The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	0	3718	5375740		Microcystis_phage(100.0%)	3	NA	NA
WP_004184615.1|678_1572_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004200300.1|1747_2641_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.4	2.8e-12
WP_004200301.1|2824_3718_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	8.8e-14
>prophage 2
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	19570	30314	5375740		Staphylococcus_phage(40.0%)	11	NA	NA
WP_004200316.1|19570_20269_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|20459_20942_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|21051_21951_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175495.1|21925_22732_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175494.1|22746_24042_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_002910715.1|24345_25272_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004200317.1|25370_25847_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|25896_27540_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|27823_28717_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910721.1|28722_29442_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_004200318.1|29438_30314_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
>prophage 3
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	34176	36471	5375740		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004200320.1|34176_36471_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	3.0e-159
>prophage 4
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	55855	56467	5375740		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|55855_56467_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 5
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	72091	79460	5375740	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_002910904.1|72091_73777_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|73982_74564_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004151443.1|74602_75298_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_020956686.1|75443_77354_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_002910910.1|77485_77830_+	RidA family protein	NA	NA	NA	NA	NA
WP_004145519.1|77830_78016_-	YoaH family protein	NA	NA	NA	NA	NA
WP_020956685.1|78104_79460_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
>prophage 6
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	83368	84928	5375740		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|83368_84928_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 7
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	92368	92578	5375740		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|92368_92578_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 8
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	97815	99864	5375740		Moraxella_phage(100.0%)	1	NA	NA
WP_032419784.1|97815_99864_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	6.8e-86
>prophage 9
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	107371	108025	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_009484457.1|107371_108025_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.0e-56
>prophage 10
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	113702	117617	5375740	lysis,integrase	Salmonella_phage(50.0%)	7	109771:109798	114671:114698
109771:109798	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_032419797.1|113702_114182_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	46.5	5.2e-29
WP_077253379.1|114180_114540_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	56.5	7.8e-14
WP_015874944.1|114933_115275_-	YebY family protein	NA	NA	NA	NA	NA
114671:114698	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_020956678.1|115288_116158_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_004151448.1|116161_116536_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_002911406.1|116648_116879_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|116957_117617_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 11
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	125041	126517	5375740		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|125041_126517_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 12
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	130442	146989	5375740	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_002911444.1|130442_131762_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004180437.1|131777_132722_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|132800_133553_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_004212745.1|133552_134338_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004148860.1|134401_135412_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|135420_136032_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|136111_136633_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|136667_137408_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|137435_137879_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911479.1|137880_139668_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_032441802.1|139935_140502_+	hydrolase	NA	NA	NA	NA	NA
WP_002911483.1|140498_141317_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|141369_141765_+	membrane protein	NA	NA	NA	NA	NA
WP_002911486.1|141804_142548_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_020956673.1|142544_143549_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_009307530.1|143630_144374_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002911491.1|144450_145020_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|145255_146989_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 13
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	153926	155441	5375740		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|153926_155441_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 14
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	172049	172802	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|172049_172802_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 15
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	179403	187846	5375740		Burkholderia_phage(40.0%)	8	NA	NA
WP_004180448.1|179403_181083_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|181197_182109_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004180449.1|182292_183204_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911592.1|183178_183673_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_022631353.1|183653_185087_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.1e-101
WP_002911594.1|185130_185838_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|185880_186162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|186700_187846_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 16
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	194682	199112	5375740	integrase	Pseudomonas_phage(50.0%)	2	190749:190768	202197:202216
190749:190768	attL	ATGATGAGCTTCATGATCGT	NA	NA	NA	NA
WP_000059621.1|194682_195939_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	3.3e-75
WP_000544020.1|198374_199112_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.0	5.7e-11
202197:202216	attR	ACGATCATGAAGCTCATCAT	NA	NA	NA	NA
>prophage 17
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	208062	210021	5375740	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_023157840.1|208062_210021_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.7	2.1e-121
>prophage 18
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	218072	219455	5375740	tRNA	Catovirus(100.0%)	1	NA	NA
WP_024622774.1|218072_219455_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.2	9.6e-44
>prophage 19
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	227154	254689	5375740	integrase,transposase	Stx2-converting_phage(37.5%)	11	226999:227012	231593:231606
226999:227012	attL	CAGCAGCACTGGCT	NA	NA	NA	NA
WP_003031976.1|227154_227559_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|227555_227903_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|227951_229490_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000059622.1|230033_231296_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.1e-73
WP_032441808.1|231489_232794_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
231593:231606	attR	CAGCAGCACTGGCT	NA	NA	NA	NA
WP_001286279.1|232821_234102_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_024622775.1|234094_235897_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_000098391.1|235883_237686_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_000140406.1|237852_238812_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_024622776.1|239002_245110_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_024622777.1|245197_254689_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 20
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	262255	262441	5375740		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032441810.1|262255_262441_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	3.6e-07
>prophage 21
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	279174	280122	5375740		Caulobacter_phage(100.0%)	1	NA	NA
WP_000155899.1|279174_280122_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	9.2e-54
>prophage 22
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	302621	303458	5375740		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|302621_303458_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 23
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	318883	325976	5375740		Pseudomonas_phage(33.33%)	4	NA	NA
WP_004152765.1|318883_320368_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_017879895.1|320888_322058_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.5	2.2e-182
WP_020324327.1|322232_323657_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_002912106.1|323873_325976_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
>prophage 24
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	330482	331382	5375740		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|330482_331382_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 25
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	337629	354461	5375740		Catovirus(12.5%)	13	NA	NA
WP_004214010.1|337629_338946_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.5	7.1e-12
WP_004175268.1|339068_340202_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004890862.1|340214_341108_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023304918.1|341104_342259_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
WP_019724801.1|342274_344170_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004175264.1|344185_344926_-	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.0e-07
WP_002912373.1|344925_345693_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004184806.1|346739_347744_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_009484572.1|348144_348267_+	small membrane protein	NA	NA	NA	NA	NA
WP_009484573.1|348691_349858_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_020324344.1|350021_351392_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.4e-31
WP_004180506.1|351414_352830_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_032408624.1|353054_354461_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
>prophage 26
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	358235	359720	5375740		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004152765.1|358235_359720_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 27
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	374629	381393	5375740		Bacillus_phage(25.0%)	5	NA	NA
WP_001741945.1|374629_375520_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_004151147.1|376283_377867_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_032408614.1|378201_380049_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|380079_380661_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|380751_381393_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 28
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	398512	403529	5375740	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_019705218.1|398512_399991_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_020324287.1|399987_400710_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_020324324.1|401028_402390_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.0e-206
WP_002912636.1|402635_403529_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
>prophage 29
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	425712	432769	5375740	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_004195370.1|425712_427746_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|427863_428334_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_004144215.1|428381_429101_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_020324322.1|429094_430783_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	4.2e-259
WP_002912762.1|431012_431126_+	protein YohO	NA	NA	NA	NA	NA
WP_020324374.1|431100_431838_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020324379.1|431821_432769_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.4e-24
>prophage 30
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	439303	439858	5375740		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032441815.1|439303_439858_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	3.0e-20
>prophage 31
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	444132	444867	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_004175087.1|444132_444867_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	1.5e-48
>prophage 32
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	456506	458027	5375740		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|456506_458027_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 33
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	461791	465698	5375740		Cellulophaga_phage(50.0%)	3	NA	NA
WP_002912924.1|461791_462460_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|462820_463654_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_020324292.1|463724_465698_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 34
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	470098	470953	5375740		Catovirus(100.0%)	1	NA	NA
WP_020806192.1|470098_470953_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	3.4e-23
>prophage 35
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	478785	483096	5375740		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_004200498.1|478785_480252_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_004144255.1|480372_481350_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004180648.1|481393_482101_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|482526_483096_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 36
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	488851	494938	5375740		Planktothrix_phage(33.33%)	5	NA	NA
WP_004151118.1|488851_490441_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|490444_490789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|491120_492317_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912977.1|492313_493033_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004144263.1|493180_494938_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 37
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	499172	503989	5375740	integrase	Vibrio_phage(100.0%)	4	502508:502528	514631:514651
WP_020324366.1|499172_500180_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	1.2e-83
WP_004195346.1|500366_500594_+	YejL family protein	NA	NA	NA	NA	NA
WP_002912990.1|500612_502373_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
502508:502528	attL	AATCCTCTCGTGCCGACCAAA	NA	NA	NA	NA
WP_020324474.1|502732_503989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.7	1.3e-103
WP_020324474.1|502732_503989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.7	1.3e-103
514631:514651	attR	AATCCTCTCGTGCCGACCAAA	NA	NA	NA	NA
>prophage 38
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	518669	519830	5375740		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020324457.1|518669_519830_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 39
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	523750	527149	5375740		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_002913002.1|523750_524815_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
WP_004180700.1|524888_525941_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_002913005.1|526045_527149_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
>prophage 40
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	531289	543420	5375740		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913009.1|531289_534130_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_020324481.1|534261_536895_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	4.6e-95
WP_002913014.1|537041_537770_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002913016.1|538114_540400_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_004140835.1|540501_541632_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|541631_541886_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_020324250.1|542349_543420_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 41
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	551265	552471	5375740		Oenococcus_phage(100.0%)	1	NA	NA
WP_004184969.1|551265_552471_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.1e-26
>prophage 42
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	555586	556528	5375740	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_004180717.1|555586_556528_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 43
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	584557	585157	5375740		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|584557_585157_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 44
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	597559	598333	5375740		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|597559_598333_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 45
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	602626	604144	5375740		Mollivirus(100.0%)	1	NA	NA
WP_004180758.1|602626_604144_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	7.7e-87
>prophage 46
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	610584	611721	5375740		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|610584_611721_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 47
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	620206	621292	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_032441816.1|620206_621292_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
>prophage 48
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	630407	634992	5375740		Enterobacteria_phage(25.0%)	5	NA	NA
WP_004149224.1|630407_631337_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
WP_004174945.1|631749_632232_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_004180785.1|632601_633483_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004180788.1|633492_634401_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180790.1|634533_634992_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
>prophage 49
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	638262	640709	5375740		Enterobacteria_phage(50.0%)	2	NA	NA
WP_020324238.1|638262_639960_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	8.8e-47
WP_002913374.1|639971_640709_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 50
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	655199	665126	5375740		Lactobacillus_phage(25.0%)	9	NA	NA
WP_002913438.1|655199_656126_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|656214_657213_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|657209_657428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180820.1|657429_659445_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
WP_085353186.1|659514_660573_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004174922.1|660806_661568_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|661744_662716_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|663096_663354_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|663398_665126_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 51
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	668735	670860	5375740		Lactococcus_phage(50.0%)	2	NA	NA
WP_004145610.1|668735_669647_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
WP_002913623.1|669765_670860_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 52
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	674213	677790	5375740		Pandoravirus(50.0%)	5	NA	NA
WP_032441818.1|674213_675113_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|675207_675783_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_020325279.1|675844_676294_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|676280_676706_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|676917_677790_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 53
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	712693	713407	5375740		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|712693_713407_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 54
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	720052	723059	5375740	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_004180868.1|720052_720976_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_071527881.1|720972_721674_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|721772_723059_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
>prophage 55
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	726598	728274	5375740		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004180872.1|726598_727636_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.8e-71
WP_004145656.1|727632_728274_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
>prophage 56
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	734685	734877	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002913843.1|734685_734877_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 57
