The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	131953	185413	4940441	tRNA,transposase,integrase,protease	Escherichia_phage(33.33%)	44	138066:138125	197393:198155
WP_001296359.1|131953_132451_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|132545_133253_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|133332_134064_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|134076_135027_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|135135_135699_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|135698_136115_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|136229_137210_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|137227_137932_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
138066:138125	attL	GGTAATGGTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCCGTGGC	NA	NA	NA	NA
WP_157662780.1|138810_139293_+	YggT family protein	NA	NA	NA	NA	NA
WP_001277229.1|139289_139580_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|139587_140181_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|140173_141310_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|141624_142611_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|142655_143159_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|143158_144460_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|144515_145523_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|145639_146686_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|146861_147581_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|147601_147742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|147764_148091_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|148090_148810_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|148970_150023_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|150050_150326_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|150390_151470_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|151671_152928_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839781.1|152976_155112_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|155504_156212_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|156590_157856_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|158111_159155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023146305.1|160938_161154_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|161122_162249_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|162339_162453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|164286_164547_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|164588_165149_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|165188_165617_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|166334_167528_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|167663_169388_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|169388_170336_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|170335_172078_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|172074_173352_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|173433_175635_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|176578_180466_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|181062_182214_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000080195.1|183799_185413_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
197393:198155	attR	GGTAATGGTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCCGTGGCTTCCATCTCCATCAGTTGTCCCTCCTGCTCAGCTACTGAAGGCGTGGTGCGTAACGGTAAAAGTACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACACACCAGAAAATCATTGATATGGCCATGAATGGTGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGATGTGATTGTCTGCGCTGAAATGGACGAACAGTGGGGCTACGTCGGTGCTAAATCACGTCAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACGGTTGTGGCGCACGTCTTCGGTGAACGCACTCTGGCCACACTGGAGCGTCTTCTGAGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGTTACACTCAGCGCATTGAGCGACATAACCTGAATCTGAGACAACATCTGGCAAGGCTGGGACGGAAGTCACTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCA	NA	NA	NA	NA
>prophage 2
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	2749141	2858933	4940441	tRNA,tail,terminase,transposase,capsid,plate,head,protease,portal,integrase,holin	Enterobacteria_phage(43.75%)	131	2844531:2844546	2863852:2863867
WP_000520781.1|2749141_2749462_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2749492_2751769_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|2752453_2752672_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|2752956_2753661_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|2753702_2755424_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|2755424_2757191_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|2757313_2758279_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|2758822_2759317_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|2759451_2763558_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|2763716_2764328_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|2764338_2765682_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886685.1|2765772_2767065_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	7.3e-94
WP_000078916.1|2767370_2767511_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|2767702_2767963_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|2768003_2769113_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|2769270_2770455_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|2770454_2770967_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|2771022_2771397_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|2771405_2771561_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|2771547_2774355_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|2774367_2774856_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|2774884_2775484_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|2775711_2776497_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|2776498_2777026_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|2777054_2777588_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|2777590_2779576_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|2779578_2780109_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|2780101_2780998_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|2781001_2781352_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|2781348_2781930_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|2781926_2782562_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|2782554_2783022_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|2783045_2784923_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|2785061_2785457_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|2785453_2785846_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|2785842_2786166_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_087758146.1|2786168_2786369_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.0e-31
WP_000063100.1|2786368_2786863_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|2786964_2787765_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|2787810_2788863_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|2788886_2789723_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|2789877_2791629_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|2791628_2792675_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|2792689_2793214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|2793937_2794435_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|2794474_2795317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|2795400_2795715_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|2795719_2796679_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|2796755_2799578_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|2799584_2799950_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000013455.1|2800022_2800253_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000104290.1|2800575_2800875_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|2800871_2801138_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|2801134_2801338_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|2801361_2801772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|2801865_2801979_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|2801975_2802218_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|2802229_2802508_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|2802518_2802869_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|2803006_2803198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|2803204_2803627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|2803631_2804153_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|2804257_2804599_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|2804668_2805661_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|2805960_2808405_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|2808415_2809033_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|2809034_2809898_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|2809933_2810560_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|2810873_2812022_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|2812118_2812859_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|2813050_2815333_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|2815387_2816245_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|2816650_2818411_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|2818540_2819233_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|2819431_2820520_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|2820590_2821874_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|2822129_2822702_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|2822761_2823202_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_001486917.1|2823242_2823725_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_000072165.1|2823724_2824339_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001554039.1|2824345_2825626_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	43.8	7.8e-40
