The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	616368	660777	4326347	protease,terminase,tail,tRNA,holin,head,plate,integrase	Bacillus_phage(52.94%)	55	626618:626635	663882:663899
WP_003179225.1|616368_616845_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003179227.1|616825_617515_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003179229.1|617527_617986_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003179232.1|617975_619001_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	2.1e-67
WP_080624180.1|619240_621166_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.3	4.2e-61
WP_003179234.1|621312_621819_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003179237.1|621822_622470_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003179239.1|622512_622692_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_011201569.1|622698_623475_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.7	5.3e-15
WP_003179243.1|623520_623715_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003179245.1|623711_624446_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|624671_624956_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_003179250.1|625000_626635_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.1e-159
626618:626635	attL	ATGGGCGGAATGATGTAA	NA	NA	NA	NA
WP_025807787.1|626716_627934_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.9	8.0e-143
WP_025807788.1|627947_628580_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	62.4	1.9e-71
WP_025807791.1|628744_628993_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	65.8	1.1e-19
WP_025807793.1|629019_629214_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025807794.1|629226_629928_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	67.8	4.4e-85
WP_025807795.1|629940_630339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807797.1|630437_630782_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	55.8	6.6e-10
WP_025807799.1|630786_630996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330098.1|630985_631198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025807801.1|631252_631471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017475008.1|631572_631791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807804.1|631783_632662_+	replication protein	NA	V9QKF6	Oenococcus_phage	44.6	4.7e-52
WP_025807806.1|632645_633479_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.0	5.4e-34
WP_025807808.1|633802_634351_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	5.2e-09
WP_017474694.1|634455_634605_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_017474644.1|634675_634876_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.9	4.2e-09
WP_017474645.1|634911_635145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474597.1|635658_635907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808209.1|636204_636645_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.1	2.3e-36
WP_080627099.1|636644_637187_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	3.3e-56
WP_025808178.1|637416_638220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407332.1|638560_638782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080869.1|639017_639659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627100.1|639818_640193_+	HNH endonuclease	NA	Q38456	Bacillus_phage	81.5	4.4e-60
WP_009330377.1|640574_641108_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_025807960.1|644228_644858_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009329208.1|646239_646689_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_009329207.1|646704_647055_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	60.0	1.3e-32
WP_069500676.1|647350_647734_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	69.3	5.9e-44
WP_069500675.1|647730_648111_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	54.8	1.8e-32
WP_009329203.1|648110_648719_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	8.2e-56
WP_009329202.1|648778_649114_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_025807965.1|649311_653202_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	62.7	0.0e+00
WP_009330398.1|653201_654038_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	71.8	2.0e-113
WP_080626726.1|654050_655760_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.2	1.9e-219
WP_069500673.1|655796_657371_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.6	1.1e-261
WP_069500672.1|657407_658754_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	86.3	9.9e-86
WP_080626727.1|658766_659090_+	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	46.4	7.8e-13
WP_080626728.1|659086_659272_+	XkdX family protein	NA	NA	NA	NA	NA
WP_069500916.1|659334_659604_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_080626729.1|659619_659883_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	2.7e-32
WP_080626730.1|659934_660777_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	54.3	3.7e-46
663882:663899	attR	ATGGGCGGAATGATGTAA	NA	NA	NA	NA
>prophage 2
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	734211	744135	4326347		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|734211_735507_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|735581_736298_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|736299_736554_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|736550_737234_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|737217_739446_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|739421_740852_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|740975_742016_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_080626734.1|742012_742600_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.1e-28
WP_003179539.1|742596_744135_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 3
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	973918	980856	4326347		uncultured_Caudovirales_phage(50.0%)	11	NA	NA
WP_080626760.1|973918_974242_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	35.7	1.4e-06
WP_080626761.1|974416_974752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626762.1|974748_974994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664247.1|974990_975167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626763.1|975167_975494_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	36.1	9.9e-08
WP_080626765.1|975845_976229_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.7	6.0e-20
WP_080626766.1|977001_977796_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	52.3	4.8e-64
WP_080626767.1|977765_978266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588499.1|978265_978469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626768.1|978465_979815_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.6	1.7e-125
WP_080626769.1|979836_980856_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	9.5e-73
>prophage 4
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	984585	1066965	4326347	protease,terminase,tail,tRNA,holin,head,transposase,portal,capsid	Bacillus_phage(44.44%)	91	NA	NA
WP_017474282.1|984585_985341_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.8	1.1e-52
WP_080626771.1|985364_985796_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	8.8e-12
WP_080626772.1|985836_986916_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	36.5	2.8e-14
