The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	789053	802236	4810234		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|789053_789815_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|789808_790435_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|790574_791714_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|791776_792769_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|792862_794227_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|794315_795092_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|795096_795735_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|795731_796994_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|796990_797899_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|798094_798862_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|798912_799569_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|799674_802236_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	1405116	1414559	4810234		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1405116_1406043_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1406047_1406779_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1406759_1406867_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1406926_1407658_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1407879_1409565_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1409561_1410281_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1410327_1410798_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1410839_1411301_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1411425_1413426_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1413422_1414559_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	1508610	1515038	4810234		Enterobacteria_phage(33.33%)	6	NA	NA
WP_042047335.1|1508610_1510017_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	2.8e-38
WP_032736000.1|1510238_1511303_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_042047338.1|1511329_1512199_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.9e-110
WP_042047340.1|1512230_1513121_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	2.1e-28
WP_023297948.1|1513135_1513690_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_042047343.1|1513871_1515038_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.6e-111
>prophage 4
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	2374530	2433159	4810234	integrase,tail,terminase,capsid,tRNA,portal,head,transposase,holin	Escherichia_phage(43.48%)	63	2382722:2382736	2433261:2433275
WP_001297484.1|2374530_2375637_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2375672_2376314_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2376317_2377688_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2377856_2378528_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2378527_2379988_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2380063_2381185_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|2381233_2382460_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2382709_2383846_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2382722:2382736	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2383829_2384693_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2385247_2385916_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|2386153_2386684_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|2387417_2387789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|2388097_2389606_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2393559_2394159_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2394226_2397706_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2397766_2398375_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2398311_2399055_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2399060_2399759_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2399758_2400115_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2400092_2403320_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2403366_2403627_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2403668_2404055_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2404054_2404759_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2404819_2405164_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2405160_2405610_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2405606_2405945_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2405953_2406271_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2406347_2407565_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2408170_2409397_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2409544_2411302_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2411301_2411784_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2411931_2412282_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2412807_2413101_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2413191_2413374_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2413590_2414124_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2414187_2414538_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2414542_2414758_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2415065_2415254_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2415514_2415850_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2415920_2416133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2416621_2416708_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_106466453.1|2417102_2417549_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	54.7	1.6e-32
WP_002431311.1|2417818_2419360_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2419374_2420121_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000139999.1|2420507_2420888_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2420888_2421947_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2421948_2422227_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2422394_2422607_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|2423641_2423824_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2423917_2424274_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2424331_2424754_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2424794_2425865_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2425936_2426362_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2426345_2426588_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2426979_2427318_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|2427749_2427950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2428042_2428261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2428225_2428429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2428829_2429018_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2429014_2429206_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2429299_2431741_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2431802_2432072_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2432040_2433159_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2433261:2433275	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	3364357	3425032	4810234	integrase,tail,lysis,terminase,portal,protease,transposase	Enterobacteria_phage(42.31%)	69	3365727:3365775	3410496:3410544