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	738646	745271	5375740		Tetraselmis_virus(33.33%)	4	NA	NA
WP_004180884.1|738646_740515_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004151979.1|740609_742187_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|742254_743721_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004174856.1|743879_745271_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
>prophage 58
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	755591	756023	5375740		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|755591_756023_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 59
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	766535	772856	5375740		Mycoplasma_phage(20.0%)	8	NA	NA
WP_004180902.1|766535_767822_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	5.8e-35
WP_002913954.1|767892_768093_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|768094_768430_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004149343.1|768431_770282_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_004174835.1|770297_770813_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|770887_771211_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|771228_771615_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|771641_772856_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 60
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	788103	810170	5375740	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|788103_789357_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914028.1|789682_790873_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|790947_791286_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004180914.1|791351_792689_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_004180916.1|792675_793383_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|793391_794813_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004185139.1|795402_799290_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_004144346.1|799464_801081_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004890375.1|801077_801620_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_004180922.1|801649_802285_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004144349.1|802498_803347_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004144350.1|803403_803664_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_004144351.1|803676_804057_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004180923.1|804056_804788_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_020324857.1|804799_805537_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|805548_806454_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|806450_807131_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|807380_808355_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|808370_810170_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 61
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	815939	820474	5375740	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_002914082.1|815939_817271_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_004180937.1|817316_817700_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|818012_818702_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|818759_819845_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|820048_820474_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
>prophage 62
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	825772	827068	5375740		Burkholderia_virus(100.0%)	1	NA	NA
WP_020324862.1|825772_827068_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
>prophage 63
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	833224	835798	5375740		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|833224_835798_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 64
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	842588	843659	5375740		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|842588_843659_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 65
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	859006	859489	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002914164.1|859006_859489_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 66
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	873649	875170	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|873649_875170_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 67
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	897328	898231	5375740		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|897328_898231_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 68
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	903412	908711	5375740		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|903412_903658_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|903654_904065_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914325.1|904037_906179_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|906189_907152_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914328.1|907508_908711_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 69
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	923429	931634	5375740	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|923429_923615_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914765.1|923978_926606_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_004181008.1|926856_927357_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|927424_928483_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_004181009.1|928573_929071_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.4e-29
WP_004174698.1|929210_930089_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004149458.1|930096_930960_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004181011.1|930956_931634_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
>prophage 70
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	937572	938538	5375740		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|937572_938538_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 71
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	965479	966880	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|965479_966880_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 72
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	977245	978067	5375740		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|977245_978067_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 73
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	989811	994975	5375740		Cedratvirus(50.0%)	5	NA	NA
WP_004151058.1|989811_990591_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_002915094.1|990869_991352_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004188736.1|991363_991813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915096.1|991797_992145_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_032441821.1|992413_994975_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.7e-30
>prophage 74
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	998444	1004863	5375740		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004151061.1|998444_999332_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
WP_004151062.1|999440_1000643_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915104.1|1000639_1001017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915106.1|1001069_1002062_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915107.1|1002219_1003356_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915108.1|1003481_1004108_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915109.1|1004101_1004863_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 75
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1007933	1009966	5375740		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|1007933_1008539_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_002915159.1|1008538_1009966_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 76
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1018732	1024069	5375740		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|1018732_1019404_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_002915212.1|1019878_1020988_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002915213.1|1021051_1022350_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915214.1|1022431_1024069_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 77
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1027611	1033077	5375740		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_002915220.1|1027611_1028916_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
WP_004151066.1|1029029_1031780_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|1031937_1033077_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 78
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1040491	1041337	5375740		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|1040491_1041337_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 79
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1051592	1052615	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|1051592_1052615_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 80
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1059019	1059775	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|1059019_1059775_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 81
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1071320	1073821	5375740	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_002915551.1|1071320_1072526_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
WP_004151086.1|1072525_1072957_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|1072999_1073821_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 82
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1078766	1079591	5375740		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|1078766_1079591_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 83
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1112242	1123922	5375740		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_002915870.1|1112242_1113496_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|1113723_1115055_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|1115284_1115605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188670.1|1115662_1117507_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_004151968.1|1117503_1121040_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_002915886.1|1121036_1123922_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 84
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1129435	1141353	5375740		Cronobacter_phage(25.0%)	10	NA	NA
WP_002915933.1|1129435_1130230_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
WP_002915934.1|1130236_1131112_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915935.1|1131357_1133604_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|1133616_1134147_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004143967.1|1134829_1135525_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|1135588_1136302_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|1136425_1136644_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915975.1|1136864_1137905_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915976.1|1138007_1139201_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|1139193_1141353_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 85
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1147331	1148342	5375740		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|1147331_1148342_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 86
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1154056	1155184	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|1154056_1155184_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 87
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1160947	1164418	5375740		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|1160947_1161943_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|1161939_1163361_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|1163656_1164418_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 88
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1185014	1186694	5375740	integrase	Escherichia_phage(100.0%)	2	1182880:1182894	1192668:1192682
1182880:1182894	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
WP_004151951.1|1185014_1185620_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
WP_002916189.1|1186085_1186694_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
1192668:1192682	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 89
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1201167	1205299	5375740		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916277.1|1201167_1202721_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_002916278.1|1203193_1203616_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916279.1|1203625_1204918_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916281.1|1204969_1205299_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 90
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1208377	1209397	5375740		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|1208377_1209397_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 91
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1213365	1221267	5375740	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|1213365_1214079_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_002916298.1|1214395_1214950_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002916299.1|1215184_1216702_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_095858446.1|1216711_1217810_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004151783.1|1217895_1219629_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_002916301.1|1219634_1220348_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|1220370_1221267_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 92
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1225963	1227397	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|1225963_1227397_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 93
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1231972	1234846	5375740		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|1231972_1234846_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 94
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1242789	1244022	5375740		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|1242789_1244022_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 95
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1261275	1262070	5375740		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|1261275_1262070_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 96
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1275825	1276980	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|1275825_1276980_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 97
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1291854	1292937	5375740		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|1291854_1292937_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 98
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1300483	1301464	5375740		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|1300483_1301464_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 99
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1308163	1309699	5375740		Vibrio_phage(100.0%)	4	NA	NA
WP_004152614.1|1308163_1308424_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
WP_004152613.1|1308564_1309020_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004155677.1|1309098_1309344_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152612.1|1309447_1309699_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
>prophage 100
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1320093	1323724	5375740	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_004150873.1|1320093_1321461_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
WP_004150874.1|1321700_1322405_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001118616.1|1322800_1323724_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 101
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1344082	1344838	5375740		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|1344082_1344838_-	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 102
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1351118	1352486	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|1351118_1352486_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 103
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1357375	1358746	5375740		Lactococcus_phage(100.0%)	1	NA	NA
WP_004150913.1|1357375_1358746_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 104
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1378455	1388358	5375740		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002916796.1|1378455_1379283_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004150920.1|1379318_1379846_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916798.1|1379903_1382087_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|1382210_1383623_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|1383706_1384444_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_002916828.1|1384635_1386894_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916831.1|1387015_1387885_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|1387962_1388358_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 105
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1391669	1393565	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|1391669_1393565_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 106
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1397907	1404788	5375740		Erwinia_phage(25.0%)	8	NA	NA
WP_002916849.1|1397907_1398579_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_002916850.1|1398584_1399745_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916851.1|1399789_1400581_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|1400767_1401538_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916855.1|1401599_1402253_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916856.1|1402630_1402903_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|1402938_1403136_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916858.1|1403354_1404788_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 107
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1409899	1411141	5375740	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|1409899_1411141_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 108
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1420434	1434794	5375740	tRNA	Moraxella_phage(20.0%)	13	NA	NA
WP_002916879.1|1420434_1421448_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1421685_1421901_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|1422012_1423758_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|1423976_1425818_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|1425917_1426424_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_002917638.1|1427159_1427432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071531177.1|1427500_1427815_-	HdeB family protein	NA	NA	NA	NA	NA
WP_002917647.1|1428167_1428782_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004150925.1|1428786_1432029_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_004150926.1|1432119_1432761_-	YfdX family protein	NA	NA	NA	NA	NA
WP_002917651.1|1433031_1433607_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_002917655.1|1433633_1433939_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917658.1|1433990_1434794_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 109
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1452872	1454252	5375740		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|1452872_1454252_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 110
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1458523	1460011	5375740		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|1458523_1460011_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 111
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1469574	1470546	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|1469574_1470546_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 112
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1487569	1488715	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|1487569_1488715_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 113
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1504821	1514519	5375740		Escherichia_phage(20.0%)	12	NA	NA
WP_002918124.1|1504821_1505595_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
WP_004160302.1|1505629_1506631_-	Fic family protein	NA	NA	NA	NA	NA
WP_004144878.1|1506634_1507498_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_004160309.1|1507561_1509679_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|1509636_1510023_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|1510048_1510639_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|1510648_1511224_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918216.1|1511345_1512386_-	permease	NA	NA	NA	NA	NA
WP_002918218.1|1512461_1513109_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918221.1|1513237_1513774_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|1513735_1514179_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004152864.1|1514234_1514519_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 114
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1520212	1522144	5375740		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|1520212_1522144_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 115
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1527558	1534177	5375740		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_002918250.1|1527558_1530249_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
