|3927398_3927878_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_002922508.1|3928065_3928875_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922510.1|3929010_3929178_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3929198_3929435_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|3929651_3930317_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002922591.1|3930489_3931704_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_002922593.1|3931684_3932140_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 281
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3935599	3936517	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152982.1|3935599_3936517_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 282
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3941559	3949849	5418909		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_004151500.1|3941559_3942618_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
WP_004151501.1|3942673_3943924_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|3944198_3944816_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002922662.1|3944821_3946498_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922664.1|3946756_3947380_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|3947434_3947710_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004151503.1|3947728_3949849_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 283
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3960830	3961682	5418909		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|3960830_3961682_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 284
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3964816	3966208	5418909		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|3964816_3966208_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 285
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3979467	3980517	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|3979467_3980517_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 286
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	3997777	3998941	5418909		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|3997777_3998941_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 287
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4017376	4018489	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|4017376_4018489_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 288
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4030666	4036105	5418909		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004198592.1|4030666_4032355_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
WP_002923286.1|4032459_4032555_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_002923292.1|4033217_4033307_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923294.1|4033397_4033844_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923296.1|4033911_4034745_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002923297.1|4034920_4036105_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
>prophage 289
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4047114	4049034	5418909		Morganella_phage(33.33%)	3	NA	NA
WP_004151522.1|4047114_4047939_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
WP_004145074.1|4048075_4048504_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|4048620_4049034_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 290
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4052469	4053618	5418909		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|4052469_4053618_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 291
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4059385	4066915	5418909		Bacillus_virus(33.33%)	7	NA	NA
WP_004151531.1|4059385_4061800_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	1.1e-114
WP_004151532.1|4061828_4062902_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004151533.1|4063048_4064149_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151534.1|4064153_4065557_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|4066178_4066319_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|4066334_4066694_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|4066657_4066915_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 292
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4074407	4075745	5418909		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|4074407_4075745_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 293
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4081521	4089081	5418909		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|4081521_4082295_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|4082342_4083233_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|4083232_4084192_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|4084320_4085361_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004151549.1|4085697_4087527_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004151550.1|4087710_4089081_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 294
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4101431	4102424	5418909		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|4101431_4102424_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 295
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4105589	4111468	5418909		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|4105589_4107458_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_002882527.1|4107643_4108063_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882529.1|4108073_4109579_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882531.1|4109584_4110550_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|4110577_4111468_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 296
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4125762	4128555	5418909		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|4125762_4128555_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 297
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4132443	4134911	5418909		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|4132443_4133853_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|4133861_4134911_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 298
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4141733	4142651	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|4141733_4142651_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 299
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4165622	4167134	5418909		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004151860.1|4165622_4167134_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 300
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4175472	4178975	5418909		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_002882894.1|4175472_4176093_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_002882896.1|4176165_4176840_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|4176906_4178280_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|4178276_4178975_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 301
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4183477	4184812	5418909		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|4183477_4184812_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 302
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4195876	4197433	5418909		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|4195876_4197433_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 303
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4202204	4202867	5418909		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|4202204_4202867_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 304
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4217497	4219336	5418909		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|4217497_4219336_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 305
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4229398	4231045	5418909		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|4229398_4231045_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 306
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4239148	4248798	5418909	transposase	Bacillus_phage(25.0%)	8	NA	NA
WP_004152491.1|4239148_4241170_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
