The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	205172	256152	5029162	tail,capsid,protease,head,plate,integrase,portal,transposase,holin	Salmonella_phage(79.49%)	63	238655:238671	264353:264369
WP_000208242.1|205172_205703_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|205712_207044_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|207110_208037_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|208129_208615_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|208699_208945_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|209369_210215_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|210237_211746_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|211881_212892_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|212988_213735_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|213739_214168_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|214194_214494_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155272.1|214705_215146_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|215246_215846_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|215953_216721_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|216775_217531_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|217637_218627_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|218946_219909_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|220089_220992_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_021567699.1|221245_221629_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	98.4	2.7e-65
WP_001251454.1|221718_221961_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_021567698.1|222009_223128_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	1.9e-191
WP_000224787.1|223285_224479_+|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_001207578.1|224491_225007_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_080028419.1|225021_225357_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	98.2	5.2e-52
WP_000763324.1|225365_225482_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_080028420.1|225482_228410_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	91.5	0.0e+00
WP_000979934.1|228419_228869_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.7	3.9e-79
WP_021567694.1|228975_229557_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	79.5	9.2e-81
WP_073511640.1|229730_229964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246760.1|231212_231827_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	98.4	5.9e-110
WP_080028422.1|231819_232731_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.0	1.8e-160
WP_000108899.1|232727_233090_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_045355545.1|233086_233716_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.2	1.3e-109
WP_016246757.1|233873_234518_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.2	5.7e-116
WP_000917105.1|234478_234973_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_016246755.1|234972_235503_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	65.3	5.3e-43
WP_016246754.1|235604_236084_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	70.1	4.6e-62
WP_021567690.1|236148_236478_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	97.2	2.3e-52
WP_001102549.1|236488_236689_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|236688_237177_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_023276968.1|237279_238128_-	hypothetical protein	NA	A0A0M4R523	Salmonella_phage	97.2	2.8e-134
WP_001246220.1|238170_239217_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
238655:238671	attL	ACGGTGATATCTTTCAT	NA	NA	NA	NA
WP_016246750.1|239257_240103_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.9	1.6e-153
WP_016246749.1|240256_241969_+	hypothetical protein	NA	A0A0M4S6K7	Salmonella_phage	98.1	0.0e+00
WP_000014576.1|241969_243019_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_045355548.1|243502_244615_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_080028423.1|244665_247035_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.6	0.0e+00
WP_021567686.1|247031_247211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087757939.1|247210_248182_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	1.1e-137
WP_021567684.1|248183_248396_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	94.3	4.1e-31
WP_080028424.1|248438_248621_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000482341.1|248620_249055_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_021567682.1|249148_249379_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	74.7	2.1e-28
WP_000290619.1|249368_249575_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_021567681.1|249585_249789_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	94.0	1.4e-28
WP_000130011.1|249799_250081_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	98.9	5.3e-50
WP_000343126.1|250171_250411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567679.1|250647_250941_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	72.2	7.2e-34
WP_057502207.1|251010_251991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	3.0e-185
WP_001223800.1|252168_252669_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|252818_253517_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|253513_254887_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_000399648.1|255171_256152_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
264353:264369	attR	ATGAAAGATATCACCGT	NA	NA	NA	NA
>prophage 2
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	1524268	1531408	5029162		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1524268_1524907_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1524903_1526166_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1526162_1527071_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1527236_1528034_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141333.1|1528084_1528741_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1528846_1531408_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	2197976	2207418	5029162		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|2197976_2198903_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|2198907_2199639_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|2199619_2199727_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2199786_2200518_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2200739_2202425_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2202421_2203141_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2203187_2203658_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2203698_2204160_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|2204284_2206285_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|2206281_2207418_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	2437337	2473249	5029162	holin,integrase,tail	Escherichia_phage(32.14%)	40	2425857:2425871	2447239:2447253
2425857:2425871	attL	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_001593427.1|2437337_2438600_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.5	7.4e-75