WP_002918252.1|1530273_1531761_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918364.1|1531788_1532241_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004144895.1|1532833_1534177_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 116
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1538441	1541318	5375740	protease	Pandoravirus(50.0%)	2	NA	NA
WP_002918371.1|1538441_1539290_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|1539383_1541318_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 117
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1547916	1549358	5375740		Indivirus(50.0%)	2	NA	NA
WP_002918380.1|1547916_1548888_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|1549085_1549358_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 118
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1553407	1566338	5375740		Bacillus_virus(16.67%)	15	NA	NA
WP_004150950.1|1553407_1554220_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
WP_002918397.1|1554429_1555407_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|1555421_1556408_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|1556422_1556989_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|1556985_1557561_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|1557529_1558075_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|1558081_1558807_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|1558854_1560288_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|1560310_1560598_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918425.1|1560668_1561157_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|1561202_1562057_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|1562053_1562326_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918435.1|1562389_1563115_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918442.1|1563111_1563765_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|1563998_1566338_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 119
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1570282	1571215	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|1570282_1571215_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 120
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1578660	1630240	5375740	terminase,tail,capsid,tRNA,integrase,portal,head,protease	uncultured_Caudovirales_phage(68.75%)	57	1614419:1614436	1630414:1630431
WP_002918465.1|1578660_1579155_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|1579158_1579797_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|1580108_1580501_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|1580516_1580945_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|1581210_1582338_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|1582528_1582927_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|1583100_1584468_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|1584555_1585614_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|1585750_1586689_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|1587103_1587574_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|1587949_1588213_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|1588311_1588578_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|1588628_1588904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|1588983_1590951_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|1590956_1591889_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|1591896_1592100_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|1592231_1593161_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|1593196_1594642_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|1594730_1598528_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|1598565_1600035_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|1600037_1600619_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|1600626_1601115_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|1601114_1602107_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|1602177_1603221_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|1603526_1605467_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|1605546_1605738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|1605966_1606968_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|1606967_1607576_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|1607799_1608252_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|1608274_1608742_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|1608752_1610102_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|1610212_1610455_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|1610444_1611896_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|1611907_1612789_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|1613146_1614112_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|1614136_1614433_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
1614419:1614436	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_004150954.1|1614586_1614778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|1614780_1616442_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|1616425_1616782_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|1617057_1617501_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|1617500_1617800_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|1617796_1618132_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|1618128_1619370_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|1619371_1619932_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|1619983_1621150_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|1621413_1621926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|1621974_1622310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|1622652_1624788_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|1624787_1625153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|1625149_1625518_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|1625514_1625829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|1625821_1626010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|1626002_1626272_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|1626723_1627503_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_001547839.1|1627513_1627798_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150970.1|1627979_1628921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150971.1|1629013_1630240_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
1630414:1630431	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
>prophage 121
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1646566	1648038	5375740	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_002919144.1|1646566_1647076_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919147.1|1647090_1648038_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 122
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1667941	1671310	5375740		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|1667941_1669126_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|1669195_1671310_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 123
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1679155	1688799	5375740		Tupanvirus(25.0%)	9	NA	NA
WP_002920148.1|1679155_1681060_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
WP_002920149.1|1681263_1682286_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|1682282_1682501_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|1682537_1683407_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|1683461_1683866_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|1684172_1684805_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004151402.1|1684856_1686935_+	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_002920226.1|1686924_1688145_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002920229.1|1688235_1688799_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 124
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1700200	1701028	5375740		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|1700200_1701028_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 125
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1715851	1719623	5375740		Bacillus_phage(66.67%)	3	NA	NA
WP_002920331.1|1715851_1717474_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
WP_002920333.1|1717551_1718907_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_001157751.1|1718903_1719623_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 126
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1732449	1734840	5375740		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|1732449_1734840_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 127
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1738185	1738944	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|1738185_1738944_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 128
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1742801	1745249	5375740		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|1742801_1745249_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 129
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1762994	1764802	5375740		Enterococcus_phage(50.0%)	2	NA	NA
WP_002920785.1|1762994_1763735_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_002920787.1|1763731_1764802_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 130
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1768228	1770461	5375740		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920800.1|1768228_1768597_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_002920802.1|1768593_1768815_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|1768978_1769692_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920803.1|1769693_1770461_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 131
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1777782	1783583	5375740		Klosneuvirus(25.0%)	5	NA	NA
WP_002920814.1|1777782_1779048_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
WP_004200671.1|1779166_1780690_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|1780742_1781597_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_002920816.1|1781866_1782922_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|1782914_1783583_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 132
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1786667	1790804	5375740		Dickeya_phage(50.0%)	4	NA	NA
WP_002920827.1|1786667_1787294_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004151416.1|1787372_1789583_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920858.1|1789686_1789932_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|1790138_1790804_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 133
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1797104	1801211	5375740		Tupanvirus(66.67%)	3	NA	NA
WP_002921032.1|1797104_1799090_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
WP_002921035.1|1799086_1800070_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|1800071_1801211_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 134
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1807313	1808105	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|1807313_1808105_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 135
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1816646	1818689	5375740		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|1816646_1818689_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 136
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1862418	1868391	5375740		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002921733.1|1862418_1864530_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_002921735.1|1864549_1865341_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_004151436.1|1865342_1865882_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921784.1|1866397_1867411_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|1867407_1868391_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 137
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1872714	1874078	5375740	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|1872714_1874078_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 138
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1880897	1883637	5375740		Streptococcus_phage(50.0%)	2	NA	NA
WP_002921915.1|1880897_1881338_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
WP_004152428.1|1881306_1883637_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 139
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1888796	1889768	5375740		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|1888796_1889768_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 140
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1893171	1895102	5375740		Morganella_phage(50.0%)	2	NA	NA
WP_000014594.1|1893171_1893384_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_004152429.1|1893482_1895102_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
>prophage 141
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1899478	1900474	5375740		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|1899478_1900474_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 142
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1905942	1907484	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|1905942_1907484_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 143
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1915457	1917299	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|1915457_1917299_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 144
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1933136	1942286	5375740		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|1933136_1933388_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|1933492_1933924_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004152046.1|1934169_1935714_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|1935723_1936995_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_002922459.1|1936998_1937946_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922460.1|1937951_1938740_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922461.1|1938908_1939934_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922462.1|1939946_1941140_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922463.1|1941353_1942286_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 145
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1955054	1959796	5375740		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|1955054_1955534_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_002922508.1|1955721_1956531_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922510.1|1956666_1956834_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1956854_1957091_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|1957307_1957973_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002922591.1|1958145_1959360_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_002922593.1|1959340_1959796_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 146
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1963255	1964173	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152982.1|1963255_1964173_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 147
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1969215	1977505	5375740		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_004151500.1|1969215_1970274_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
WP_004151501.1|1970329_1971580_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|1971854_1972472_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002922662.1|1972477_1974154_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922664.1|1974412_1975036_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|1975090_1975366_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004151503.1|1975384_1977505_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 148
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1988486	1989338	5375740		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|1988486_1989338_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 149
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	1992472	1993864	5375740		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|1992472_1993864_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 150
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2007123	2008173	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|2007123_2008173_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 151
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2025433	2026597	5375740		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|2025433_2026597_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 152
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2045032	2046145	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|2045032_2046145_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 153
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2058322	2063761	5375740		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004198592.1|2058322_2060011_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
WP_002923286.1|2060115_2060211_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_002923292.1|2060873_2060963_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923294.1|2061053_2061500_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923296.1|2061567_2062401_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002923297.1|2062576_2063761_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
>prophage 154
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2074770	2076690	5375740		Morganella_phage(33.33%)	3	NA	NA
WP_004151522.1|2074770_2075595_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
WP_004145074.1|2075731_2076160_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|2076276_2076690_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 155
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2080125	2081274	5375740		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|2080125_2081274_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 156
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2087041	2094571	5375740		Bacillus_virus(33.33%)	7	NA	NA
WP_004173845.1|2087041_2089456_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
WP_032441831.1|2089484_2090558_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004151533.1|2090704_2091805_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151534.1|2091809_2093213_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|2093834_2093975_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|2093990_2094350_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|2094313_2094571_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 157
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2102063	2103401	5375740		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|2102063_2103401_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 158
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2109177	2116737	5375740		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|2109177_2109951_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|2109998_2110889_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|2110888_2111848_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|2111976_2113017_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004151549.1|2113353_2115183_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004151550.1|2115366_2116737_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 159
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2129087	2130080	5375740		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|2129087_2130080_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 160
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2133245	2139124	5375740		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|2133245_2135114_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_002882527.1|2135299_2135719_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882529.1|2135729_2137235_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882531.1|2137240_2138206_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|2138233_2139124_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 161
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2153418	2156211	5375740		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|2153418_2156211_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 162
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2160099	2162567	5375740		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|2160099_2161509_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|2161517_2162567_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 163
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2169389	2170307	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|2169389_2170307_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 164
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2193278	2194790	5375740		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004151860.1|2193278_2194790_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 165
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2203128	2206631	5375740		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_002882894.1|2203128_2203749_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_002882896.1|2203821_2204496_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|2204562_2205936_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|2205932_2206631_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 166
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2211133	2212468	5375740		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|2211133_2212468_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 167
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2223532	2225089	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|2223532_2225089_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 168