WP_002883185.1|4241174_4241897_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_032408920.1|4241959_4242955_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000019473.1|4243008_4243989_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002883211.1|4244288_4245215_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002883220.1|4245234_4246734_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002883222.1|4246861_4248127_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|4248468_4248798_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 307
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4252848	4258990	5418909		Catovirus(20.0%)	6	NA	NA
WP_002883297.1|4252848_4253979_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_002883302.1|4253975_4255238_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|4255234_4256302_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883307.1|4256320_4257202_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_004146507.1|4257179_4257854_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883310.1|4257859_4258990_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 308
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4275357	4279202	5418909		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002883396.1|4275357_4276260_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_002883397.1|4276259_4276976_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|4277039_4279202_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 309
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4283037	4286499	5418909	transposase	Catovirus(50.0%)	3	NA	NA
WP_004152055.1|4283037_4284864_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_004152056.1|4284925_4285546_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_002883410.1|4285590_4286499_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 310
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4298500	4301844	5418909		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_002883424.1|4298500_4300141_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|4300270_4300522_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883426.1|4300525_4301062_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|4301064_4301844_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 311
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4310562	4311177	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|4310562_4311177_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 312
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4321113	4324234	5418909		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|4321113_4322064_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|4323049_4324234_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 313
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4328461	4340905	5418909		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_004152306.1|4328461_4332490_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|4332566_4336790_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_002884148.1|4337190_4338531_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884149.1|4338573_4338891_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|4338894_4339200_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004171439.1|4339372_4340905_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 314
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4349330	4351094	5418909		Klosneuvirus(50.0%)	3	NA	NA
WP_004152311.1|4349330_4350002_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
WP_002884331.1|4350044_4350635_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|4350821_4351094_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 315
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4356515	4358105	5418909		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|4356515_4358105_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 316
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4371648	4375332	5418909		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|4371648_4375332_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 317
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4381900	4382704	5418909		Moumouvirus(100.0%)	1	NA	NA
WP_002884614.1|4381900_4382704_-	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 318
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4399213	4400323	5418909		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|4399213_4400323_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 319
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4407389	4407998	5418909		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|4407389_4407998_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 320
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4413993	4416520	5418909		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|4413993_4415409_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884943.1|4415440_4416520_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 321
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4419701	4425008	5418909		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004146620.1|4419701_4422527_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|4422778_4423303_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_002885017.1|4423427_4425008_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 322
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4436987	4438019	5418909		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004177837.1|4436987_4438019_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 323
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4445548	4446898	5418909		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|4445548_4446898_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 324
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4459181	4465966	5418909		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002885145.1|4459181_4461140_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
WP_004226113.1|4461240_4461441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146659.1|4461552_4462866_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004151733.1|4462902_4463589_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598858.1|4463818_4465966_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 325
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4471907	4473428	5418909		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|4471907_4473428_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 326
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4478808	4480355	5418909		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|4478808_4479489_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_002885198.1|4479596_4480355_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 327
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4485715	4487218	5418909		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|4485715_4487218_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 328
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4491582	4496669	5418909	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_004146678.1|4491582_4492539_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
WP_004151723.1|4492548_4492920_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_085955125.1|4493085_4494449_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002885324.1|4494617_4494923_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_002885338.1|4494922_4495840_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_004199298.1|4495985_4496669_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 329
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4505891	4507254	5418909	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|4505891_4507254_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 330
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4518168	4523814	5418909		Cronobacter_phage(33.33%)	5	NA	NA
WP_004152420.1|4518168_4518462_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
WP_002885441.1|4518499_4520146_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152419.1|4520406_4520760_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885443.1|4520814_4521678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885444.1|4521690_4523814_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
>prophage 331
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4531098	4532079	5418909	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|4531098_4532079_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 332
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4536193	4541387	5418909		Morganella_phage(33.33%)	6	NA	NA