WP_000138756.1|2825628_2826207_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|2826199_2827303_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|2827293_2827641_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|2827695_2828292_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|2828288_2829443_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|2829430_2829646_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|2829642_2830527_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|2830526_2833478_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|2833553_2833712_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|2833635_2833971_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|2834068_2834350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|2834352_2834874_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|2834873_2836301_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|2836290_2836545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|2836541_2837006_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|2837005_2837452_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2837453_2837792_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|2837801_2838755_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|2838769_2839885_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|2840099_2840558_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|2840560_2841382_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|2841362_2842859_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000167500.1|2842858_2844454_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000124060.1|2844450_2844996_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
2844531:2844546	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|2844995_2845307_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|2845306_2845633_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|2845629_2846280_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|2846263_2847004_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|2847006_2847357_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|2847487_2848216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|2848191_2848596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|2848594_2848810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|2849000_2849765_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|2849881_2850238_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|2850331_2850520_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|2850572_2850881_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|2850891_2851812_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|2851811_2852129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|2852144_2853914_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|2853924_2855091_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|2855093_2855363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2855390_2855921_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|2856209_2856482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|2856491_2856788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|2856802_2857018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2857014_2857698_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|2857694_2857925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|2857914_2858121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|2858122_2858572_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|2858543_2858933_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
2863852:2863867	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	3070248	3115942	4940441	tRNA,tail,terminase,lysis,capsid,head,portal,integrase,holin	Enterobacteria_phage(56.0%)	58	3068566:3068580	3097145:3097159
3068566:3068580	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|3070248_3071355_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3071408_3071870_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|3071879_3072533_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|3072704_3073955_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|3074068_3075211_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|3075200_3075437_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|3075576_3075816_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|3075799_3076126_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|3076125_3076347_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|3076445_3076727_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|3076737_3076929_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|3076901_3077084_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|3077080_3077761_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|3077757_3078543_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|3078548_3078845_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|3078920_3079127_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|3079722_3080412_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|3080516_3080747_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|3080816_3081356_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|3081442_3082372_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|3082368_3083070_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_087758148.1|3083319_3087570_+	adhesin	NA	NA	NA	NA	NA
WP_000700202.1|3087606_3088650_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|3088999_3089101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|3089097_3089553_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|3089552_3089723_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|3089715_3090006_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|3090002_3090365_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|3090361_3090502_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|3090498_3091188_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|3091509_3091815_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|3091801_3092278_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|3092494_3092677_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|3092767_3093061_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|3093541_3093868_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|3094074_3094257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|3094820_3095366_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|3095340_3097266_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
3097145:3097159	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|3097262_3097469_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|3097465_3099067_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|3099047_3100367_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|3100376_3100709_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|3100764_3101790_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|3101831_3102230_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|3102241_3102595_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|3102606_3103185_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|3103181_3103577_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|3103584_3104325_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|3104340_3104763_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|3104744_3105179_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|3105171_3107733_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|3107729_3108059_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|3108058_3108757_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|3108761_3109505_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|3109441_3110044_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|3110104_3113587_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|3113645_3115667_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|3115663_3115942_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	3256443	3326935	4940441	tail,terminase,transposase,capsid,head,protease,portal,integrase,holin	Stx2-converting_phage(25.45%)	78	3252617:3252631	3258527:3258541
3252617:3252631	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|3256443_3257574_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|3257551_3257800_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|3257864_3260336_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