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2229860	2230523	5375740		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|2229860_2230523_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 169
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2245153	2246992	5375740		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|2245153_2246992_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 170
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2257054	2258701	5375740		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|2257054_2258701_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 171
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2266804	2268826	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004152491.1|2266804_2268826_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 172
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2273317	2275254	5375740		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002883222.1|2273317_2274583_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|2274924_2275254_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 173
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2279304	2285446	5375740		Catovirus(20.0%)	6	NA	NA
WP_002883297.1|2279304_2280435_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_002883302.1|2280431_2281694_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|2281690_2282758_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883307.1|2282776_2283658_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_004146507.1|2283635_2284310_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883310.1|2284315_2285446_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 174
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2301812	2305657	5375740		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002883396.1|2301812_2302715_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_002883397.1|2302714_2303431_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|2303494_2305657_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 175
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2309492	2312954	5375740	transposase	Catovirus(50.0%)	3	NA	NA
WP_004152055.1|2309492_2311319_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_004152056.1|2311380_2312001_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_002883410.1|2312045_2312954_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 176
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2324955	2328299	5375740		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_002883424.1|2324955_2326596_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|2326725_2326977_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883426.1|2326980_2327517_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|2327519_2328299_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 177
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2337017	2337632	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|2337017_2337632_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 178
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2347565	2350686	5375740		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|2347565_2348516_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|2349501_2350686_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 179
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2354913	2367357	5375740		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_004152306.1|2354913_2358942_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|2359018_2363242_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_002884148.1|2363642_2364983_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884149.1|2365025_2365343_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|2365346_2365652_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004171439.1|2365824_2367357_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 180
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2375782	2377546	5375740		Klosneuvirus(50.0%)	3	NA	NA
WP_004152311.1|2375782_2376454_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
WP_002884331.1|2376496_2377087_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|2377273_2377546_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 181
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2382967	2384557	5375740		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|2382967_2384557_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 182
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2398100	2401784	5375740		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|2398100_2401784_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 183
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2408352	2409156	5375740		Moumouvirus(100.0%)	1	NA	NA
WP_002884614.1|2408352_2409156_-	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 184
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2425665	2426775	5375740		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|2425665_2426775_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 185
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2433841	2434450	5375740		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|2433841_2434450_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 186
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2440445	2442972	5375740		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|2440445_2441861_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884943.1|2441892_2442972_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 187
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2446153	2451460	5375740		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004146620.1|2446153_2448979_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|2449230_2449755_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_002885017.1|2449879_2451460_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 188
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2463439	2464471	5375740		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004177837.1|2463439_2464471_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 189
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2472000	2473350	5375740		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|2472000_2473350_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 190
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2485633	2492418	5375740		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002885145.1|2485633_2487592_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
WP_004226113.1|2487692_2487893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146659.1|2488004_2489318_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004151733.1|2489354_2490041_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598858.1|2490270_2492418_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 191
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2498359	2499880	5375740		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|2498359_2499880_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 192
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2505260	2506807	5375740		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|2505260_2505941_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_002885198.1|2506048_2506807_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 193
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2512167	2513670	5375740		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|2512167_2513670_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 194
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2518034	2523121	5375740	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_004146678.1|2518034_2518991_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
WP_004151723.1|2519000_2519372_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_085955125.1|2519537_2520901_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002885324.1|2521069_2521375_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_002885338.1|2521374_2522292_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_004199298.1|2522437_2523121_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 195
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2543028	2548674	5375740		Cronobacter_phage(33.33%)	5	NA	NA
WP_004152420.1|2543028_2543322_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
WP_002885441.1|2543359_2545006_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152419.1|2545266_2545620_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885443.1|2545674_2546538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885444.1|2546550_2548674_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
>prophage 196
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2559853	2565047	5375740		Morganella_phage(33.33%)	6	NA	NA
WP_002885523.1|2559853_2560387_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|2560500_2560860_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885530.1|2560870_2561266_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885531.1|2561276_2562011_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004152023.1|2562003_2563794_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004146714.1|2564069_2565047_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 197
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2572401	2572947	5375740		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|2572401_2572947_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 198
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2577789	2581015	5375740		Vibrio_phage(50.0%)	2	NA	NA
WP_004152021.1|2577789_2579145_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
WP_004152020.1|2579155_2581015_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 199
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2586945	2591289	5375740		Pithovirus(50.0%)	3	NA	NA
WP_002885665.1|2586945_2588244_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|2588394_2588820_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885668.1|2588856_2591289_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
>prophage 200
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2610886	2611711	5375740		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|2610886_2611711_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 201
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2628210	2634789	5375740		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|2628210_2628741_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|2629144_2630101_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886772.1|2630224_2631727_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_004152011.1|2631737_2632763_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886825.1|2632749_2633748_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|2633790_2634789_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 202
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2650922	2654054	5375740		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_002886902.1|2650922_2651207_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
WP_002886903.1|2651210_2651675_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886904.1|2651915_2654054_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 203
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2661811	2667869	5375740		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002886919.1|2661811_2662759_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
WP_004152273.1|2663138_2665847_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_032441834.1|2665919_2666306_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|2666458_2666920_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|2666933_2667869_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 204
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2677962	2687012	5375740	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_002886952.1|2677962_2680818_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
WP_002886953.1|2680817_2681261_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|2681380_2682892_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|2683281_2684379_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|2684378_2685461_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886957.1|2685509_2687012_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 205
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2702903	2707729	5375740		Planktothrix_phage(50.0%)	5	NA	NA
WP_002886975.1|2702903_2703977_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
WP_002886979.1|2703982_2704807_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886980.1|2704817_2705705_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002886983.1|2705694_2706567_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004177639.1|2706709_2707729_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
>prophage 206
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2710811	2712074	5375740	integrase	Stenotrophomonas_phage(100.0%)	1	2709633:2709646	2716740:2716753
2709633:2709646	attL	ATTCCTGCGCCAGC	NA	NA	NA	NA
WP_004152198.1|2710811_2712074_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
WP_004152198.1|2710811_2712074_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
2716740:2716753	attR	ATTCCTGCGCCAGC	NA	NA	NA	NA
>prophage 207
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2715449	2721274	5375740		Enterobacteria_phage(100.0%)	7	NA	NA
WP_004152202.1|2715449_2716016_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|2716033_2716279_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|2716275_2717013_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004153681.1|2717836_2718385_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|2718381_2718609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|2718605_2718926_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|2718940_2721274_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 208
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2742084	2747042	5375740		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002887258.1|2742084_2742813_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|2742929_2743463_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887261.1|2743472_2743820_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887262.1|2743892_2747042_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
>prophage 209
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2750280	2752387	5375740		Bacillus_phage(50.0%)	2	NA	NA
WP_002887273.1|2750280_2750964_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_002887275.1|2750953_2752387_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
>prophage 210
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2762142	2764887	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|2762142_2764887_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 211
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2768803	2770288	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|2768803_2770288_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 212
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2785875	2786802	5375740	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|2785875_2786802_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 213
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2818903	2819926	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|2818903_2819926_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 214
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2826930	2830098	5375740	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_002887612.1|2826930_2827992_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
WP_085955148.1|2827988_2829020_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002887616.1|2829159_2830098_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 215
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2833258	2834538	5375740		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|2833258_2833996_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|2833998_2834538_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 216
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2847761	2850482	5375740		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|2847761_2849351_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|2849570_2850191_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|2850320_2850482_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 217
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2855217	2856540	5375740		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|2855217_2856540_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 218
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2862871	2868031	5375740		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|2862871_2864104_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|2864197_2865865_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887806.1|2866093_2868031_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 219
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2885188	2886142	5375740		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|2885188_2886142_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 220
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2890513	2900466	5375740	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|2890513_2892430_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|2892517_2893651_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_002887958.1|2893828_2895004_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887961.1|2895058_2895955_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|2896074_2896338_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|2896667_2897606_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887972.1|2897649_2900466_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
>prophage 221
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2919263	2920412	5375740		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|2919263_2920412_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 222
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2926753	2928337	5375740		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|2926753_2927233_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_002888321.1|2927488_2928337_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 223
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2940795	2946247	5375740		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004151368.1|2940795_2943702_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_002888349.1|2943889_2946247_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
>prophage 224
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2952543	2953245	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|2952543_2953245_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 225
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2961944	2962700	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|2961944_2962700_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 226
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	2974099	2975824	5375740		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|2974099_2975824_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 227
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3002016	3003060	5375740		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|3002016_3003060_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 228
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3007327	3007891	5375740		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|3007327_3007891_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 229
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3019231	3020656	5375740		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|3019231_3020656_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 230
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3030305	3040183	5375740	transposase	Shigella_phage(25.0%)	9	NA	NA
WP_085955245.1|3030305_3031498_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004151949.1|3031546_3032389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888804.1|3032385_3032796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888808.1|3033043_3033391_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888811.1|3033536_3035135_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888816.1|3035218_3037609_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888819.1|3037813_3038350_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|3038409_3039072_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|3039256_3040183_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 231
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3045587	3052358	5375740	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|3045587_3046982_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_004145903.1|3047044_3047926_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|3047985_3048441_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|3048603_3049320_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004145901.1|3049319_3049856_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004151944.1|3049928_3052358_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 232
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3074493	3075291	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|3074493_3075291_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 233
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3081257	3081602	5375740		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|3081257_3081602_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 234
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3085557	3086991	5375740	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|3085557_3086991_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 235