WP_080626773.1|987121_989419_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	6.0e-123
WP_080626774.1|989419_990469_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	2.2e-80
WP_048356262.1|990468_990789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664248.1|990785_991304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626776.1|991309_991675_+	hypothetical protein	NA	M4HNF9	Bacillus_phage	38.1	1.7e-11
WP_080626777.1|991679_991937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626778.1|991933_992128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626779.1|992124_992325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761926.1|992321_992471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114555277.1|992464_992827_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	55.0	9.6e-28
WP_080626780.1|992833_994933_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.4	0.0e+00
WP_006640508.1|994964_995297_+	DUF1140 family protein	NA	NA	NA	NA	NA
WP_075876064.1|995335_996304_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	4.5e-149
WP_080626781.1|996354_996936_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	2.0e-43
WP_048354323.1|996935_997163_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	78.2	6.0e-20
WP_155761927.1|997163_997334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626782.1|997338_997896_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.4	8.7e-28
WP_080626783.1|997911_998976_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	51.9	2.4e-34
WP_016885220.1|998972_999533_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	46.4	6.7e-36
WP_080626784.1|999521_999908_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	37.0	2.0e-07
WP_080626785.1|1000018_1001293_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.9e-150
WP_080626786.1|1001292_1001682_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.3	2.5e-18
WP_080626787.1|1001674_1002163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626788.1|1002251_1003052_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	7.0e-71
WP_080626789.1|1003084_1003396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626790.1|1003407_1004835_-	lipase	NA	NA	NA	NA	NA
WP_017474209.1|1004885_1005230_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_080626791.1|1005366_1005585_+	helix-turn-helix transcriptional regulator	NA	A0A1Z1DA26	Bacillus_phage	43.1	1.3e-08
WP_080626792.1|1006570_1006849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885205.1|1006838_1007213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407310.1|1007205_1007754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075443.1|1007754_1008144_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
WP_157664249.1|1008454_1008760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626794.1|1009170_1009509_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_011197905.1|1009628_1009952_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	69.8	6.8e-33
WP_080626795.1|1009926_1011708_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.1	1.9e-246
WP_073411216.1|1011719_1013018_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.2	4.3e-86
WP_069500356.1|1012971_1013718_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	2.4e-57
WP_017474201.1|1013717_1014872_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_026080791.1|1014912_1015410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|1015412_1015652_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_080626796.1|1015656_1015992_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	50.5	1.1e-22
WP_080626797.1|1015988_1016411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197913.1|1016407_1016752_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	1.0e-15
WP_011197914.1|1016760_1017342_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073411210.1|1017292_1017607_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.6	2.1e-23
WP_011197916.1|1017657_1017993_+	hypothetical protein	NA	H0USX2	Bacillus_phage	40.7	1.2e-11
WP_080626798.1|1018235_1023536_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	42.6	8.1e-99
WP_069500360.1|1023536_1024358_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.5	1.5e-65
WP_069500361.1|1024367_1025894_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.3	8.4e-49
WP_080627101.1|1027412_1027985_+	hypothetical protein	NA	A0A2I7S7J8	Vibrio_phage	40.4	1.3e-07
WP_080626799.1|1029457_1029754_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	50.0	1.3e-17
WP_003181188.1|1029754_1029949_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003181190.1|1029952_1030216_+|holin	holin	holin	NA	NA	NA	NA
WP_080626800.1|1030282_1031218_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	65.9	9.6e-96
WP_011197925.1|1031239_1031497_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	52.9	2.3e-20
WP_016885193.1|1031940_1032207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885192.1|1032227_1033742_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016885191.1|1033805_1034021_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069500365.1|1034180_1034999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069500366.1|1035071_1035401_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.6	2.2e-07
WP_003179971.1|1038205_1038415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179974.1|1039617_1039833_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|1039826_1040177_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|1040235_1040574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|1040599_1042324_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_100224395.1|1042598_1042886_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.8	6.4e-19
WP_009329006.1|1043116_1043557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583540.1|1048916_1050242_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|1050488_1050707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|1051094_1051859_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017474999.1|1052264_1054040_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|1054242_1055010_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_087634947.1|1055006_1056020_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|1056016_1056853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|1056866_1057997_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071583541.1|1058027_1058486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|1058482_1058689_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|1059238_1059451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|1059558_1060305_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_080626803.1|1060270_1061740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699457.1|1061729_1062638_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|1062634_1062919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|1063026_1063296_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|1063620_1064250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583959.1|1064330_1065479_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|1065542_1066448_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085959525.1|1066482_1066965_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	1395064	1462328	4326347	tail,terminase,holin,portal,plate,coat	Bacillus_phage(27.78%)	81	NA	NA