WP_001302302.1|2438937_2439735_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021546102.1|2439970_2440996_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|2440995_2441199_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069067231.1|2441257_2443699_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	7.8e-113
WP_021579309.1|2443792_2443984_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|2443980_2444169_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2444568_2444733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2444736_2444955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2445114_2445270_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_069067232.1|2445542_2446259_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.7e-52
WP_060615121.1|2446308_2446524_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693850.1|2446520_2446946_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475341.1|2447017_2448088_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
2447239:2447253	attR	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_021546098.1|2448128_2448554_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|2448728_2449394_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_029488705.1|2449574_2449787_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_000737636.1|2449930_2450323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|2450619_2450898_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|2450899_2451949_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001217424.1|2451961_2452321_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_080028474.1|2452317_2453007_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.0e-58
WP_000839572.1|2453803_2454019_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|2454023_2454338_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|2454393_2454927_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|2455143_2455329_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|2455569_2456055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016240599.1|2456299_2456500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001441851.1|2456687_2457059_+	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	97.6	1.0e-61
WP_071590020.1|2457100_2457361_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_071549949.1|2457407_2460635_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.0	0.0e+00
WP_040079256.1|2460612_2460969_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_001152456.1|2460968_2461667_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_064732677.1|2461671_2462415_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.3	4.1e-142
WP_012311734.1|2462312_2462960_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_071549948.1|2463020_2466500_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_041498143.1|2466569_2467169_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.2e-105
WP_072042815.1|2467233_2470647_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
WP_041498150.1|2470646_2471228_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.7e-101
WP_001079062.1|2472718_2473249_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 5
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	2705318	2723352	5029162	tail,tRNA	Enterobacteria_phage(69.23%)	20	NA	NA
WP_001144192.1|2705318_2707247_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|2707250_2707793_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2707889_2708087_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2708139_2708496_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2708618_2708663_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|2708946_2709930_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|2709944_2712332_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2712336_2712636_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2712939_2713080_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|2713270_2713531_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024188892.1|2713680_2714184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132830.1|2714540_2715650_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|2715807_2716992_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|2716991_2717504_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2717558_2717924_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2717959_2718088_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_033544764.1|2718074_2720882_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000979945.1|2720894_2721383_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001100987.1|2721479_2722658_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_060615039.1|2722752_2723352_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
>prophage 6
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	2858835	2910647	5029162	tail,protease,integrase,terminase,transposase,lysis	Enterobacteria_phage(37.93%)	58	2875966:2875980	2893475:2893489
WP_001260855.1|2858835_2859657_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2859756_2859840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2859932_2860268_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|2860664_2861918_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2862024_2862918_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225275.1|2863052_2864273_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2864397_2865093_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2865045_2866338_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2866497_2867112_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2867154_2868009_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2868010_2868628_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2868638_2871062_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_072644962.1|2871122_2872289_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.9	1.1e-85
WP_072644963.1|2872214_2873813_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000113586.1|2874335_2874704_+	hypothetical protein	NA	NA	NA	NA	NA
2875966:2875980	attL	ACGAAGAATACTTCG	NA	NA	NA	NA
WP_002431311.1|2876217_2877759_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2877773_2878520_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000095383.1|2879106_2879616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025924.1|2879702_2880692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041533.1|2881156_2882635_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.2e-120
WP_001295396.1|2882833_2883139_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2883246_2883957_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2883959_2884520_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2884554_2884896_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2885030_2885357_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2885562_2886777_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2886788_2887808_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2887865_2887976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876993.1|2887995_2889276_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2889310_2889547_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048320.1|2889634_2892106_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2892199_2892391_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2892387_2892576_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|2892975_2893140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171933.1|2893143_2893362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2893521_2893677_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