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3098569	3099328	5375740		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|3098569_3099328_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 236
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3108159	3112259	5375740		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002889376.1|3108159_3108759_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_002889378.1|3108776_3112259_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
>prophage 237
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3125243	3126275	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|3125243_3126275_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 238
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3132787	3133591	5375740		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|3132787_3133591_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 239
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3137656	3141866	5375740		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|3137656_3139024_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004152035.1|3139095_3139851_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889685.1|3139883_3140606_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|3140602_3141070_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004152034.1|3141134_3141866_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 240
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3147374	3147956	5375740		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|3147374_3147956_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 241
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3165214	3166498	5375740		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|3165214_3166498_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 242
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3174031	3175027	5375740		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|3174031_3175027_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 243
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3179674	3181072	5375740		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|3179674_3181072_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 244
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3189528	3202524	5375740	integrase	Enterobacteria_phage(72.73%)	14	3177662:3177676	3200719:3200733
3177662:3177676	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|3189528_3191862_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|3191873_3192194_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|3192190_3192418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|3192414_3192972_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|3192968_3193235_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|3193776_3194514_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|3194510_3194756_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|3194773_3195340_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|3195908_3196334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|3196333_3197284_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|3197271_3198462_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|3198814_3200068_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|3200078_3201182_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
3200719:3200733	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_004144576.1|3201471_3202524_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 245
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3209368	3210211	5375740		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|3209368_3210211_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 246
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3219284	3223005	5375740		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151355.1|3219284_3220103_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
WP_002890106.1|3220104_3220914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002890108.1|3221247_3221418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002890126.1|3221534_3222230_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_004151354.1|3222222_3223005_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 247
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3234008	3234776	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|3234008_3234776_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 248
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3255259	3263779	5375740		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|3255259_3256171_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_002890286.1|3256262_3257177_+	fructokinase	NA	NA	NA	NA	NA
WP_004151346.1|3257250_3260388_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890342.1|3260384_3261590_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|3261772_3262462_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|3262483_3263779_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 249
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3280584	3284923	5375740	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|3280584_3281712_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|3281734_3282067_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|3282093_3283941_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|3283951_3284923_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 250
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3288521	3293181	5375740		Indivirus(33.33%)	6	NA	NA
WP_002890420.1|3288521_3289625_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
WP_001021161.1|3289712_3290183_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|3290202_3290622_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002891357.1|3290693_3291665_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004191729.1|3291657_3292161_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891359.1|3292206_3293181_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
>prophage 251
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3305966	3307664	5375740		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|3305966_3307664_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 252
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3321970	3327139	5375740	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|3321970_3322594_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|3322844_3324119_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|3324302_3326657_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|3326866_3327139_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 253
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3330369	3331071	5375740		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|3330369_3331071_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 254
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3335496	3339040	5375740		Bacillus_phage(100.0%)	2	NA	NA
WP_002891876.1|3335496_3337269_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
WP_002891880.1|3337261_3339040_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 255
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3349962	3351072	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_002891989.1|3349962_3351072_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 256
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3360246	3369637	5375740		Enterobacteria_phage(33.33%)	10	NA	NA
WP_002892007.1|3360246_3361317_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|3361432_3361696_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|3361695_3361836_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|3361832_3362531_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892023.1|3362631_3364083_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|3364057_3364528_-	membrane protein	NA	NA	NA	NA	NA
WP_002892030.1|3364660_3365227_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|3365385_3365604_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|3365630_3366005_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892069.1|3366490_3369637_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 257
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3375159	3382970	5375740	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_002892131.1|3375159_3376059_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
WP_002892136.1|3376126_3376300_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892142.1|3376312_3376840_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892144.1|3376909_3377287_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892145.1|3377437_3377989_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_004151328.1|3378081_3379989_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892173.1|3380046_3380379_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002892177.1|3380378_3380984_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892181.1|3381095_3382970_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
>prophage 258
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3393115	3398321	5375740		uncultured_virus(50.0%)	5	NA	NA
WP_004151326.1|3393115_3395617_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
WP_002892208.1|3395723_3396134_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004151325.1|3396130_3396589_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|3396585_3397503_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002892260.1|3397643_3398321_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
>prophage 259
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3401503	3402190	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|3401503_3402190_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 260
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3410735	3456010	5375740	lysis,tRNA,integrase,head	Escherichia_phage(26.42%)	63	3413618:3413664	3462752:3462798
WP_004143010.1|3410735_3412121_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|3412166_3412379_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|3412380_3413247_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3413618:3413664	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|3413677_3414841_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|3414717_3415053_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|3415054_3415270_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|3415271_3415490_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|3415486_3416254_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|3416250_3416907_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|3416903_3417062_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|3417058_3417739_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|3417735_3418581_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|3418596_3418881_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|3418969_3419164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|3419263_3419479_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|3419829_3420519_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|3420646_3420880_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|3420920_3421142_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|3421366_3422266_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|3422255_3423686_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|3423685_3423979_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|3423975_3424482_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|3424588_3425431_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|3425603_3426251_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|3426751_3427207_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|3427206_3427377_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|3427369_3428005_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|3428001_3428139_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|3428131_3428662_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|3428658_3429348_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|3430257_3430506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|3430508_3431039_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|3431035_3431500_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|3431605_3431935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|3432305_3432908_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|3432907_3434380_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|3434392_3435814_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|3435788_3436793_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|3436834_3437311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|3437383_3438769_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|3438772_3439201_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|3439212_3440307_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|3440317_3440557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|3440559_3440940_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|3440939_3441113_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|3441112_3441475_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|3441477_3441903_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|3441899_3442292_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|3442360_3443113_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|3443165_3443843_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|3444018_3444774_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|3444776_3445031_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|3445324_3445795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|3445811_3446171_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|3446270_3446441_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|3446430_3447144_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|3447209_3447995_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|3448122_3448626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|3448718_3452165_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|3452264_3452684_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|3452683_3453154_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|3453150_3453546_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|3453532_3456010_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
3462752:3462798	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 261
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3460477	3462596	5375740		Pseudomonas_phage(33.33%)	3	NA	NA
WP_022644740.1|3460477_3461962_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151791.1|3462039_3462279_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
WP_002892355.1|3462278_3462596_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
>prophage 262
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3474069	3474990	5375740		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|3474069_3474990_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 263
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3481213	3484538	5375740	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_004151795.1|3481213_3482689_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892491.1|3483020_3484538_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 264
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3489016	3490380	5375740	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3489016_3490380_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 265
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3494227	3500028	5375740		Amsacta_moorei_entomopoxvirus(50.0%)	5	NA	NA
WP_004142660.1|3494227_3495712_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
WP_002892599.1|3495722_3496754_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151798.1|3496937_3497546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151799.1|3497593_3498598_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004199626.1|3498627_3500028_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
>prophage 266
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3506650	3507448	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|3506650_3507448_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 267
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3522230	3523346	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|3522230_3523346_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 268
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3566248	3568963	5375740		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004151826.1|3566248_3568963_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 269
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3573496	3574859	5375740	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3573496_3574859_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 270
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3579366	3584046	5375740		Streptococcus_phage(50.0%)	5	NA	NA
WP_032441862.1|3579366_3580830_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
WP_002893184.1|3581071_3581923_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893187.1|3581970_3582612_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893189.1|3582626_3583292_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151676.1|3583284_3584046_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
>prophage 271
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3587116	3588644	5375740		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151674.1|3587116_3587821_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
WP_004151673.1|3587807_3588644_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
>prophage 272
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3593201	3599115	5375740	holin	Catovirus(50.0%)	4	NA	NA
WP_004142489.1|3593201_3594866_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_002893471.1|3594879_3596352_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004151671.1|3596365_3596953_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004142478.1|3597081_3599115_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 273
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3605818	3607363	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002893593.1|3605818_3607363_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 274
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3618755	3623496	5375740		Tupanvirus(50.0%)	2	NA	NA
WP_004151663.1|3618755_3622637_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
WP_002893737.1|3622701_3623496_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 275
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3635838	3640259	5375740		Burkholderia_phage(50.0%)	5	NA	NA
WP_002893905.1|3635838_3636243_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
WP_002893907.1|3636217_3636520_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893908.1|3636703_3637447_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004151660.1|3637504_3638593_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004151659.1|3638756_3640259_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 276
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3657370	3671085	5375740		Cedratvirus(20.0%)	12	NA	NA
WP_002894255.1|3657370_3658399_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
WP_002894256.1|3658441_3659383_-	sugar kinase	NA	NA	NA	NA	NA
WP_002894258.1|3659394_3660399_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147555.1|3660395_3661385_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894349.1|3661381_3662932_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
WP_002894353.1|3662928_3663909_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151652.1|3664317_3666627_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894357.1|3666734_3667277_-	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_002894359.1|3667273_3667963_-	acireductone synthase	NA	NA	NA	NA	NA
WP_002894362.1|3668089_3669250_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004151651.1|3669250_3669877_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_002894369.1|3669861_3671085_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
>prophage 277
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3674220	3676291	5375740		Bacillus_virus(50.0%)	2	NA	NA
WP_002894398.1|3674220_3675786_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894401.1|3675862_3676291_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 278
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3680381	3681042	5375740		Morganella_phage(50.0%)	2	NA	NA
WP_002439184.1|3680381_3680591_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
WP_002894459.1|3680658_3681042_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 279
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3685920	3688407	5375740		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002894539.1|3685920_3687120_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
WP_004147579.1|3687258_3688407_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 280
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3695451	3703417	5375740	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_002894696.1|3695451_3698034_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
WP_002894699.1|3698260_3698743_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_032441865.1|3698788_3700582_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.0	5.6e-28
WP_002894704.1|3700647_3702318_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894706.1|3702691_3703417_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 281
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3709421	3710468	5375740		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|3709421_3710468_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 282
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3714508	3716173	5375740		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|3714508_3716173_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 283