WP_009328811.1|1395064_1395514_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1395664_1396153_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1396284_1396797_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1396867_1397266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1397314_1397701_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1397847_1398204_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1398490_1398700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1398779_1398911_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1399040_1399298_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|1399336_1401619_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|1401740_1401998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1402037_1402625_-	DedA family protein	NA	NA	NA	NA	NA
WP_009328799.1|1403702_1404593_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|1404615_1405011_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1405175_1405595_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1405604_1406114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|1406178_1406901_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|1406891_1407224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|1407417_1407906_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|1407986_1408934_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|1409242_1410367_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_011197788.1|1410356_1411532_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1411577_1412768_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|1412941_1413511_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1413500_1413785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|1413960_1415334_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_080626900.1|1415638_1416625_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|1417226_1417310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|1417748_1417928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|1417961_1418540_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|1418626_1418914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|1419121_1420012_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|1420332_1422162_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_080626901.1|1422189_1423908_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|1423965_1424853_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|1424944_1425817_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|1425864_1426242_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|1426285_1426834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|1427286_1428021_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|1428076_1429501_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_075223542.1|1429516_1430095_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075223543.1|1430107_1430443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1430471_1430885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1431259_1431742_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|1434012_1434660_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|1434673_1435330_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|1435518_1435872_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|1436044_1436305_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|1436294_1436591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624211.1|1436591_1437422_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_035317447.1|1437321_1438122_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	6.1e-59
WP_003180798.1|1438392_1438734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1438730_1438934_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1439054_1439558_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1439700_1440501_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1440497_1441796_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|1441799_1443314_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|1443321_1444170_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1444187_1445123_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|1445210_1445591_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|1445587_1445944_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080626902.1|1445940_1446429_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.2	3.8e-35
WP_003180824.1|1446441_1446882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1446882_1447107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|1447106_1448453_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|1448454_1448898_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1449080_1449530_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1449571_1449709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626903.1|1449712_1453495_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1453487_1454144_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|1454200_1455181_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1455177_1455486_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1455504_1455930_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|1455922_1456966_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1456952_1457873_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1457886_1458273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|1458288_1459494_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|1459531_1460563_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|1460665_1460935_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|1460949_1461213_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|1461263_1462328_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
>prophage 6
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	2463244	2475424	4326347		Staphylococcus_phage(55.56%)	15	NA	NA
WP_080626939.1|2463244_2463838_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.0e-14
WP_009327962.1|2463827_2464583_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|2464765_2464861_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2464981_2465503_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2465513_2465888_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2465989_2466454_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|2466488_2467685_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|2467706_2468354_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183120.1|2468365_2469454_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	6.6e-64
WP_003183123.1|2469814_2470159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183125.1|2470421_2472608_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|2472734_2473172_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2473330_2473636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|2473625_2474756_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_080626940.1|2474986_2475424_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	43.3	3.2e-17
>prophage 7
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	2868107	2960363	4326347	protease,tail,terminase,tRNA,holin,head,portal,capsid,plate,coat	Bacillus_phage(82.22%)	96	NA	NA