2893475:2893489	attR	CGAAGTATTCTTCGT	NA	NA	NA	NA
WP_000448563.1|2893843_2894251_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2894334_2894565_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|2894548_2895070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2895050_2896016_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001151251.1|2896056_2896479_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000566848.1|2896731_2897631_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|2897945_2898599_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|2898611_2899307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|2899992_2900205_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000980987.1|2900421_2900673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2900739_2901018_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265276.1|2901019_2902069_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_001204811.1|2902086_2902464_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_000780579.1|2902620_2903145_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_000592549.1|2903337_2904297_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839586.1|2905228_2905444_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_001348167.1|2905443_2905941_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|2906157_2906340_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2906430_2906724_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_000421825.1|2907404_2907944_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_100069996.1|2907952_2909263_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000885571.1|2910065_2910647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
>prophage 7
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	3096398	3109570	5029162	transposase,holin,tail	Enterobacteria_phage(41.67%)	16	NA	NA
WP_000837924.1|3096398_3097532_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3097672_3098107_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|3098883_3098997_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|3099065_3099299_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|3099615_3100206_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000885599.1|3100303_3100879_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_060614949.1|3100878_3102954_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	57.0	5.1e-198
WP_000839557.1|3103085_3103301_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	6.5e-32
WP_001348108.1|3103552_3103927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|3104098_3104527_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640162.1|3105570_3106113_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|3106109_3106400_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|3106399_3106999_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|3107812_3108151_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|3108407_3108707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3108703_3109570_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 8
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	3114388	3132687	5029162	integrase,tRNA	Escherichia_phage(66.67%)	21	3115725:3115738	3130110:3130123
WP_155119857.1|3114388_3116386_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
3115725:3115738	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|3116726_3117149_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_080028387.1|3117189_3118260_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693853.1|3118331_3118757_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|3118753_3119008_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|3119087_3119507_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|3119938_3120094_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3120090_3120579_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3121020_3121242_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3121241_3121412_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3121486_3121762_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105127.1|3121863_3124464_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_060615110.1|3124456_3125239_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	73.0	5.5e-105
WP_001317028.1|3125322_3125517_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3125509_3125719_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3125797_3126013_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3126014_3127250_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|3127301_3128237_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|3128365_3129739_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3130216_3131200_-	zinc transporter ZntB	NA	NA	NA	NA	NA
3130110:3130123	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_069067245.1|3131454_3132687_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	3209212	3267092	5029162	tail,capsid,protease,head,plate,integrase,holin	Salmonella_phage(42.59%)	76	3226971:3226987	3267279:3267295
WP_000422045.1|3209212_3210262_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|3210481_3211240_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|3211236_3211827_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3211866_3212739_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|3212839_3213460_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_087757969.1|3213456_3214338_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3214475_3214520_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194591.1|3214611_3216174_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3216173_3217769_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|3217772_3219131_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|3219142_3220336_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|3220335_3221142_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3221522_3221702_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3221787_3222288_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079504.1|3222333_3222840_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|3222899_3223538_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|3223894_3224638_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|3224667_3225207_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|3225311_3225710_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|3225749_3226469_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|3226692_3226989_+	YciI family protein	NA	NA	NA	NA	NA
3226971:3226987	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
WP_000639140.1|3227107_3227656_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
WP_080028388.1|3228199_3228610_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.5	1.9e-19