WP_002885523.1|4536193_4536727_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|4536840_4537200_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885530.1|4537210_4537606_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885531.1|4537616_4538351_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004152023.1|4538343_4540134_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004146714.1|4540409_4541387_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 333
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4548741	4549287	5418909		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|4548741_4549287_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 334
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4554129	4557355	5418909		Vibrio_phage(50.0%)	2	NA	NA
WP_004152021.1|4554129_4555485_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
WP_004152020.1|4555495_4557355_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 335
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4563285	4567629	5418909		Pithovirus(50.0%)	3	NA	NA
WP_002885665.1|4563285_4564584_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|4564734_4565160_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885668.1|4565196_4567629_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
>prophage 336
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4587226	4588051	5418909		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|4587226_4588051_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 337
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4604550	4611129	5418909		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|4604550_4605081_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|4605484_4606441_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886772.1|4606564_4608067_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_004152011.1|4608077_4609103_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886825.1|4609089_4610088_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|4610130_4611129_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 338
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4627262	4630394	5418909		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_002886902.1|4627262_4627547_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
WP_002886903.1|4627550_4628015_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886904.1|4628255_4630394_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 339
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4638151	4644209	5418909		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002886919.1|4638151_4639099_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
WP_004152273.1|4639478_4642187_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_002886926.1|4642259_4642646_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|4642798_4643260_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|4643273_4644209_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 340
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4654302	4663352	5418909	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_002886952.1|4654302_4657158_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
WP_002886953.1|4657157_4657601_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|4657720_4659232_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|4659621_4660719_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|4660718_4661801_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886957.1|4661849_4663352_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 341
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4679243	4684069	5418909		Bacillus_virus(50.0%)	5	NA	NA
WP_002886975.1|4679243_4680317_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
WP_002886979.1|4680322_4681147_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886980.1|4681157_4682045_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002886983.1|4682034_4682907_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002886990.1|4683049_4684069_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	8.4e-45
>prophage 342
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4687151	4688414	5418909	integrase	Stenotrophomonas_phage(100.0%)	1	4685973:4685986	4693080:4693093
4685973:4685986	attL	ATTCCTGCGCCAGC	NA	NA	NA	NA
WP_004152198.1|4687151_4688414_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
WP_004152198.1|4687151_4688414_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
4693080:4693093	attR	ATTCCTGCGCCAGC	NA	NA	NA	NA
>prophage 343
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4691789	4697614	5418909		Enterobacteria_phage(100.0%)	7	NA	NA
WP_004152202.1|4691789_4692356_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4692373_4692619_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|4692615_4693353_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004153681.1|4694176_4694725_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|4694721_4694949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|4694945_4695266_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|4695280_4697614_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 344
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4718424	4723382	5418909		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002887258.1|4718424_4719153_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|4719269_4719803_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887261.1|4719812_4720160_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887262.1|4720232_4723382_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
>prophage 345
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4726620	4728727	5418909		Bacillus_phage(50.0%)	2	NA	NA
WP_002887273.1|4726620_4727304_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_002887275.1|4727293_4728727_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
>prophage 346
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4738483	4741228	5418909		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|4738483_4741228_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 347
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4745144	4746629	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|4745144_4746629_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 348
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4762216	4763143	5418909	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|4762216_4763143_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 349
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4795244	4796267	5418909		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|4795244_4796267_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 350
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4803271	4806439	5418909	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_002887612.1|4803271_4804333_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
WP_085955148.1|4804329_4805361_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002887616.1|4805500_4806439_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 351
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4809599	4810879	5418909		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|4809599_4810337_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|4810339_4810879_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 352
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4824102	4826823	5418909		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|4824102_4825692_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|4825911_4826532_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|4826661_4826823_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 353
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4831558	4832881	5418909		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|4831558_4832881_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 354
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4839212	4844372	5418909		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|4839212_4840445_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|4840538_4842206_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887806.1|4842434_4844372_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 355
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4861529	4862483	5418909		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|4861529_4862483_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 356