3258527:3258541	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|3260428_3260620_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|3260616_3260805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|3261154_3261322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|3261370_3261589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3261748_3261904_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|3262176_3262893_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|3262942_3263158_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|3263154_3263580_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_087758160.1|3263602_3264565_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.1	5.4e-70
WP_000788950.1|3264571_3265318_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|3265339_3266110_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|3266125_3266551_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|3266725_3267391_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|3267571_3267784_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|3267951_3268224_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|3268225_3269281_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|3269281_3269662_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|3269658_3270480_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|3270706_3270904_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|3271055_3272105_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|3272906_3273038_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_016230612.1|3274691_3276545_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|3276695_3276911_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|3276915_3277260_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|3277225_3277498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|3277603_3278137_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|3278691_3278778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|3278999_3279185_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|3279270_3279486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|3279684_3279885_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|3279926_3280292_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|3280582_3281146_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|3281142_3282804_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|3282867_3284805_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|3284849_3285071_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|3285016_3287602_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|3287598_3287925_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|3287934_3288285_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|3288281_3288728_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|3288724_3289069_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|3289135_3289852_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|3289866_3290241_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3290336_3290546_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|3290593_3293836_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|3293828_3294170_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|3294169_3294868_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|3294878_3295622_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|3295567_3296200_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|3296542_3300016_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_087758150.1|3300656_3302198_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	1.4e-128
WP_001016257.1|3302212_3302959_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|3303420_3306246_+|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|3306247_3306781_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|3306811_3307339_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|3307354_3308323_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|3308448_3308631_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|3308829_3309498_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|3309554_3309824_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|3310235_3310793_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|3310789_3311065_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|3311440_3312247_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|3312246_3313440_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|3313451_3314810_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|3314813_3316409_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|3316408_3317971_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3318062_3318107_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|3318244_3319126_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3319122_3319743_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|3319770_3321666_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|3321878_3322754_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|3322959_3323946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|3323955_3324264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|3324320_3324911_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|3324907_3325666_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|3325885_3326935_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	3823908	3906418	4940441	tRNA,tail,terminase,capsid,plate,portal,integrase,holin	Escherichia_phage(24.39%)	95	3863868:3863927	3906480:3906604
WP_001258676.1|3823908_3825681_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|3825990_3826557_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|3826553_3827372_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|3827424_3827820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|3827860_3828604_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|3828600_3829572_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|3829607_3832037_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214293.1|3832061_3833162_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|3833549_3834296_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|3834309_3834876_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|3835091_3836825_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|3836877_3837270_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|3837269_3839348_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|3839340_3840489_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|3840677_3841322_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3841332_3841722_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|3841736_3842786_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|3842788_3843649_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|3843939_3845601_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|3845745_3846249_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|3846269_3848234_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|3848238_3849165_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|3849161_3850049_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3850175_3850754_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3850756_3851107_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|3851886_3852315_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|3852321_3853746_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|3853720_3854521_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3854687_3855674_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|3855688_3857203_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|3857272_3858262_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3859056_3859560_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3859637_3859889_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3860003_3860090_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|3860353_3860677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3860848_3861346_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3861383_3861623_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|3861813_3863025_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3863075_3863741_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3863868:3863927	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|3864212_3864632_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|3865846_3866071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|3866232_3866622_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|3866657_3868298_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|3868406_3868688_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|3868700_3869213_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|3869230_3870733_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|3870729_3871119_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|3871118_3872303_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|3872295_3872922_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|3872924_3873845_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|3873841_3874183_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|3874185_3875088_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|3875068_3875605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|3875601_3876282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|3876313_3876694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|3876690_3877110_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|3877144_3878179_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|3878237_3878567_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|3878566_3879874_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|3879873_3881448