WP_001340317.1|3228590_3228824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080028390.1|3229599_3230280_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	2.2e-102
WP_087757970.1|3230276_3231476_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.5	1.6e-180
WP_016239889.1|3231476_3231830_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_087757972.1|3232058_3232799_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	66.1	3.8e-79
WP_080028393.1|3232863_3233979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087757973.1|3233984_3235076_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	65.4	5.9e-137
WP_001160174.1|3235078_3235384_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_032238365.1|3235385_3235988_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	69.5	1.6e-64
WP_087757974.1|3235987_3238003_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	73.4	1.0e-283
WP_000393957.1|3238180_3238606_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_000257257.1|3238609_3239050_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_087757975.1|3239060_3240221_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.1	7.8e-156
WP_087757976.1|3240224_3240788_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	1.1e-78
WP_087757977.1|3240762_3241152_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.9	7.8e-68
WP_087757978.1|3241138_3241693_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	1.6e-82
WP_001125674.1|3241689_3242097_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	5.1e-70
WP_001040703.1|3242062_3242452_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_000627486.1|3242493_3243435_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.8	6.1e-175
WP_000128056.1|3243446_3243950_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	7.2e-74
WP_080028399.1|3243954_3245187_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	95.4	2.0e-218
WP_113772720.1|3245201_3245939_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	2.3e-108
WP_087757979.1|3245823_3247293_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.5	1.1e-268
WP_032238376.1|3247292_3248915_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	2.1e-311
WP_016243561.1|3248917_3249391_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	4.7e-51
WP_001081498.1|3249422_3250043_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	4.4e-89
WP_029403918.1|3250097_3250283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029403919.1|3250426_3250819_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	76.6	1.2e-47
WP_001567570.1|3250815_3251430_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	95.6	3.0e-106
WP_000422366.1|3251429_3251711_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001567569.1|3251697_3252084_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	4.6e-60
WP_029403922.1|3252448_3253018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567567.1|3253222_3254005_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	76.4	2.9e-114
WP_087757980.1|3254001_3254142_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	97.8	3.7e-20
WP_001472176.1|3254138_3254501_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	99.2	1.4e-63
WP_001472175.1|3254497_3254788_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	100.0	1.1e-50
WP_001472174.1|3254790_3254997_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	97.0	7.3e-33
WP_001472173.1|3254996_3255596_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.5	6.5e-106
WP_071524885.1|3255630_3255879_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	97.6	1.8e-41
WP_032238380.1|3255996_3256230_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	97.4	1.5e-37
WP_001299077.1|3256415_3256616_-	hypothetical protein	NA	K7PHG5	Enterobacteria_phage	93.3	6.7e-07
WP_000838082.1|3256617_3257307_-	Replication protein 14	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
WP_087757981.1|3257303_3258212_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	99.7	4.5e-159
WP_001472167.1|3258296_3258854_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
WP_001568772.1|3258865_3259084_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_001472166.1|3259156_3259576_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	77.1	3.1e-46
WP_001767223.1|3259640_3259922_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	75.3	2.2e-32
WP_001767222.1|3260159_3260450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567552.1|3260905_3261112_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	97.1	7.3e-33
WP_001472161.1|3261423_3264258_+	exodeoxyribonuclease VIII	NA	K7PJT5	Enterobacteria_phage	83.0	0.0e+00
WP_001472160.1|3264269_3265382_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	99.7	1.5e-204
WP_001237029.1|3265420_3265663_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000627155.1|3265898_3267092_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
3267279:3267295	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 10
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	4252821	4313623	5029162	holin,integrase,tail	Shigella_phage(44.44%)	52	4281701:4281716	4311670:4311685
WP_000131044.1|4252821_4254855_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|4254983_4255571_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|4255584_4257057_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|4257070_4258741_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|4259815_4260379_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|4260708_4261503_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|4261656_4262418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|4263563_4264757_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|4264940_4265606_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|4265851_4266547_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|4266539_4267967_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4267977_4268697_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|4269226_4270081_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046304.1|4270306_4271632_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474074.1|4271740_4271977_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4271988_4272582_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_024198277.1|4272741_4273611_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_000092619.1|4274837_4279091_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4280185_4280287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|4280649_4280913_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4280912_4281053_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|4281087_4281315_-	hypothetical protein	NA	NA	NA	NA	NA
4281701:4281716	attL	TCCCTTACCCTTAAAA	NA	NA	NA	NA