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4866854	4876807	5418909	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|4866854_4868771_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|4868858_4869992_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_002887958.1|4870169_4871345_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887961.1|4871399_4872296_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|4872415_4872679_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|4873008_4873947_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887972.1|4873990_4876807_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
>prophage 357
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4895604	4896753	5418909		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|4895604_4896753_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 358
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4903094	4904678	5418909		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|4903094_4903574_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_002888321.1|4903829_4904678_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 359
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4917136	4922588	5418909		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004151368.1|4917136_4920043_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_002888349.1|4920230_4922588_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
>prophage 360
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4928884	4929586	5418909		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|4928884_4929586_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 361
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4938285	4939041	5418909		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|4938285_4939041_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 362
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4950440	4952165	5418909		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|4950440_4952165_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 363
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4978357	4979401	5418909		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|4978357_4979401_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 364
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4983668	4984232	5418909		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|4983668_4984232_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 365
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	4995572	4996997	5418909		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|4995572_4996997_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 366
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5006646	5016524	5418909	transposase	Shigella_phage(25.0%)	9	NA	NA
WP_085955245.1|5006646_5007839_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004151949.1|5007887_5008730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888804.1|5008726_5009137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888808.1|5009384_5009732_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888811.1|5009877_5011476_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888816.1|5011559_5013950_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888819.1|5014154_5014691_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|5014750_5015413_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|5015597_5016524_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 367
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5021928	5028699	5418909	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|5021928_5023323_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_004145903.1|5023385_5024267_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|5024326_5024782_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|5024944_5025661_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004145901.1|5025660_5026197_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004151944.1|5026269_5028699_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 368
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5050834	5051632	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|5050834_5051632_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 369
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5057598	5057943	5418909		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|5057598_5057943_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 370
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5061898	5063332	5418909	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|5061898_5063332_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 371
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5074910	5075669	5418909		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|5074910_5075669_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 372
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5084500	5088600	5418909		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002889376.1|5084500_5085100_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_002889378.1|5085117_5088600_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
>prophage 373
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5101584	5102616	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|5101584_5102616_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 374
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5109128	5109932	5418909		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|5109128_5109932_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 375
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5113997	5118207	5418909		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|5113997_5115365_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004152035.1|5115436_5116192_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889685.1|5116224_5116947_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|5116943_5117411_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004152034.1|5117475_5118207_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 376
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5123715	5124297	5418909		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|5123715_5124297_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 377
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5141546	5142830	5418909		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|5141546_5142830_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 378
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5150363	5151359	5418909		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|5150363_5151359_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 379
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5156006	5157404	5418909		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|5156006_5157404_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 380
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5165860	5178856	5418909	integrase	Enterobacteria_phage(72.73%)	14	5153994:5154008	5177051:5177065
5153994:5154008	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|5165860_5168194_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|5168205_5168526_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|5168522_5168750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|5168746_5169304_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|5169300_5169567_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|5170108_5170846_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|5170842_5171088_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|5171105_5171672_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|5172240_5172666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|5172665_5173616_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|5173603_5174794_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|5175146_5176400_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|5176410_5177514_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
5177051:5177065	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_004144576.1|5177803_5178856_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 381
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5185700	5186543	5418909		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|5185700_5186543_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 382
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5195616	5199337	5418909		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151355.1|5195616_5196435_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
WP_002890106.1|5196436_5197246_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002890108.1|5197579_5197750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002890126.1|5197866_5198562_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_004151354.1|5198554_5199337_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 383