WP_069500660.1|2868107_2869136_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2869176_2869377_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2869369_2870374_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_003183986.1|2870383_2870989_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2871111_2871633_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003183988.1|2871875_2872526_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2872803_2872983_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2873078_2873543_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003183992.1|2873603_2874314_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2874727_2874907_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_003183994.1|2874998_2875325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2875466_2876189_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080626953.1|2877861_2878497_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184007.1|2879836_2880946_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2880967_2881807_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2881787_2883362_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|2883462_2884641_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2884609_2885152_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2885195_2886065_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2886073_2886517_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_080626954.1|2886630_2887917_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2887949_2888528_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2888753_2889035_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2889047_2889389_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2889401_2889710_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2889866_2890733_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|2890725_2891517_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2891662_2892091_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_061578553.1|2892090_2892411_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2892455_2893262_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2893264_2893945_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2893999_2894518_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2894514_2895423_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2895453_2896464_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_080626955.1|2897063_2897648_+	hypothetical protein	NA	Q9ZXD6	Bacillus_phage	26.1	6.3e-05
WP_080626956.1|2897746_2898115_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_035338316.1|2898337_2899459_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_025807654.1|2899711_2901328_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|2901340_2901757_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_080626957.1|2901787_2902741_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	1.2e-61
WP_069500507.1|2902788_2903052_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_069500916.1|2903067_2903337_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_039072971.1|2903400_2903583_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_069500506.1|2903579_2903903_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	5.8e-08
WP_080626958.1|2903915_2905355_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	40.5	9.4e-58
WP_080626959.1|2905393_2906947_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	77.2	7.3e-234
WP_017475032.1|2908704_2909541_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
WP_009329202.1|2913625_2913961_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_157664251.1|2914029_2914629_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	1.1e-55
WP_080626963.1|2915672_2916023_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	59.1	2.8e-32
WP_009329208.1|2916038_2916488_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|2916513_2917830_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_025807960.1|2917870_2918500_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330396.1|2918489_2919734_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	6.1e-207
WP_009330378.1|2919921_2921631_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_017475038.1|2921630_2922164_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_017475039.1|2922250_2922577_-	hypothetical protein	NA	Q9T203	Bacillus_phage	56.5	3.7e-31
WP_087634980.1|2922545_2922920_-	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	5.8e-60
WP_017475040.1|2923079_2923724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185368.1|2923942_2924167_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|2924916_2925297_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|2925409_2925787_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_009329249.1|2925802_2926318_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_017695850.1|2926321_2926492_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_017474566.1|2926488_2927028_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_080626964.1|2927024_2927462_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	1.5e-62
WP_080626965.1|2927439_2927811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626966.1|2928031_2930464_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_017474381.1|2930524_2930965_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.0	2.9e-71
WP_017474382.1|2930983_2931337_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	56.6	3.9e-26
WP_080626967.1|2931326_2932262_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.0	3.2e-160
WP_057957666.1|2932265_2932823_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_069500681.1|2933016_2933286_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	55.8	9.0e-23
WP_048355993.1|2933282_2933474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626968.1|2933624_2933864_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	3.3e-16
WP_048355991.1|2934113_2934557_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.9	4.9e-42
WP_048355990.1|2934588_2935068_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.9	1.3e-43
WP_080626969.1|2935107_2936496_+	recombinase family protein	NA	Q9T200	Bacillus_phage	60.5	6.9e-159
WP_009329283.1|2936508_2936895_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003184048.1|2936949_2937522_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|2937675_2938707_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|2938910_2939660_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|2939802_2941107_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184058.1|2944285_2944477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|2944496_2945519_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|2945546_2947004_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|2947152_2948448_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|2948473_2949448_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_080626970.1|2949451_2950243_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009329302.1|2950232_2951174_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011198166.1|2951213_2952044_-	cytochrome c	NA	NA	NA	NA	NA