WP_001296902.1|4282137_4282680_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4282754_4283342_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4283399_4284068_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|4284093_4286619_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|4286608_4288252_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|4288220_4288931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|4289243_4289573_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4289820_4290435_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|4290852_4291542_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000667026.1|4292523_4294722_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|4294731_4295688_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|4295666_4296077_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_042058399.1|4296698_4297631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614957.1|4298415_4299399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048228913.1|4300054_4300729_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.0e-78
WP_023568709.1|4300831_4301134_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_023568708.1|4301139_4301760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023568707.1|4302194_4302746_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.9e-86
WP_071549914.1|4302817_4303165_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.2	4.6e-11
WP_000090998.1|4303349_4303706_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_069067270.1|4303705_4304845_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	75.3	1.3e-190
WP_000497751.1|4304828_4304999_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001191674.1|4306592_4306853_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4306950_4307643_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000206732.1|4308039_4308345_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|4308344_4308695_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|4308571_4309735_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_058685605.1|4309907_4311131_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060614976.1|4311161_4311440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614977.1|4311778_4313623_-	cell envelope integrity protein TolA	NA	A0A1Q1N989	Escherichia_phage	32.4	1.5e-63
4311670:4311685	attR	TTTTAAGGGTAAGGGA	NA	NA	NA	NA
>prophage 11
NZ_CP021535	Escherichia coli strain AR_0119 chromosome, complete genome	5029162	4711588	4727831	5029162	transposase,integrase	Salmonella_phage(28.57%)	16	4709050:4709109	4732583:4733350
4709050:4709109	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_032426534.1|4711588_4712593_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|4712671_4715638_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4715640_4716201_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4716326_4716677_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|4716879_4717893_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_045899678.1|4718582_4719056_+	trimethoprim-resistant dihydrofolate reductase Dfr7	NA	A0A1B2IBQ4	Erwinia_phage	35.4	9.0e-18
WP_045899677.1|4719202_4719634_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001007673.1|4719715_4720543_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|4720678_4721026_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4721019_4721859_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4721986_4722487_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|4722993_4723758_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000480968.1|4723959_4724796_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|4724795_4725599_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|4725705_4726835_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_085947932.1|4727071_4727831_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
4732583:4733350	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 1
NZ_CP021536	Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence	244955	14799	46401	244955	transposase,integrase	Salmonella_phage(25.0%)	30	17556:17571	42651:42666
WP_000427620.1|14799_15804_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|15882_18855_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
17556:17571	attL	GCGCATCGGCGGGCAC	NA	NA	NA	NA
WP_001162012.1|18857_19415_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_002075255.1|19720_20734_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032488579.1|20964_21519_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000679427.1|21687_22035_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|22028_22868_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|23272_24814_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201164.1|25858_26671_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|26674_27040_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|27044_27683_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|27693_28725_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|28729_29059_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|29252_29543_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|29598_31239_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_072223382.1|31427_32756_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|32749_33589_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376617.1|33715_33958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|34041_34341_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_004201046.1|35851_36505_+	endonuclease III	NA	NA	NA	NA	NA
WP_000855769.1|36602_37448_-	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000951934.1|38088_38280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|38303_38531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|38581_39718_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|39684_39834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342213.1|41345_41471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072199448.1|41803_42223_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|42713_43418_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
42651:42666	attR	GCGCATCGGCGGGCAC	NA	NA	NA	NA
WP_000429836.1|44883_45318_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|45396_46401_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021536	Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence	244955	197172	234527	244955	transposase,integrase	Macacine_betaherpesvirus(33.33%)	36	208585:208599	231129:231143
WP_087523611.1|197172_198445_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_089634947.1|198430_199000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157663666.1|200100_200238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029702196.1|200378_200942_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	40.0	3.0e-20
WP_039023242.1|200989_202351_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|202402_202633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|203661_203853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051394489.1|203852_204314_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001436678.1|204313_204616_-	antirestriction protein	NA	NA	NA	NA	NA
WP_029702191.1|205982_206417_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104867.1|206430_206652_-	hypothetical protein	NA	A0A2I6TCC3	Escherichia_phage	35.6	6.9e-05
WP_000086148.1|206652_207336_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_032260558.1|207411_207723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001507408.1|207719_208622_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