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3720926	3724728	5375740	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_004147599.1|3720926_3722882_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
WP_002894753.1|3723060_3724728_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 284
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3729416	3730190	5375740		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|3729416_3730190_-	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 285
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3737016	3744446	5375740		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004152227.1|3737016_3739065_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
WP_004152226.1|3739085_3740765_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020323459.1|3740764_3740854_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_002894847.1|3741163_3741370_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_004152225.1|3741553_3742996_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_004199663.1|3742967_3744446_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	6.5e-46
>prophage 286
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3750255	3751047	5375740		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|3750255_3751047_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 287
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3775370	3778881	5375740		Vibriophage(33.33%)	4	NA	NA
WP_004151689.1|3775370_3776090_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
WP_004147641.1|3776086_3777031_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_002895084.1|3777148_3777514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895086.1|3777828_3778881_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 288
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3783242	3789765	5375740		Tupanvirus(33.33%)	7	NA	NA
WP_002895150.1|3783242_3784259_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
WP_002895152.1|3784468_3785941_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895154.1|3786008_3786797_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895156.1|3786949_3787099_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004151692.1|3787241_3788015_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895159.1|3788014_3788704_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002895161.1|3788706_3789765_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 289
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3805438	3811061	5375740		Catovirus(50.0%)	4	NA	NA
WP_002895420.1|3805438_3806965_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
WP_004147672.1|3807063_3808446_+	amino acid permease	NA	NA	NA	NA	NA
WP_002895575.1|3809224_3809701_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_002895578.1|3809771_3811061_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 290
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3814864	3815587	5375740		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|3814864_3815587_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 291
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3822084	3822990	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|3822084_3822990_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 292
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3833157	3834897	5375740		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|3833157_3834897_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 293
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3840102	3848037	5375740		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_002895753.1|3840102_3840948_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
WP_002895757.1|3840947_3841940_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004151702.1|3842154_3843510_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_032441868.1|3843697_3845836_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	1.9e-43
WP_002895821.1|3845865_3846834_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895822.1|3846943_3847204_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895824.1|3847489_3847756_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176771.1|3847776_3848037_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 294
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3852111	3857263	5375740		Planktothrix_phage(33.33%)	6	NA	NA
WP_004142040.1|3852111_3852834_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
WP_002895837.1|3852830_3853490_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002895839.1|3853615_3854362_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895841.1|3854770_3855274_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895842.1|3855511_3856399_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895845.1|3856750_3857263_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 295
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3861264	3862641	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|3861264_3862641_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 296
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3865650	3867243	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|3865650_3867243_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 297
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3875222	3877655	5375740		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|3875222_3877655_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 298
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3881898	3883758	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|3881898_3883758_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 299
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3895463	3897463	5375740		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004151716.1|3895463_3896666_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
WP_004151717.1|3896704_3897463_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 300
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3902538	3954024	5375740	plate,terminase,capsid,tail,integrase,portal,lysis,head	Salmonella_phage(73.33%)	60	3902446:3902464	3939946:3939964
3902446:3902464	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|3902538_3903591_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|3904009_3905494_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|3905592_3906537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3906548_3907427_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|3907572_3907794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3907826_3908336_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|3908343_3908544_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|3908507_3908849_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|3908916_3909150_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|3909149_3909377_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|3909373_3910231_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|3910227_3912642_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|3912795_3912984_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|3912994_3913228_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|3913342_3914020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|3914295_3916038_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|3916099_3917125_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|3917124_3918891_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|3919033_3919867_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|3919883_3920942_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|3920945_3921596_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|3921691_3922156_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|3922155_3922359_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|3922362_3922578_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|3922558_3923068_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|3923072_3923456_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|3923452_3923881_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|3923976_3924408_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|3924400_3924847_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|3924843_3925536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|3925630_3926203_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|3926199_3926562_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|3926548_3927457_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|3927449_3928049_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|3928050_3931002_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|3931005_3931737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|3931733_3931937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|3931966_3933043_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|3933181_3934354_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|3934363_3934879_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|3934931_3935231_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|3935245_3935365_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|3935357_3937985_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|3937981_3938467_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|3938463_3939564_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|3939655_3939874_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|3940093_3941779_-	transporter	NA	NA	NA	NA	NA
3939946:3939964	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|3942045_3942429_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|3942435_3942699_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|3942901_3943189_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|3944010_3944913_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|3945001_3945481_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|3945829_3946942_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|3947105_3948239_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|3948249_3949203_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|3949199_3950045_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|3950102_3950591_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|3950632_3951760_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|3951838_3952555_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|3952551_3954024_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 301
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3957124	3961474	5375740		Planktothrix_phage(50.0%)	4	NA	NA
WP_002896392.1|3957124_3957853_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|3958079_3958595_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|3959472_3960612_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|3960643_3961474_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 302
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	3974290	4004421	5375740	tRNA,protease	uncultured_Mediterranean_phage(13.33%)	22	NA	NA
WP_002896440.1|3974290_3975406_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3975402_3977343_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3977419_3977641_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3977966_3978284_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3978314_3980594_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3980714_3980933_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3981286_3981988_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|3982032_3983754_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898017.1|3983754_3985521_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004141839.1|3985635_3986631_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_000228469.1|3987136_3987631_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004150846.1|3987766_3992020_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_002898132.1|3992142_3992754_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002898137.1|3992762_3994106_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898139.1|3994196_3995489_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898141.1|3995689_3998128_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_004150845.1|3998138_3998756_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004150844.1|3998757_3999621_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004147798.1|3999632_3999779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150843.1|3999895_4001044_+	MFS transporter	NA	NA	NA	NA	NA
WP_002898145.1|4001206_4001947_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_002898148.1|4002138_4004421_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 303
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4008471	4009560	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|4008471_4009560_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 304
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4013733	4018276	5375740		Bacillus_phage(100.0%)	3	NA	NA
WP_002898165.1|4013733_4014021_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
WP_002898168.1|4014226_4016491_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002898170.1|4016527_4018276_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 305
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4037315	4038716	5375740	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
WP_002898206.1|4037315_4038716_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 306
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4044778	4049901	5375740		Agrobacterium_phage(33.33%)	3	NA	NA
WP_002898217.1|4044778_4045981_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
WP_002898220.1|4046307_4048923_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_004150838.1|4049127_4049901_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 307
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4058667	4060575	5375740		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|4058667_4060575_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 308
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4073267	4075322	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|4073267_4075322_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 309
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4080264	4080924	5375740	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|4080264_4080924_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 310
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4105062	4108581	5375740		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898708.1|4105062_4105236_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_004199515.1|4105397_4106336_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002898810.1|4106742_4108065_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_002898812.1|4108086_4108581_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 311
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4125145	4126204	5375740		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|4125145_4126204_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 312
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4134305	4134833	5375740		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|4134305_4134833_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 313
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4143184	4144105	5375740		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|4143184_4144105_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 314
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4147346	4147598	5375740		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|4147346_4147598_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 315
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4166753	4167935	5375740		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002899294.1|4166753_4167488_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|4167698_4167935_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 316
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4171214	4171856	5375740		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|4171214_4171856_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 317
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4191580	4197646	5375740		Planktothrix_phage(33.33%)	6	NA	NA
WP_002900798.1|4191580_4192282_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
WP_002900801.1|4192281_4193526_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004150816.1|4193574_4194486_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176563.1|4194500_4195331_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_002900906.1|4195421_4195766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150815.1|4196017_4197646_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
>prophage 318
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4202078	4203215	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|4202078_4203215_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 319
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4209780	4211151	5375740		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004150804.1|4209780_4211151_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 320
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4214379	4215630	5375740		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|4214379_4215630_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 321
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4230240	4232025	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004150787.1|4230240_4232025_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 322
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4235314	4238900	5375740		Morganella_phage(50.0%)	7	NA	NA
WP_004148038.1|4235314_4236229_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|4236318_4236957_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|4237087_4237351_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|4237410_4237536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|4237653_4237728_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|4237727_4237829_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|4237886_4238900_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
>prophage 323
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4245829	4257263	5375740		Klebsiella_phage(14.29%)	12	NA	NA
WP_002901096.1|4245829_4246072_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004152765.1|4246689_4248174_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901192.1|4248252_4248672_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152360.1|4248674_4249940_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_004140447.1|4249946_4250852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901225.1|4251018_4251768_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004152361.1|4251764_4252982_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152362.1|4253157_4254039_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901229.1|4254296_4254608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|4254729_4255212_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901231.1|4255370_4255934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|4255979_4257263_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 324
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4260537	4261392	5375740		Indivirus(100.0%)	1	NA	NA
WP_002901238.1|4260537_4261392_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
>prophage 325
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4265076	4266330	5375740		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|4265076_4266330_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 326
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4272022	4276081	5375740		Staphylococcus_phage(50.0%)	4	NA	NA
WP_002901272.1|4272022_4273006_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
WP_002901274.1|4273143_4273902_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901278.1|4274043_4275402_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901282.1|4275439_4276081_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
>prophage 327
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4279955	4285969	5375740	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955203.1|4279955_4281318_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002901387.1|4282002_4282749_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002901388.1|4282974_4284018_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901390.1|4284022_4285969_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 328
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4291271	4291904	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|4291271_4291904_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 329
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4297961	4299182	5375740		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|4297961_4299182_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 330
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4305865	4306693	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|4305865_4306693_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 331
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4312957	4318691	5375740		Tupanvirus(50.0%)	5	NA	NA
WP_002901554.1|4312957_4315216_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
WP_004140343.1|4315328_4315661_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004151918.1|4315720_4317112_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002901611.1|4317247_4317838_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002901621.1|4317929_4318691_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 332
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4325985	4326663	5375740		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|4325985_4326663_-	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 333
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4338907	4341865	5375740		Acinetobacter_phage(100.0%)	2	NA	NA