WP_000772656.1|3364357_3365566_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3365727:3365775	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_039023233.1|3366204_3367047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023231.1|3367547_3367745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371964.1|3368440_3369022_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023230.1|3368999_3369881_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_072240810.1|3370558_3370687_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086708942.1|3370741_3374500_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_001230375.1|3374564_3375164_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_039023163.1|3375233_3378731_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_032158484.1|3378791_3379439_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032151194.1|3379336_3380080_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|3380085_3380784_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039023164.1|3380793_3381123_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_039023165.1|3381122_3384188_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|3384159_3384489_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3384497_3384884_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021560209.1|3384944_3385688_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|3385698_3386100_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|3386096_3386675_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|3386686_3386962_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140705.1|3386954_3387278_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_023277783.1|3387364_3389392_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_052249886.1|3389375_3390845_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|3390844_3391057_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|3391053_3393156_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|3393155_3393647_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|3394322_3394475_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|3394462_3394930_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|3394926_3395424_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3395423_3395639_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|3395706_3396759_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|3396909_3397113_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|3397381_3398323_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|3398344_3398794_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|3398829_3399198_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_039023166.1|3399212_3400202_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|3400209_3401019_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|3401038_3401428_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|3401424_3401751_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|3401747_3402401_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_001393497.1|3402400_3402895_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_039023167.1|3402891_3403878_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
WP_001250272.1|3403867_3404047_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|3404222_3404774_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|3404766_3405027_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|3405124_3405817_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|3406519_3406882_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3406947_3407772_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3407899_3408436_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3408426_3408789_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|3408788_3409094_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_077873866.1|3409009_3409444_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_039023168.1|3409320_3410484_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	1.7e-227
WP_000893278.1|3410688_3411942_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3410496:3410544	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3411953_3413057_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3413344_3414400_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3414438_3414840_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3414897_3416142_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3416233_3416692_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3416952_3418410_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3418466_3419003_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3418935_3419202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3419507_3419960_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3419969_3420368_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554758.1|3420370_3420664_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3420715_3421771_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|3421841_3422612_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3422571_3424311_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3424534_3425032_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	3433290	3506133	4810234	tRNA,plate,transposase,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|3433290_3434427_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3434857_3435250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3435227_3439460_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3439535_3441677_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3441886_3442405_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3443099_3443600_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3443634_3443859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3443909_3445385_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3445391_3445805_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3445808_3447659_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3447622_3448705_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3448729_3450010_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3450006_3450531_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3450533_3451865_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3451869_3452631_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3452639_3455405_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3455401_3456145_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3456149_3457562_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3457670_3461105_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3461115_3462468_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3462491_3462974_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_087760840.1|3463017_3463932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3463941_3464421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3464557_3465343_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3465879_3466611_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3466675_3467143_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3467139_3467862_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3467895_3468651_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3468722_3470081_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3470128_3470752_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3470755_3471556_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3471796_3472711_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3472707_3473511_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3479270_3479846_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3480033_3481065_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3481057_3481711_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3481750_3482566_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3482683_3483088_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3483084_3483792_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3483903_3485622_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3485675_3486500_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3486699_3487410_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3487423_3487846_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3487842_3488388_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3488553_3488754_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3488740_3489001_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3489049_3490348_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|3490412_3490802_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3490858_3493000_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3493098_3494058_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3494070_3497553_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3497589_3498186_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|3498182_3499331_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3499330_3500119_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3500122_3500578_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3500682_3501708_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3501711_3502197_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3502318_3504751_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3504780_3506133_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP021683	Escherichia coli strain AR_0162, complete genome	4810234	4179111	4286418	4810234	integrase,tail,tRNA,protease,transposase	Escherichia_phage(44.12%)	103	4188811:4188846	4268716:4268751