_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|3881444_3881678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|3881677_3883540_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|3883526_3884093_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|3884461_3884707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|3884766_3884961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|3884968_3885448_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|3885447_3885720_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|3885719_3886103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|3886215_3886887_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|3886886_3887180_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|3887176_3887773_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|3887850_3888030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|3888181_3888823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|3889066_3889300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|3889698_3890187_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|3890196_3890802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|3891264_3891963_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|3893151_3894075_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|3894249_3895038_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|3895719_3895944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|3895940_3896252_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|3896248_3896485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|3896486_3896897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|3896935_3898351_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|3898340_3899096_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|3899092_3899317_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|3899356_3899833_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|3899891_3900122_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|3900220_3900634_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|3901644_3901965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|3901995_3904212_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|3904208_3904778_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|3904777_3904960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|3905169_3905433_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|3905401_3906418_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
3906480:3906604	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	4028369	4064667	4940441	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
WP_001296203.1|4028369_4029566_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|4029689_4029968_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|4030061_4030664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093906.1|4031689_4032385_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
WP_000255956.1|4032381_4033404_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|4033549_4033729_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001296206.1|4034928_4036074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|4036604_4036862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|4036915_4037683_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|4037679_4038738_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|4038756_4039746_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|4039756_4041922_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|4042350_4042785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|4043002_4045387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|4045383_4046289_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|4046285_4047356_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|4047491_4047905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|4048019_4049561_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4049575_4050322_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000080195.1|4050788_4052402_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|4052432_4052783_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4052779_4053205_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000846703.1|4053310_4053721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|4053941_4054760_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|4054759_4055005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|4055098_4055572_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|4055587_4056064_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4056126_4056348_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|4056366_4057011_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|4057026_4057395_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|4057483_4057858_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|4057854_4058049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|4058061_4058175_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|4058663_4058846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|4058946_4059276_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|4059447_4060506_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|4060703_4061177_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|4061295_4062462_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|4062670_4064098_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|4064208_4064667_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 7
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	4088591	4094894	4940441		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|4088591_4089134_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|4089138_4090017_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|4090074_4090974_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|4090973_4092059_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|4092431_4093325_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|4093499_4094894_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	4407734	4479125	4940441	tRNA,tail,terminase,transposase,lysis,head,coat,portal,integrase,holin	Enterobacteria_phage(53.23%)	90	4437586:4437602	4479199:4479215
WP_001283598.1|4407734_4408547_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4408546_4409560_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699128.1|4409625_4410762_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
WP_000615816.1|4410860_4411856_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|4411852_4413031_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|4413295_4414516_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683761.1|4414674_4416681_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|4416801_4417080_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|4417113_4417662_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|4417661_4418471_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043795.1|4418470_4419295_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001296258.1|4419298_4420384_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001296259.1|4420418_4421351_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4421516_4422068_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001527383.1|4422127_4422952_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000054000.1|4422953_4423481_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000819140.1|4423477_4423957_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000679363.1|4423953_4424445_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000499462.1|4424461_4425214_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296260.1|4425233_4427882_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032632.1|4427962_4428529_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195810.1|4429087_4429573_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425017.1|4429775_4431920_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|4431919_4433230_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|4433410_4433695_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296262.1|4434066_4435407_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|4435468_4436224_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|4436517_4437450_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
4437586:4437602	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|4437761_4438919_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_050008022.1|4439027_4441202_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	70.6	1.8e-60
WP_021538724.1|4441224_4441725_+	HNH endonuclease	NA	A5H1J6	Xanthomonas_virus	45.3	4.3e-26
WP_001407254.1|4441837_4442125_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085227.1|4442139_4442361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021575671.1|4442360_4443089_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.4	3.4e-80
WP_044342074.1|4443176_4443899_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	91.3	2.6e-117
WP_024191015.1|4443888_4444062_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_032152582.1|4444185_4444437_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	68.6	2.1e-10
WP_001334102.1|4444504_4444873_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_044342076.1|4444897_4446736_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.9	1.4e-247