WP_002901733.1|4338907_4340266_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_004148109.1|4340269_4341865_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 334
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4348984	4354350	5375740	protease	Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_002901754.1|4348984_4349746_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
WP_004148112.1|4349740_4349956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901758.1|4350000_4351047_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|4351094_4351346_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|4351752_4354350_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 335
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4359190	4359793	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|4359190_4359793_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 336
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4365383	4367318	5375740		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|4365383_4367318_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 337
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4371949	4373753	5375740		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004140269.1|4371949_4372759_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|4372760_4373753_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
>prophage 338
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4404427	4448103	5375740	integrase,transposase,terminase	uncultured_Caudovirales_phage(33.33%)	63	4405436:4405450	4414376:4414390
WP_004152141.1|4404427_4405297_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218009.1|4405321_4405459_-	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
4405436:4405450	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152142.1|4405464_4405773_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004176439.1|4405843_4406032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|4406332_4407247_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|4407355_4408117_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|4408333_4409866_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|4410064_4410613_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|4410809_4411991_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|4411971_4412214_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|4412392_4412872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|4412868_4413081_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|4413077_4413302_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|4413291_4414002_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|4414007_4414526_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
4414376:4414390	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|4414630_4415458_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|4415454_4415649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|4415645_4416071_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|4416067_4416286_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|4416257_4416512_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|4416504_4416870_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|4417039_4417228_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|4417220_4417535_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|4417705_4418374_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|4418471_4418693_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|4419269_4420928_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|4420929_4421892_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|4421888_4422365_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|4422361_4423144_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|4423549_4423798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|4423800_4424331_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|4424327_4424717_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|4424951_4425272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|4425373_4426126_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|4426076_4427477_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_001567369.1|4427737_4428370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|4428398_4429802_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_004152173.1|4429997_4431449_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|4431504_4432053_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|4432104_4433307_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|4433310_4433805_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|4433816_4434758_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|4434797_4435079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|4435047_4435467_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|4435463_4435970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|4435969_4436356_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|4436450_4436891_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|4436894_4438040_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|4438050_4438491_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|4438494_4438920_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|4438955_4439108_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|4439097_4441101_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|4441100_4441700_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|4441700_4442003_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|4442005_4443028_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_032441788.1|4443020_4443368_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	4.7e-24
WP_004199301.1|4443417_4443600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441789.1|4443642_4444209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|4444262_4444916_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|4444917_4445271_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|4445270_4446467_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|4446463_4447237_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|4447236_4448103_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 339
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4452938	4453187	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002902136.1|4452938_4453187_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
>prophage 340
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4460613	4465639	5375740		Cronobacter_phage(50.0%)	2	NA	NA
WP_002902163.1|4460613_4463268_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902166.1|4463260_4465639_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
>prophage 341
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4494565	4495579	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|4494565_4495579_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 342
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4503186	4510333	5375740	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902419.1|4503186_4503930_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
WP_004148192.1|4504209_4505193_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|4505718_4507092_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|4507137_4508073_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_002902424.1|4508306_4508732_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902432.1|4508822_4509035_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902433.1|4509178_4510333_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 343
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4515451	4516441	5375740		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|4515451_4516441_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 344
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4542621	4547259	5375740		Catovirus(50.0%)	2	NA	NA
WP_004198150.1|4542621_4546524_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
WP_004151576.1|4546584_4547259_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 345
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4555945	4557151	5375740		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|4555945_4557151_+	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 346
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4569326	4572854	5375740		Enterobacteria_phage(50.0%)	6	NA	NA
WP_002903231.1|4569326_4569719_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
WP_002903233.1|4569969_4570203_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903234.1|4570199_4571408_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903236.1|4571511_4571865_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002903238.1|4572062_4572581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151566.1|4572650_4572854_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 347
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4585674	4586976	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|4585674_4586976_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 348
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4598219	4598735	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|4598219_4598735_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 349
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4618080	4620858	5375740		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|4618080_4620858_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 350
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4630301	4631261	5375740		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|4630301_4631261_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 351
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4648385	4650512	5375740		Escherichia_phage(100.0%)	3	NA	NA
WP_004152236.1|4648385_4648994_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
WP_002903710.1|4649035_4649893_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152235.1|4649894_4650512_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 352
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4655307	4659444	5375740		uncultured_virus(33.33%)	4	NA	NA
WP_002903722.1|4655307_4655634_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_002903724.1|4655747_4657031_+	MFS transporter	NA	NA	NA	NA	NA
WP_002903726.1|4657284_4658748_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903728.1|4659012_4659444_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
>prophage 353
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4664582	4665257	5375740		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|4664582_4665257_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 354
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4674400	4690295	5375740		Escherichia_phage(70.0%)	15	NA	NA
WP_002210516.1|4674400_4675021_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|4675013_4676279_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|4676290_4677193_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|4677453_4678215_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|4678235_4679096_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|4679393_4679654_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|4679740_4680829_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|4680859_4682125_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|4682179_4685287_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151614.1|4685483_4686548_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_002904139.1|4686802_4687243_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004205985.1|4687295_4687511_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004198831.1|4687479_4688577_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_002904247.1|4688644_4689043_+	rhodanese	NA	NA	NA	NA	NA
WP_002904248.1|4689191_4690295_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 355
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4694446	4695952	5375740		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_002904321.1|4694446_4695244_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
WP_004151618.1|4695253_4695952_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
>prophage 356
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4699198	4699573	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|4699198_4699573_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 357
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4711521	4712283	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|4711521_4712283_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 358
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4717730	4719104	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_085666577.1|4717730_4719104_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 359
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4732138	4732930	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004176216.1|4732138_4732930_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 360
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4743423	4744803	5375740		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004199850.1|4743423_4744803_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	9.1e-18
>prophage 361
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4770582	4771758	5375740		Streptococcus_phage(100.0%)	1	NA	NA
WP_004199865.1|4770582_4771758_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 362
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4779120	4780677	5375740		Catovirus(100.0%)	1	NA	NA
WP_004199868.1|4779120_4780677_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 363
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4787957	4788731	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|4787957_4788731_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 364
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4803304	4803823	5375740		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004199889.1|4803304_4803823_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	38.2	3.4e-26
>prophage 365
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4810348	4811611	5375740	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_000608644.1|4810348_4811611_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 366
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4819787	4820570	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002904975.1|4819787_4820570_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 367
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4833146	4837362	5375740	transposase	Escherichia_phage(50.0%)	5	NA	NA
WP_001118616.1|4833146_4834070_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_087758678.1|4834095_4835346_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_004176134.1|4835376_4835643_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004199922.1|4835654_4836092_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_004151868.1|4836309_4837362_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 368
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4852940	4853678	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_004143660.1|4852940_4853678_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
>prophage 369
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4881432	4882689	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_014343088.1|4881432_4882689_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.5e-19
>prophage 370
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4888635	4892753	5375740		Pithovirus(50.0%)	4	NA	NA
WP_004180001.1|4888635_4889364_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	3.7e-18
WP_004143673.1|4889360_4890101_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199983.1|4890125_4891061_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004199985.1|4891367_4892753_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 371
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4896733	4898814	5375740		Bacillus_phage(100.0%)	2	NA	NA
WP_014343090.1|4896733_4898077_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.8e-10
WP_004199992.1|4898073_4898814_-	response regulator	NA	W8CYM9	Bacillus_phage	37.6	8.5e-31
>prophage 372
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4915336	4916017	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|4915336_4916017_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 373
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4922180	4924793	5375740		Rathayibacter_phage(100.0%)	1	NA	NA
WP_014343099.1|4922180_4924793_-	family 78 glycoside hydrolase catalytic domain	NA	A0A1P8VV88	Rathayibacter_phage	21.5	2.4e-11
>prophage 374
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4934820	4935225	5375740		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|4934820_4935225_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 375
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4940042	4942379	5375740		Mycobacterium_phage(50.0%)	3	NA	NA
WP_004143717.1|4940042_4940258_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
WP_004143718.1|4940623_4940809_-	general stress protein	NA	NA	NA	NA	NA
WP_020953426.1|4941506_4942379_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 376
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4948867	4953610	5375740		Tupanvirus(66.67%)	4	NA	NA
WP_004200033.1|4948867_4950583_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	4.7e-32
WP_019725529.1|4950619_4951573_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906218.1|4951747_4952347_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_002906221.1|4952599_4953610_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 377
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4957198	4958815	5375740		Planktothrix_phage(100.0%)	1	NA	NA
WP_004200039.1|4957198_4958815_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	2.5e-19
>prophage 378
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4970086	4970860	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_025862058.1|4970086_4970860_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 379
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4977339	4978839	5375740		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|4977339_4978839_-	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 380
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4984946	4986491	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_004200061.1|4984946_4986491_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 381
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	4992133	4992835	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004200066.1|4992133_4992835_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	9.6e-32
>prophage 382
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5002274	5003054	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004200076.1|5002274_5003054_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 383
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5008992	5009544	5375740		Leuconostoc_phage(100.0%)	1	NA	NA
WP_004200078.1|5008992_5009544_-	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 384
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5014124	5016215	5375740		Salmonella_phage(100.0%)	1	NA	NA
WP_085706575.1|5014124_5016215_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 385
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5031903	5032917	5375740		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004200094.1|5031903_5032917_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 386
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5039825	5041787	5375740		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|5039825_5041787_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 387
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5052219	5054860	5375740		Moumouvirus(100.0%)	2	NA	NA
WP_004200104.1|5052219_5053308_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	9.1e-05
WP_004200105.1|5053354_5054860_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.5	2.5e-29
>prophage 388
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5061685	5063737	5375740		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_004189749.1|5061685_5062804_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	1.8e-32
WP_002907563.1|5062828_5063104_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907640.1|5063209_5063737_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 389
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5069288	5070659	5375740		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|5069288_5070659_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 390
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5081914	5083189	5375740	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|5081914_5083189_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 391
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5086525	5087887	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004200121.1|5086525_5087887_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 392
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5091693	5093181	5375740		Salmonella_phage(50.0%)	2	NA	NA
WP_004184268.1|5091693_5092215_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
WP_004200125.1|5092284_5093181_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
>prophage 393
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5097368	5098241	5375740		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|5097368_5098241_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 394
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5101512	5112554	5375740		Enterobacteria_phage(20.0%)	11	NA	NA
WP_087758680.1|5101512_5102538_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.6	2.2e-29
WP_002907780.1|5102464_5103469_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907785.1|5103581_5104763_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907788.1|5105055_5106204_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_004200129.1|5106240_5106876_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