WP_000187022.1|4179111_4180212_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4180251_4180611_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4180610_4181261_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4181591_4182992_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4182974_4183892_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4184158_4185532_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4185592_4186369_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4186376_4187381_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4187534_4188686_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4188811:4188846	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4189283_4191935_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4192116_4193850_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4194064_4194916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4194902_4195244_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4195245_4196124_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4196089_4198387_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4198437_4198758_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4198772_4199852_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4200160_4202662_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4202673_4203336_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4203346_4204450_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4204724_4205342_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4205368_4206274_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_087760842.1|4206366_4208547_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4208875_4209766_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4210114_4212547_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4212549_4213710_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4213986_4214304_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4214487_4215096_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4215156_4215369_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4215571_4217770_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4217925_4218951_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4219042_4220002_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4220094_4220625_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4220634_4221966_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4222032_4222959_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4223051_4223537_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4223621_4223867_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4224291_4225137_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4225159_4226668_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4226802_4227813_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4227909_4228656_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4228660_4229089_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4229115_4229415_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4229626_4230067_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4230167_4230767_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4230874_4231642_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4231696_4232452_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4232558_4233548_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4233867_4234830_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4235010_4235913_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|4236120_4236633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4236906_4238276_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4238348_4238567_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4238648_4239812_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4239811_4240291_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4240305_4242753_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4242745_4242865_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4242897_4243173_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4243229_4243748_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4243760_4244951_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4245010_4245613_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4245620_4247156_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4247204_4247552_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4247548_4247953_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|4248094_4248610_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|4248624_4249227_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001016257.1|4249640_4250387_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4250401_4251943_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4253417_4253693_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4253689_4253914_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4253913_4254216_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4254215_4254440_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4254503_4255004_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4255173_4255446_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4255582_4255876_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4255945_4256926_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4257112_4257613_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4257762_4258461_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4258457_4259831_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|4259936_4260611_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4260759_4261743_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|4262002_4262623_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_000063517.1|4262907_4263942_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000863142.1|4263938_4264877_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|4264860_4265697_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144073.1|4265984_4267454_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001311268.1|4267450_4268710_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179741.1|4269160_4269985_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
4268716:4268751	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
WP_000619493.1|4269994_4270309_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|4270609_4271056_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446015.1|4271066_4272518_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019486.1|4272507_4273578_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931299.1|4273577_4275326_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001295677.1|4275375_4276431_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753617.1|4276583_4277417_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077248221.1|4277610_4280661_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4280673_4281576_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4281572_4282208_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027703.1|4282204_4283134_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4283463_4283706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4283923_4284142_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|4284994_4285936_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4285980_4286418_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP021681	Escherichia coli strain AR_0162 plasmid tig00003056, complete sequence	95850	0	54987	95850	transposase,protease,integrase	Escherichia_phage(33.33%)	51	7354:7413	49360:50180
WP_001120891.1|791_1331_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|1302_2139_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2138_2942_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_087760815.1|3002_3818_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|4147_4324_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|4505_5510_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
7354:7413	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|7406_8111_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|9047_9290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|9321_9999_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|10077_11277_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|11308_12193_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|12330_12723_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000600827.1|14823_15801_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_087760816.1|17423_19142_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	1.6e-27