WP_078214632.1|4446735_4448151_-	acyltransferase	NA	I6RSG0	Salmonella_phage	80.3	6.3e-200
WP_044342079.1|4448160_4448853_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	97.4	6.4e-113
WP_029403249.1|4448855_4449311_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	3.0e-87
WP_087758155.1|4449310_4450012_-|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.9	1.3e-116
WP_087758156.1|4450011_4451430_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.4	2.1e-275
WP_001140510.1|4451439_4451901_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001462613.1|4451881_4452070_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_087758157.1|4452111_4453365_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.6	1.3e-233
WP_038977027.1|4453383_4454277_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	3.4e-127
WP_000818368.1|4454367_4456566_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_033558927.1|4456567_4457983_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	5.8e-278
WP_000179910.1|4457979_4458405_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_085949154.1|4458491_4459639_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000807788.1|4459737_4459980_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001028465.1|4460337_4460859_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_060617796.1|4461061_4461499_-|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	97.9	3.8e-71
WP_001296839.1|4461495_4461972_-	glycoside hydrolase family protein	NA	K7P847	Enterobacteria_phage	100.0	2.9e-88
WP_015966862.1|4461955_4462279_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_033552114.1|4462866_4463205_-	Fis family transcriptional regulator	NA	A0A1W6DXT8	Salmonella_phage	49.1	8.7e-23
WP_001235461.1|4463629_4464253_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|4464249_4464438_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|4464434_4464797_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002244.1|4464793_4465084_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286917.1|4465076_4465289_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000567005.1|4465281_4465452_-	protein ninF	NA	K7PM86	Enterobacteria_phage	98.2	7.9e-25
WP_024257963.1|4465448_4465631_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.3	2.2e-28
WP_023157010.1|4465767_4466358_-	MT-A70 protein	NA	A0A193GYV6	Enterobacter_phage	76.0	2.8e-85
WP_023157011.1|4466354_4466795_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.3	5.5e-78
WP_023157012.1|4467008_4467335_-	hypothetical protein	NA	I6RSP8	Salmonella_phage	98.1	1.2e-58
WP_023157013.1|4467410_4468847_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.8	1.0e-274
WP_023157014.1|4468836_4469736_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	98.3	3.3e-162
WP_023157015.1|4469728_4469875_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	97.9	2.5e-19
WP_000438538.1|4469907_4470207_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000067727.1|4470316_4470532_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_014532159.1|4470607_4471303_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	97.0	2.0e-130
WP_024257965.1|4471834_4472149_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	67.6	7.5e-29
WP_130078254.1|4472145_4472412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387878.1|4472545_4472869_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_085949154.1|4472968_4474115_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_014532157.1|4474241_4474517_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_024257966.1|4474601_4474910_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	2.8e-52
WP_023157019.1|4474906_4475809_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.8	1.5e-146
WP_000041317.1|4475792_4476275_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_000753555.1|4476286_4476601_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_001214456.1|4476617_4476782_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_024257968.1|4476778_4477288_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	76.9	1.3e-62
WP_024257969.1|4477284_4477539_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	9.4e-38
WP_023157022.1|4477525_4478215_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	71.0	4.9e-81
WP_000022062.1|4478329_4478611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545735.1|4478699_4478867_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	1.3e-27
WP_001163428.1|4478924_4479125_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
4479199:4479215	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 9
NZ_CP021689	Escherichia coli strain AR_0058, complete genome	4940441	4807031	4814171	4940441		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|4807031_4809593_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|4809698_4810355_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|4810405_4811173_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|4811368_4812277_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|4812273_4813536_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|4813532_4814171_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 1
NZ_CP021690	Escherichia coli strain AR_0058 plasmid tig00007555j7554, complete sequence	163045	31209	99948	163045	integrase,transposase	Escherichia_phage(45.45%)	59	21697:21711	47252:47266
21697:21711	attL	GCACTTCGCGGATAA	NA	NA	NA	NA
WP_000016982.1|31209_32016_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|32016_32322_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|32323_32542_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|33249_34245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|34248_35181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553854.1|36228_39345_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|39466_40750_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|40746_42303_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|42485_42707_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|42706_43087_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|43091_43271_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|43298_43658_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|43944_44262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|44489_45506_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|45713_47117_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|47103_48036_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
47252:47266	attR	TTATCCGCGAAGTGC	NA	NA	NA	NA
WP_000361610.1|51378_52356_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|52640_53381_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|53501_53690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|54056_55226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|56072_56345_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|57587_59558_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|59564_60356_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001300609.1|61094_61877_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_001310017.1|61873_62896_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|63975_64323_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|64319_64724_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|65225_66734_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_011478084.1|67042_67414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020413.1|68999_70175_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|70243_72505_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|72673_73450_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|73457_74333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|76783_77119_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|77247_77595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|77614_78124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|78120_78381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011478084.1|79214_79586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|79894_80383_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|81287_81773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|81797_82283_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|82269_82965_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|82969_84100_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|84089_85373_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|85375_86755_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|86858_87386_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|87426_89313_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|89659_90475_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|90657_91164_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|91153_91312_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_001067858.1|92500_93205_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|94170_94644_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|94774_95563_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|95768_96116_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|96109_96949_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|97076_97280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|97435_98641_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|98651_98957_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|99183_99948_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