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5210340	5211108	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|5210340_5211108_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 384
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5231591	5240111	5418909		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|5231591_5232503_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_002890286.1|5232594_5233509_+	fructokinase	NA	NA	NA	NA	NA
WP_004151346.1|5233582_5236720_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890342.1|5236716_5237922_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|5238104_5238794_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|5238815_5240111_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 385
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5256916	5261255	5418909	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|5256916_5258044_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|5258066_5258399_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|5258425_5260273_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|5260283_5261255_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 386
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5264853	5269513	5418909		Indivirus(33.33%)	6	NA	NA
WP_002890420.1|5264853_5265957_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
WP_001021161.1|5266044_5266515_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|5266534_5266954_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002891357.1|5267025_5267997_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004191729.1|5267989_5268493_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891359.1|5268538_5269513_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
>prophage 387
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5282298	5283996	5418909		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|5282298_5283996_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 388
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5298302	5303471	5418909	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|5298302_5298926_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|5299176_5300451_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|5300634_5302989_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|5303198_5303471_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 389
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5306701	5307403	5418909		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|5306701_5307403_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 390
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5311830	5315374	5418909		Bacillus_phage(100.0%)	2	NA	NA
WP_002891876.1|5311830_5313603_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
WP_002891880.1|5313595_5315374_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 391
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5326297	5327407	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_002891989.1|5326297_5327407_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 392
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5336581	5345972	5418909		Enterobacteria_phage(33.33%)	10	NA	NA
WP_002892007.1|5336581_5337652_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|5337767_5338031_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|5338030_5338171_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|5338167_5338866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892023.1|5338966_5340418_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|5340392_5340863_-	membrane protein	NA	NA	NA	NA	NA
WP_002892030.1|5340995_5341562_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|5341720_5341939_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|5341965_5342340_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892069.1|5342825_5345972_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 393
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5351493	5359304	5418909	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_002892131.1|5351493_5352393_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
WP_002892136.1|5352460_5352634_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892142.1|5352646_5353174_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892144.1|5353243_5353621_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892145.1|5353771_5354323_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_004151328.1|5354415_5356323_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892173.1|5356380_5356713_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002892177.1|5356712_5357318_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892181.1|5357429_5359304_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
>prophage 394
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5369449	5374655	5418909		uncultured_virus(50.0%)	5	NA	NA
WP_004151326.1|5369449_5371951_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
WP_002892208.1|5372057_5372468_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004151325.1|5372464_5372923_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|5372919_5373837_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002892260.1|5373977_5374655_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
>prophage 395
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5377837	5378524	5418909		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|5377837_5378524_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 396
NZ_CP021718	Klebsiella pneumoniae strain AR_0129, complete genome	5418909	5387069	5418626	5418909	integrase,lysis,tRNA,head	Escherichia_phage(30.0%)	48	5378570:5378584	5412577:5412591
5378570:5378584	attL	TCGTCTGGCTGGCGT	NA	NA	NA	NA
WP_004143010.1|5387069_5388455_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|5388500_5388713_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|5388714_5389581_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151318.1|5390011_5391175_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|5391051_5391387_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|5391388_5391604_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|5391605_5391824_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|5391820_5392588_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|5392584_5393241_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|5393237_5393396_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|5393392_5394073_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|5394069_5394915_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|5394930_5395215_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|5395303_5395498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|5395597_5395813_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|5396163_5396853_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|5396980_5397214_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|5397254_5397476_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|5397700_5398600_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|5398589_5400020_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|5400019_5400313_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|5400309_5400816_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|5400922_5401765_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|5401937_5402585_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|5403085_5403541_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|5403540_5403711_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|5403703_5404339_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|5404335_5404473_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|5404465_5404996_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|5404992_5405682_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|5406591_5406840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|5406842_5407373_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|5407369_5407834_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|5407939_5408269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|5408639_5409242_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|5409241_5410714_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|5410726_5412148_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|5412122_5413127_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
5412577:5412591	attR	ACGCCAGCCAGACGA	NA	NA	NA	NA