208585:208599	attL	ATCTCAGCGATCTGT	NA	NA	NA	NA
WP_000817036.1|209488_210460_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|210459_211626_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|212213_212969_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|213742_214549_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|214549_214855_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|214856_215075_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|215782_216778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058682609.1|216781_217714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236297.1|219205_220018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361611.1|220804_221782_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066942.1|222066_222807_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032355874.1|222927_223053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440647.1|223176_223338_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_029702141.1|224017_224758_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_029702172.1|225710_226160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032173305.1|226686_226908_+	iso-IS1	NA	A0A0U2RK18	Escherichia_phage	60.6	9.3e-18
WP_077825751.1|226907_227045_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	85.7	8.9e-11
WP_087758007.1|227038_227221_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	74.4	3.2e-08
WP_085948620.1|227223_228437_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000027057.1|231100_231961_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
231129:231143	attR	ATCTCAGCGATCTGT	NA	NA	NA	NA
WP_001235713.1|232143_232701_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|233264_234527_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 1
NZ_CP021537	Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence	97474	2872	69491	97474	integrase,plate,terminase,capsid,tail,tRNA	Escherichia_phage(82.89%)	84	7905:7921	24543:24559
WP_000488304.1|2872_3064_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000274528.1|3063_3456_+	hypothetical protein	NA	A0A222YWH1	Escherichia_phage	100.0	2.9e-70
WP_000435256.1|3564_3957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087758036.1|4337_5318_+	DNA pacase A subunit	NA	NA	NA	NA	NA
WP_087758010.1|5317_6826_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	57.0	4.3e-162
WP_000888609.1|6853_7093_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
7905:7921	attL	TTTAGTTTTCTAACATA	NA	NA	NA	NA
WP_087758011.1|8285_9314_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	3.9e-58
WP_000349257.1|9423_9732_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_000861175.1|9728_10205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000640907.1|10201_10696_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	99.4	2.2e-91
WP_087758012.1|10710_11388_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	73.8	2.7e-92
WP_087758013.1|11394_12195_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	96.5	6.2e-136
WP_053919810.1|12278_12659_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	91.1	3.6e-57
WP_001190712.1|12658_12880_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_087758014.1|12952_13342_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	2.4e-69
WP_162287626.1|13742_15230_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.2	2.7e-31
WP_001377386.1|15374_15626_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_001261544.1|16287_16650_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_000057449.1|16646_17579_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_000988651.1|17560_17935_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
WP_000269004.1|17941_18235_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_000517421.1|18413_18647_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	7.3e-37
WP_033553819.1|18723_18984_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
WP_087758016.1|18980_19856_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	83.7	1.2e-135
WP_000797279.1|20369_20558_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_073840218.1|20891_21137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087758017.1|21544_22204_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	64.5	2.8e-57
WP_087758020.1|22905_23502_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	81.8	2.0e-91
WP_050484480.1|23506_24502_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.9	9.6e-195
WP_087758021.1|24599_25292_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	94.8	7.5e-130
24543:24559	attR	TATGTTAGAAAACTAAA	NA	NA	NA	NA
WP_087758022.1|25288_25600_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	4.5e-58
WP_000139733.1|25596_25821_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	100.0	9.1e-37
WP_087758023.1|25817_26093_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	84.6	9.5e-36
WP_087758024.1|26089_26785_-	ead/Ea22-like family protein	NA	A0A2I6TCG8	Escherichia_phage	98.3	1.7e-41
WP_087758025.1|26781_27105_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	78.4	1.1e-38
WP_087758026.1|27106_27592_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	6.4e-43
WP_087758027.1|27588_28086_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	68.5	1.9e-42
WP_087758037.1|28075_28360_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	1.4e-42
WP_077887573.1|28389_28986_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	98.0	7.7e-107
WP_087758028.1|29273_29852_+	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	3.2e-73
WP_157663667.1|29991_30150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|30525_30645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000246409.1|30663_30879_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	97.1	1.3e-35
WP_087758029.1|30878_31820_+	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	86.9	7.0e-155
WP_000717724.1|31879_32191_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
WP_001396850.1|32187_32415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032323273.1|32600_33209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087758030.1|33492_34146_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.1	8.4e-115
WP_000542383.1|34474_34804_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_087758031.1|34796_35990_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	99.5	9.7e-202
WP_087758032.1|36023_36752_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	98.8	8.2e-127
WP_044868318.1|36814_37174_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	100.0	1.6e-62
WP_000806445.1|37230_37569_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|37639_37942_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000532307.1|38104_38896_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.9	7.5e-150
WP_000203293.1|38892_39660_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000046500.1|39663_40644_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000828873.1|40640_41294_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	99.1	2.1e-102
WP_001258019.1|41353_42259_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	99.7	1.5e-165
WP_000812693.1|42242_44399_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	72.6	5.9e-298