WP_004200136.1|5107105_5108479_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_004200137.1|5108654_5109062_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004200138.1|5109201_5109780_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_072769241.1|5110459_5110687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065928302.1|5110683_5111145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180176.1|5111669_5112554_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 395
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5118028	5118799	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|5118028_5118799_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 396
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5123983	5125932	5375740		Bacillus_virus(50.0%)	2	NA	NA
WP_004200151.1|5123983_5124964_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	9.0e-12
WP_004200153.1|5124960_5125932_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	2.4e-09
>prophage 397
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5143241	5144072	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004180245.1|5143241_5144072_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 398
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5161403	5167048	5375740		Leptospira_phage(50.0%)	3	NA	NA
WP_004200176.1|5161403_5164520_-	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.4	1.2e-54
WP_017896248.1|5164557_5165442_-	membrane protein	NA	NA	NA	NA	NA
WP_004151175.1|5166343_5167048_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
>prophage 399
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5179837	5180461	5375740		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004200196.1|5179837_5180461_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	4.0e-05
>prophage 400
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5185318	5186389	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_087758682.1|5185318_5186389_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 401
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5205914	5210315	5375740		Planktothrix_phage(50.0%)	3	NA	NA
WP_004200218.1|5205914_5206736_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	6.6e-16
WP_004200219.1|5207241_5209314_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002908439.1|5209541_5210315_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 402
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5220965	5222929	5375740		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004200233.1|5220965_5221982_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.3e-41
WP_004200234.1|5221978_5222929_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
>prophage 403
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5230366	5231116	5375740		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004200241.1|5230366_5231116_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	2.8e-05
>prophage 404
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5241036	5242257	5375740		environmental_halophage(100.0%)	1	NA	NA
WP_002908867.1|5241036_5242257_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 405
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5258748	5259510	5375740		Indivirus(100.0%)	1	NA	NA
WP_004200259.1|5258748_5259510_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.8e-15
>prophage 406
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5269489	5277456	5375740		Hokovirus(25.0%)	7	NA	NA
WP_002909055.1|5269489_5271868_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
WP_002909061.1|5272207_5273041_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909064.1|5273195_5274242_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909070.1|5274349_5274577_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_004184566.1|5274606_5276049_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	2.0e-55
WP_002909082.1|5276162_5276627_-	lipoprotein	NA	NA	NA	NA	NA
WP_004200263.1|5276706_5277456_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	8.4e-10
>prophage 407
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5284524	5291693	5375740	tRNA	Geobacillus_virus(25.0%)	8	NA	NA
WP_002909098.1|5284524_5284824_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_002909101.1|5284828_5287216_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909105.1|5287231_5288215_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|5288353_5288398_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|5288521_5288878_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|5288928_5289126_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|5289218_5289761_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_002910026.1|5289764_5291693_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 408
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5301368	5304266	5375740		Lactobacillus_phage(33.33%)	3	NA	NA
WP_002910080.1|5301368_5302196_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
WP_002910083.1|5302251_5303256_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_004200274.1|5303252_5304266_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 409
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5312525	5318795	5375740		Citrobacter_phage(25.0%)	7	NA	NA
WP_087758683.1|5312525_5313143_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	3.0e-53
WP_002910103.1|5313704_5314112_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910105.1|5314233_5315136_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_004175574.1|5315333_5316347_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910108.1|5316436_5317339_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910109.1|5317451_5317910_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004151854.1|5317952_5318795_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 410
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5322808	5324344	5375740		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|5322808_5324344_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 411
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5340837	5341626	5375740		Bacillus_virus(100.0%)	1	NA	NA
WP_004200289.1|5340837_5341626_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 412
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5347138	5352852	5375740		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_002910389.1|5347138_5347369_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
WP_002910392.1|5347632_5348733_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910393.1|5348819_5349674_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910395.1|5349713_5350526_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004145428.1|5350529_5350922_-	SirB family protein	NA	NA	NA	NA	NA
WP_004180387.1|5350921_5351770_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|5351769_5352852_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 413
NZ_CP021685	Klebsiella pneumoniae strain AR_0146, complete genome	5375740	5356064	5358816	5375740		Tupanvirus(50.0%)	2	NA	NA
WP_002910407.1|5356064_5357012_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|5357136_5358816_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
>prophage 1
NZ_CP021686	Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence	183376	47026	115807	183376	integrase,transposase	uncultured_Caudovirales_phage(23.81%)	60	38769:38783	58796:58810
38769:38783	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|47026_47767_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|48910_49858_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|49884_50196_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|50260_51184_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|51856_52114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|52733_54170_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004200923.1|55152_56430_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|56492_58490_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|59529_60737_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
58796:58810	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|62165_62597_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|62847_64323_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|64315_64996_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|65185_66571_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|66599_66953_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|67066_68359_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_087758684.1|68369_71516_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	8.9e-61
WP_000758228.1|71602_72043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|72169_74617_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|74657_74855_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|74888_75626_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_032441949.1|75914_76364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925242.1|76597_78415_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|78414_79311_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|79350_79731_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|79735_80665_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_004200912.1|80719_81400_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	6.6e-30
WP_004152084.1|81396_82797_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|83013_83448_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|83679_83859_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|85601_86111_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|86160_86658_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|86989_87316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|87315_88026_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|88034_88580_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|88655_89018_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|90914_91451_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|91483_91909_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|91921_93211_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|93258_95010_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|95027_95390_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|95439_95790_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004200907.1|96147_96396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200905.1|96392_97625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200903.1|97758_98250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031976.1|98702_99107_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|99103_99451_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|99499_101038_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_017896554.1|101936_102245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|102738_103287_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|103333_103768_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003026799.1|104012_104279_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|104266_104749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|104949_106353_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|106381_107014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200842.1|107631_109395_+	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	41.3	2.9e-08
WP_004200841.1|110044_110908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255340.1|110924_111350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017896188.1|112261_113146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200838.1|113755_114304_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004200837.1|114811_115807_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.2	3.5e-19
>prophage 1
NZ_CP021687	Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence	96814	0	4943	96814	transposase	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000509966.1|1345_1951_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|2045_4943_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
>prophage 2
NZ_CP021687	Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence	96814	8043	11061	96814	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_021740570.1|8043_11061_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
>prophage 3
NZ_CP021687	Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence	96814	25406	28730	96814		Idiomarinaceae_phage(100.0%)	1	NA	NA
WP_032495745.1|25406_28730_+	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	29.5	5.0e-14
>prophage 4
NZ_CP021687	Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence	96814	47223	94214	96814	integrase,transposase	Escherichia_phage(19.05%)	53	37309:37326	92512:92529
37309:37326	attL	ACAGGCCCTGATCGACCA	NA	NA	NA	NA
WP_015632443.1|47223_47529_+	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	35.4	4.3e-05
WP_015632444.1|47551_49141_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_032495749.1|49181_49520_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.8	7.6e-27
WP_015632445.1|49516_49924_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_016162081.1|49999_50257_+	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
WP_016162080.1|50268_50520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|50560_52489_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_016162079.1|52491_52803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|53198_53531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|53802_54123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162076.1|54176_54410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632450.1|55101_55539_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015632451.1|55708_56569_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_032441934.1|56642_56822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|56965_57325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632453.1|57918_58356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|58482_58971_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632455.1|58967_59426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632456.1|59578_60007_-	partitioning protein	NA	NA	NA	NA	NA
WP_015632457.1|59999_60980_-	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632458.1|61340_61523_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632459.1|61548_61992_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_016162072.1|62333_62561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|62990_63248_+	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_015632462.1|63451_64018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632463.1|64059_64404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632464.1|64548_64854_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632465.1|64853_65072_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632466.1|65257_66283_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015632467.1|67226_67658_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_016162068.1|67657_68929_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_004098982.1|69340_70216_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|70848_71475_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|71594_71774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|72237_73032_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_016162067.1|73229_74234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024191724.1|74298_74610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|74658_74973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|75535_75766_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|75762_76179_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|76252_76963_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_063840280.1|77971_78526_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|78759_79317_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_012817690.1|79480_82489_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_094334140.1|82562_82757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|82989_83298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|83791_84340_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001118616.1|84794_85718_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_020316917.1|86194_86866_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
WP_050484131.1|87105_88089_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032441801.1|88250_89231_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.8e-186
WP_000427623.1|90164_91169_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015065644.1|91247_94214_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
92512:92529	attR	TGGTCGATCAGGGCCTGT	NA	NA	NA	NA
>prophage 1
NZ_CP021688	Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence	90199	782	64820	90199	integrase,transposase	Escherichia_phage(34.48%)	60	28606:28665	44343:45162
WP_032441952.1|782_1805_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001568019.1|2834_4562_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568018.1|5007_5256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568017.1|5252_5825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114073.1|6395_6749_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|6796_7159_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|7176_8928_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|8976_10266_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|10278_10704_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_004118313.1|10734_11139_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|11147_11720_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_012817690.1|11883_14892_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_025403922.1|16363_16798_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_004201260.1|16839_17484_-	quinolone resistance pentapeptide repeat protein QnrB9	NA	NA	NA	NA	NA
WP_004201261.1|17578_18553_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_003020532.1|18723_19392_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_003020509.1|19446_19671_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_003020497.1|19670_20030_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_003833267.1|20038_20269_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004201265.1|20715_21033_+	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_020324562.1|21827_22532_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_153933072.1|22537_22684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|22680_23292_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|23345_23627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|23799_24135_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000807690.1|25552_26308_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000861580.1|27319_27511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|27519_27906_-	hypothetical protein	NA	NA	NA	NA	NA
28606:28665	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_020324562.1|28657_29362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_071549088.1|29386_29899_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|29903_30110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|30491_31925_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|31958_33173_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|33433_34198_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|34340_34607_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|34827_35301_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|35456_36470_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|36862_37432_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_004201235.1|38188_39658_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_004201234.1|40177_40915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201232.1|41052_41739_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020324562.1|43645_44350_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001011939.1|44493_45135_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|45284_45785_-	hypothetical protein	NA	NA	NA	NA	NA
44343:45162	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTCTGAAACGAAATTACAGATTACGGTTAAAATATAAAAAAAAGCCACCAATCCTGCCGGATACGGTGGCTTAAATACAGAATTAATTAATTTATTTCAGTATGTTATCACACATCAGCTGAAGTGTATTGATAAACCTTGCTGCATGAAAACCATCACAGACTGCATGATGAACCTGTACAGAAACAGGTAATAGTACGCGGTCACCTTCCTGCTGAAACTTTGCCATTGTAAAAACCGGGGAAAAATAATCATCATTTCCGGTGATATTCAGATTAAATCCGTCAAAACTCACCCAGGGTAACGATGATATATTCAGGTGATTCTCCGGTAAATTTCCCTGCGGAAACAACCTGGTATCATGCTGATATTCTGCTGTTACCGCGTTATAACCCGCCATAAACTCACTGAGATCCGGAAAATAACGGCAGGACAGTGCGGAGAATGTTTCGGTTTCTTTATGAAAGACAGTAAAGACCGGGTCTGACTGTTCCCAGTAAATCAGTTCATTATCTTTCATTGCCATCCGGAACTCCGGAAACTGATTAACAGCCCGGGAGATCAGGTAAATCATCAGCGGATAAAACTTATAACCGGTTTTCGCCAGTGCAGTACGCAAAGCGGTAATATCGAGTTTGGTGGTCAGGCTGAATCCGCATTTAATCTGCTGACGATAAAGGGCAAAATGTTCCCTGCGATTCCAGGTATTCAGGTCAATCCGGGTAAAATTCATGGTTATTCCTTCTGATTAATAGTGAAA	NA	NA	NA	NA
WP_001067855.1|45864_46569_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|46712_47267_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|47397_48228_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|48859_49564_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|51885_52218_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|52264_53140_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|53395_54658_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000339857.1|55373_55643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|56057_57263_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|57259_58237_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|58318_59590_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|59589_60021_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|60429_61914_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|62383_63349_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|63828_64260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|64292_64820_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