WP_004151273.1|5413168_5413645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|5413717_5415103_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|5415106_5415535_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|5415546_5416641_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|5416651_5416891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|5416893_5417274_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|5417273_5417447_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|5417446_5417809_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|5417811_5418237_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|5418233_5418626_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
>prophage 1
NZ_CP021713	Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence	208224	96065	158855	208224	protease,integrase,transposase	uncultured_Caudovirales_phage(27.78%)	59	87808:87822	107835:107849
87808:87822	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|96065_96806_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|97949_98897_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|98923_99235_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|99299_100223_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|100895_101153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|101754_103209_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|104191_105469_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|105531_107529_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|108568_109776_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
107835:107849	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|111204_111636_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|111886_113362_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|113354_114035_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|114224_115610_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|115638_115992_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|116105_117398_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|117408_120555_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|120641_121082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|121208_123656_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|123696_123894_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|123927_124665_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|124953_125403_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|125636_127454_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|127453_128350_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|128389_128770_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|128774_129704_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|129758_130439_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|130435_131836_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|132052_132487_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|132718_132898_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|134640_135150_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|135199_135697_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|136028_136355_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|136354_137065_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|137073_137619_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|137694_138057_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|139953_140490_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|140522_140948_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|140960_142250_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|142297_144049_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|144066_144429_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|144478_144829_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|145186_145456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|145443_146019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|146049_146544_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|146587_146956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|146989_147193_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|147241_147499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|147574_147829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|148004_148271_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|148258_148741_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|148952_150299_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|152141_153104_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|153090_153840_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|154077_154275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|154274_157070_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|157184_157754_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|157788_158070_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|158313_158577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|158591_158855_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP021714	Klebsiella pneumoniae strain AR_0129 plasmid tig00000001, complete sequence	106541	0	105737	106541	tail,integrase,terminase	Salmonella_phage(88.24%)	111	22223:22244	101237:101258
WP_087749557.1|1071_1803_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.2	6.4e-79
WP_048331561.1|1951_2215_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.3	4.8e-29
WP_012540037.1|2338_2974_-	peptidase	NA	NA	NA	NA	NA
WP_087749558.1|3271_3589_+	hypothetical protein	NA	J9Q750	Salmonella_phage	76.2	2.9e-44
WP_087749559.1|3602_3797_+	hypothetical protein	NA	J9Q6K5	Salmonella_phage	68.3	1.7e-18
WP_019704577.1|5347_5566_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_023279445.1|5578_5791_+	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_087749561.1|5927_6239_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	8.8e-30
WP_004109918.1|6358_6766_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.8e-23
WP_032439733.1|6892_7174_+	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
WP_032439735.1|7201_7390_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
WP_042935000.1|7615_8098_+	hypothetical protein	NA	J9Q805	Salmonella_phage	78.1	2.5e-71
WP_004109904.1|8668_8872_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|8921_9572_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_141232857.1|9896_10196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047065793.1|10205_10736_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	85.8	1.1e-72
WP_087749562.1|10891_11329_+	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.7	1.9e-14
WP_004109887.1|11379_11655_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_087749563.1|11657_13217_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.2e-279
WP_021313132.1|13300_13981_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_087749564.1|13980_14649_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_046882064.1|14645_15284_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	3.9e-109
WP_019704585.1|15276_15531_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_087749565.1|15527_16427_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	96.6	4.6e-164
WP_004109869.1|16436_16703_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|16880_17522_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|17524_18781_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_087749566.1|18798_20388_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.5	8.8e-275
WP_087749567.1|20410_21310_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.8e-123
WP_004109857.1|21336_22215_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
22223:22244	attL	AATAGGTAAGTACTTACCTATT	NA	NA	NA	NA
WP_087749568.1|22293_22722_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	1.0e-28
WP_072124224.1|22769_23204_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	1.3e-63
WP_087749569.1|23203_24037_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.8e-131
WP_004109848.1|24134_24479_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_087749570.1|24469_24943_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.0	4.3e-76
WP_047066294.1|24944_25337_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
WP_004109839.1|25404_26151_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109835.1|26212_26530_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109830.1|26646_26880_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_087749571.1|26887_31417_+	tape measure protein	NA	J9Q712	Salmonella_phage	69.3	0.0e+00