WP_001287146.1|44447_46109_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.6	0.0e+00
WP_000595051.1|46377_46665_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_000585022.1|46657_47299_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
WP_000076909.1|47586_47925_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_080028511.1|47937_48894_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.2e-180
WP_001272821.1|49160_49445_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_080028510.1|49444_50251_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	99.3	8.5e-117
WP_080028509.1|50321_50780_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.7	2.7e-67
WP_023908691.1|51307_51523_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	78.3	3.2e-23
WP_080028508.1|51522_52521_+	ORF6N domain-containing protein	NA	A0A222YWG0	Escherichia_phage	91.9	1.4e-116
WP_080028507.1|52556_52961_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	98.5	2.6e-66
WP_080028506.1|53119_54817_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	99.1	0.0e+00
WP_047647205.1|54964_55243_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	95.7	1.1e-39
WP_080028505.1|55310_56969_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	97.1	8.8e-302
WP_080028504.1|57012_57747_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.6	1.7e-124
WP_080028503.1|57873_58392_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	77.3	3.8e-70
WP_080028502.1|58400_58892_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	98.8	3.0e-88
WP_000187854.1|58946_59498_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_000021878.1|59513_60221_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|60602_61358_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_047647212.1|61746_62568_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	2.9e-157
WP_032220997.1|66833_67208_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	96.8	2.5e-63
WP_080028501.1|67204_68635_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	93.1	1.2e-254
WP_080028500.1|68645_69491_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	95.0	5.3e-154
>prophage 2
NZ_CP021537	Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence	97474	74117	96788	97474	holin,lysis,transposase,head	Escherichia_phage(95.0%)	20	NA	NA
WP_000457140.1|74117_74444_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_080028498.1|74443_74890_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	99.3	2.7e-80
WP_080028497.1|74879_75500_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	96.1	1.6e-75
WP_080028496.1|75492_77430_+|head	head protein	head	A0A222YWA3	Escherichia_phage	97.7	0.0e+00
WP_060877123.1|77429_77804_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_080028495.1|77920_79129_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_080028494.1|79235_80621_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	9.1e-236
WP_052154682.1|81135_82368_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	99.8	2.8e-236
WP_080028493.1|82381_83380_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.8	7.9e-181
WP_080028492.1|83580_84543_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.4	8.2e-175
WP_000245715.1|84956_85181_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_080028525.1|85180_85888_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	98.7	1.4e-128
WP_047648389.1|85887_86085_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	93.8	5.0e-31
WP_001273800.1|86117_86603_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_087758033.1|86753_93590_+	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	99.1	0.0e+00
WP_087758034.1|93626_94061_+	olxA	NA	A0A222YZ35	Escherichia_phage	98.6	2.1e-77
WP_001230915.1|94063_94324_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_099145002.1|94577_94955_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	99.2	1.1e-69
WP_001238268.1|94969_95170_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_087758035.1|95579_96788_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.3	1.7e-230
>prophage 1
NZ_CP021538	Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence	64372	4261	45204	64372	transposase,integrase	Salmonella_phage(25.0%)	37	923:940	49745:49762
923:940	attL	AACCAGTTCATAATCATC	NA	NA	NA	NA
WP_025760373.1|4261_4972_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.5	2.2e-15
WP_032635065.1|5130_5385_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	48.8	1.5e-11
WP_000143805.1|5374_5665_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.1	3.0e-24
WP_032635044.1|5975_6575_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032635043.1|7380_7977_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_032635075.1|8266_10264_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_032635042.1|10327_11605_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_032635041.1|11838_12426_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032635040.1|12428_12986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154816812.1|13335_14550_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	41.9	4.7e-34
WP_032635037.1|14584_16018_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.6	4.9e-107
WP_032635036.1|16395_17046_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	29.9	3.1e-08
WP_032635035.1|17042_17915_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_032635034.1|18042_18600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045265539.1|19043_19625_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032635033.1|19651_20134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072918.1|20256_20550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072917.1|20638_20923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072916.1|20982_21831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087758039.1|22974_23850_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_020323529.1|23830_23908_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032635028.1|24141_24393_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001067855.1|26567_27272_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001339197.1|28632_29841_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_162287627.1|29960_31058_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.4e-13
WP_001393253.1|33974_34307_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|34353_35229_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_072031555.1|35484_35703_-	hypothetical protein	NA	A0A1B0VDR3	Salmonella_phage	100.0	1.4e-18
WP_001067855.1|35693_36398_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|37029_37860_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|37990_38545_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|38688_39393_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|39709_40264_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|40333_41122_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|41181_42006_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001101446.1|42891_43917_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004099053.1|44235_45204_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
49745:49762	attR	AACCAGTTCATAATCATC	NA	NA	NA	NA