WP_000238872.1|19138_19627_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039267228.1|19619_20603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891983.1|20606_21521_-	response regulator	NA	NA	NA	NA	NA
WP_000062770.1|21834_22143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001112907.1|22135_22351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958205.1|22353_23016_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000175462.1|23026_23326_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_048659795.1|23335_26086_+	ATPase	NA	NA	NA	NA	NA
WP_024132261.1|26110_26821_+	Minor pilin of type IV secretion complex (VirB5)	NA	NA	NA	NA	NA
WP_000769859.1|26832_27117_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000014166.1|27134_28142_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001293055.1|28351_29038_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001045307.1|29030_29924_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_000980841.1|29920_31117_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000342114.1|31120_32170_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000979494.1|32156_32558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683352.1|32648_32966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610141.1|32992_33328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212005.1|33303_33612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281073.1|33608_35810_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_001079960.1|35806_36199_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_033546593.1|36907_38815_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000909125.1|38829_39576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048659789.1|39568_40096_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	2.8e-20
WP_001776120.1|40127_40559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438824.1|40690_40867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023281075.1|41038_42004_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.3e-58
WP_085018615.1|42455_42668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048230572.1|42682_42871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|42880_44080_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021546926.1|44733_45594_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
WP_000817632.1|45993_47199_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_000725192.1|47195_48161_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_094653748.1|48425_48650_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	96.7	1.0e-24
WP_001067855.1|48661_49366_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021546935.1|51261_52266_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
49360:50180	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCATTGAATCTACAGCGGCTTTTTTTAATATGTCCCGTTCGTCGGTAACCCGCTTCAGCTCTTTCTGGAGACGGCGGATCTCGGCCTGAGCATCTGACTGTTCTTTATTAGCGGAAGAATCCGGACCGTACTTCTTTATCCAGGCGTAAAGGCTGTGGGTGGTGATATCGAGACGTGTTGCAACGCTGGCAACAGAATAACCGCGATCAACAACCTGTTTGACTGCTTCAGTTTTAAACTCTTCGGGATAACGCTTACCGCTCATGGGCACCTCTCTTTAAGCCATCTTAAATGACTCTGAGGTGTCTGTTAAACCCGTGGCGATTCAGGAAGCCATTCATGATTACCTTTCGCAATCGTCCTGGGCTCCTGGTATTGATATAGAAACGGTCAGTGTATCTATCCAGAACAGCCTTTGTTTTGGCCTACTGGATGGCACAAGACAGATCGGTTTCGCCCGTCTGGTGACAGACTTTGCCACTTTTGGTTATTTGTGCGACGTCTACGTGCTGAACGACTATCAGAAAAGTGGCCTCGGTCGTTGGTTGATTGAATGCTGTCACGCCCATCCATTGATGTCACGCCTGCGACGGATAATGCTGGTCACTGACAGCGCCCCTTGGCTATACTAGAAAATGGGGTATCTCCCGTTGAACCGACCAGACTTTGTCTGGCAGATCAACCGACCAGACATGTATCGTAAAACCGAAGGTAAATGAAGACTGTTTGGAGAGTAATATAGACTGTCAATCCGTAGGGCTGAG	NA	NA	NA	NA
WP_048659818.1|52941_54987_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021681	Escherichia coli strain AR_0162 plasmid tig00003056, complete sequence	95850	69552	69732	95850		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_012600012.1|69552_69732_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
>prophage 3
NZ_CP021681	Escherichia coli strain AR_0162 plasmid tig00003056, complete sequence	95850	74115	76674	95850	transposase,integrase	Escherichia_phage(66.67%)	3	69822:69835	82813:82826
69822:69835	attL	AACTCTGATGGCGT	NA	NA	NA	NA
WP_001067852.1|74115_74820_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000161640.1|75165_75975_+	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001752951.1|76071_76674_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	30.5	3.6e-11
82813:82826	attR	AACTCTGATGGCGT	NA	NA	NA	NA
>prophage 4
NZ_CP021681	Escherichia coli strain AR_0162 plasmid tig00003056, complete sequence	95850	80202	84370	95850		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_005032116.1|80202_82200_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_154606844.1|82415_82556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534857.1|82580_82820_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_001513653.1|82819_83014_+	hypothetical protein	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.7	1.1e-14
WP_012477564.1|83070_83661_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|83797_84370_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 5
NZ_CP021681	Escherichia coli strain AR_0162 plasmid tig00003056, complete sequence	95850	91874	95389	95850	transposase	Salmonella_phage(66.67%)	3	NA	NA
WP_000239590.1|91874_92750_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|93005_94268_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|94831_95389_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
>prophage 1
NZ_CP021684	Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence	84929	11392	52077	84929	protease,transposase	Escherichia_phage(33.33%)	42	NA	NA
WP_000616807.1|11392_12046_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|12138_12396_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|12328_12730_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|14040_14745_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024210412.1|14756_16238_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|16766_17216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|17730_17841_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|17845_18583_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|18708_18804_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|18938_19643_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|19764_20679_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|20675_21914_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|21913_22498_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|22990_23755_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|24056_24614_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|24796_25657_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|28417_29122_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|29112_29253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|31063_31345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|31467_31818_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|31820_32783_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|32929_33223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|33299_33983_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|33983_34205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|34218_34653_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|35352_35925_+	YubH family protein	NA	NA	NA	NA	NA
WP_001671341.1|36020_36323_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|36369_36792_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027493.1|36788_36980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|38017_38248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|38299_39661_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001298559.1|39707_40271_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000936285.1|41771_43673_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_031311812.1|43822_44308_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.8	1.7e-40
WP_000006003.1|44365_44599_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845953.1|46696_47131_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|47127_47847_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001309233.1|47867_48047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|48126_48285_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272251.1|49199_49496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|49606_50428_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_000381395.1|50505_52077_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