WP_004109823.1|31460_31796_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_004109820.1|31882_32581_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|32573_33371_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|33358_33970_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_087749572.1|33986_46121_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.0	7.0e-29
WP_087749573.1|46234_47683_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.3	6.8e-40
WP_004109805.1|47778_48102_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032422980.1|48115_48808_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.7e-119
WP_021313118.1|48810_49062_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	5.8e-24
WP_032734133.1|49478_49871_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
WP_087749574.1|49855_50605_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	3.5e-16
WP_021313115.1|50789_51455_+	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_004110193.1|51454_51817_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_087749575.1|51832_52597_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	40.2	6.1e-48
WP_087749576.1|52803_53529_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	3.3e-128
WP_032440528.1|53593_54934_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_032443551.1|55087_56206_+	hypothetical protein	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
WP_087749577.1|56248_57415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087749578.1|57703_58492_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	1.2e-70
WP_087749579.1|58571_59039_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.6	8.8e-50
WP_087749580.1|59038_60361_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	2.2e-226
WP_141232859.1|60357_60537_+	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	4.6e-15
WP_023279477.1|60520_60736_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_087636937.1|60732_60885_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	84.0	7.1e-17
WP_087749582.1|60881_61181_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	64.6	9.7e-26
WP_087749583.1|62954_63671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749584.1|63914_64691_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.4	6.5e-90
WP_087749585.1|64700_65087_+	hypothetical protein	NA	Q716B1	Shigella_phage	72.0	3.7e-46
WP_032440523.1|65083_65329_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_087749604.1|65588_66041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064152235.1|66050_66461_+	toxin YafO	NA	NA	NA	NA	NA
WP_087749586.1|66525_66885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095337145.1|67235_68336_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	29.5	3.6e-17
WP_064317490.1|68330_68711_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_087749606.1|68984_69197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749587.1|69313_71593_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.8	1.5e-243
WP_019704545.1|71689_72922_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_087749588.1|73102_76621_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.3	0.0e+00
WP_087749589.1|76617_77061_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	80.9	3.2e-57
WP_023279488.1|77213_77429_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_087749590.1|77777_78209_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	93.0	3.6e-66
WP_042935032.1|78328_79336_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_032734154.1|79396_80341_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	2.4e-171
WP_019704549.1|80340_80607_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_087749591.1|80609_81683_+	recombinase	NA	J9Q736	Salmonella_phage	95.7	1.3e-192
WP_039817757.1|83253_83589_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	3.6e-37
WP_014342074.1|83588_83801_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_087749593.1|84273_85371_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	6.0e-73
WP_021313778.1|85691_86336_+	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
WP_087749594.1|86411_86906_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	72.0	1.0e-64
WP_021313776.1|87094_88180_+	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_087749595.1|88409_90326_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	1.5e-300
WP_087749596.1|90315_91062_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.3	1.0e-79
WP_014342183.1|91071_91641_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_014342182.1|91716_94020_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_087749597.1|94150_95293_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_032423045.1|95370_96246_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_014342179.1|96439_97543_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_087749598.1|97544_97958_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	78.1	6.2e-55
WP_087749599.1|97954_98431_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	3.2e-71
WP_087749600.1|98430_99075_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	1.4e-93
WP_087749601.1|99138_99558_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	1.9e-51
WP_014342174.1|99567_100125_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_087749602.1|100250_101084_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.5	4.3e-63
WP_023279507.1|101268_101862_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
101237:101258	attR	AATAGGTAAGTACTTACCTATT	NA	NA	NA	NA
WP_019704564.1|102059_102293_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_019704565.1|102865_103453_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_157663083.1|103610_104150_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	47.1	5.8e-29
WP_019704567.1|104450_104876_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|104875_105031_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_021313149.1|105158_105737_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
>prophage 1
NZ_CP021715	Klebsiella pneumoniae strain AR_0129 plasmid tig00000002, complete sequence	43378	21989	32287	43378	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|21989_25007_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|26215_27118_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|27379_28141_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|28161_29022_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|29158_29863_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|30255_30495_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|30581_31244_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|31624_32287_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
NZ_CP021716	Klebsiella pneumoniae strain AR_0129 plasmid tig00000003, complete sequence	43500	0	5772	43500	integrase	Salmonella_phage(25.0%)	9	2095:2123	6067:6095
WP_002353177.1|431_683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353182.1|773_1421_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	28.3	4.1e-05
WP_032442017.1|1583_2027_-	antirestriction protein	NA	NA	NA	NA	NA
2095:2123	attL	GTGCGTTTCAACCGGGTATAGCGCACGTT	NA	NA	NA	NA
WP_002353199.1|2263_3031_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.7	2.0e-14
WP_002353184.1|3646_4036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353195.1|4286_4478_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	55.6	7.8e-05
WP_032442018.1|4638_4962_-	CcdB family protein	NA	NA	NA	NA	NA
WP_077261114.1|4961_5210_-	post-segregation antitoxin CcdA	NA	NA	NA	NA	NA
WP_032442020.1|5307_5772_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	42.0	5.5e-20
6067:6095	attR	AACGTGCGCTATACCCGGTTGAAACGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP021716	Klebsiella pneumoniae strain AR_0129 plasmid tig00000003, complete sequence	43500	23677	25218	43500		Bacillus_phage(50.0%)	3	NA	NA
WP_032442030.1|23677_24364_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.1	7.9e-23
WP_043053774.1|24364_24715_+	trbM family protein	NA	NA	NA	NA	NA
WP_032442031.1|24756_25218_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	93.2	3.0e-58
>prophage 3
NZ_CP021716	Klebsiella pneumoniae strain AR_0129 plasmid tig00000003, complete sequence	43500	31269	35908	43500	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_004152397.1|31269_32589_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|32838_33720_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|34106_34886_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|34882_35908_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 4
NZ_CP021716	Klebsiella pneumoniae strain AR_0129 plasmid tig00000003, complete sequence	43500	41983	42541	43500		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001217881.1|41983_42541_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