WP_009329306.1|2952049_2953411_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2953599_2954085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2954133_2954721_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_080626972.1|2957259_2958915_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2959097_2960363_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 8
NZ_CP021677	Bacillus licheniformis strain SRCM100027 chromosome, complete genome	4326347	3302667	3342215	4326347	tail,protease,terminase,holin,head,transposase,portal,capsid,plate,coat,integrase	Bacillus_phage(62.86%)	48	3300368:3300427	3342308:3342383
3300368:3300427	attL	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAA	NA	NA	NA	NA
WP_087635001.1|3302667_3303102_+	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	47.9	3.4e-27
WP_080627000.1|3303098_3303503_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_080627001.1|3303504_3303702_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	65.0	3.9e-15
WP_080627002.1|3303998_3305498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080627003.1|3305512_3305911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627004.1|3305956_3307036_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	53.0	5.2e-45
WP_080627005.1|3307087_3307351_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.3e-31
WP_071583811.1|3307366_3307636_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.3e-25
WP_080627006.1|3307698_3307881_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_080627007.1|3307877_3308201_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_080627106.1|3308213_3309560_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	42.3	1.9e-65
WP_080627008.1|3309576_3312222_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	1.4e-293
WP_080627009.1|3312258_3313971_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.6	1.2e-216
WP_080627011.1|3314818_3319288_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-70
WP_043054229.1|3319496_3319862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054228.1|3319915_3320533_-|tail	tail protein	tail	NA	NA	NA	NA
WP_043054227.1|3320547_3320931_-	phage protein	NA	NA	NA	NA	NA
WP_043054226.1|3320927_3321326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627012.1|3321325_3321634_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	9.7e-13
WP_003185351.1|3321623_3321926_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_065643430.1|3321946_3322372_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.0	2.9e-15
WP_075646713.1|3322394_3323675_-|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.8	2.6e-75
WP_080627013.1|3323744_3324476_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	8.9e-57
WP_071583905.1|3324420_3325731_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.3	3.2e-105
WP_035316082.1|3325731_3325923_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_071583906.1|3325935_3327645_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.8	2.1e-210
WP_071583907.1|3327641_3328157_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	6.3e-33
WP_080627014.1|3328387_3328762_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.8e-29
WP_080627015.1|3328788_3329097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|3329311_3329536_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003185369.1|3330274_3330655_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_080627017.1|3331029_3331854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627107.1|3331937_3332132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627018.1|3332255_3332771_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_003185375.1|3332773_3332944_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
WP_080627019.1|3332940_3333480_-	nuclease	NA	Q9ZXC2	Bacillus_phage	91.1	5.9e-90
WP_080627020.1|3333476_3333914_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	4.2e-62
WP_080627021.1|3334182_3336621_-	DNA primase	NA	D6R422	Bacillus_phage	80.3	0.0e+00
WP_061578359.1|3336681_3337122_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
WP_080627022.1|3337121_3338054_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.4	1.2e-154
WP_080627023.1|3338057_3338615_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.6e-69
WP_080627024.1|3338707_3338950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627025.1|3339043_3339310_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.2	9.5e-17
WP_017474831.1|3339433_3339703_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	50.0	8.4e-21
WP_026587143.1|3339708_3339894_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_080627026.1|3340162_3340591_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	65.2	1.2e-45
WP_080627027.1|3340599_3341022_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	61.6	2.0e-45
WP_080627028.1|3341066_3342215_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	34.6	3.6e-52
3342308:3342383	attR	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAACATGTTGACTTTGTAT	NA	NA	NA	NA
>prophage 1
NZ_CP021678	Bacillus licheniformis strain SRCM100027 plasmid pBL027-1 sequence	100616	25954	84384	100616	tail,holin	Bacillus_phage(86.79%)	76	NA	NA
WP_080626823.1|25954_26194_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	58.9	1.7e-17
WP_080626824.1|26215_26404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626825.1|26507_26720_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_080626826.1|26716_27037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634952.1|27026_27386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634953.1|27481_28156_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	49.3	2.8e-41
WP_157664254.1|28130_28331_+	hypothetical protein	NA	U5PTI4	Bacillus_phage	45.6	4.3e-06
WP_080626827.1|28330_30085_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	43.4	4.5e-123
WP_080626829.1|30507_30735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626830.1|30960_31707_+	DUF3603 family protein	NA	A0A109ZRE1	Bacillus_phage	34.9	3.5e-32
WP_087634999.1|31729_32122_+	dCMP deaminase family protein	NA	F8WPT6	Bacillus_phage	72.8	2.8e-49
WP_157664255.1|32105_32375_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	38.8	4.5e-06
WP_071583448.1|32498_32732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626833.1|32734_32932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583450.1|33117_33519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626834.1|33515_33827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626835.1|33926_34709_+	hypothetical protein	NA	A0A0E3M0X6	Bacillus_phage	31.3	2.7e-27
WP_142396725.1|34715_35207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626837.1|35181_35883_+	hypothetical protein	NA	A0A0E3X9H9	Bacillus_phage	38.6	1.5e-37
WP_080626838.1|35896_36394_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	51.2	1.3e-30
WP_080626839.1|36492_37137_+	hypothetical protein	NA	A0A1D6X8E5	Bacillus_phage	39.3	5.2e-08
WP_080626840.1|37265_37544_+	hypothetical protein	NA	U5PY47	Bacillus_phage	50.0	8.7e-13
WP_080626841.1|37543_38101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626842.1|38123_38897_+	hypothetical protein	NA	U5Q178	Bacillus_phage	50.2	3.4e-70
WP_080626843.1|38958_39261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583460.1|39739_40417_+	hypothetical protein	NA	A0A1D6X837	Bacillus_phage	33.3	1.5e-21
WP_080626844.1|40416_42003_+	hypothetical protein	NA	S5MLT2	Bacillus_phage	36.7	1.2e-93
WP_080626845.1|42095_43454_+	hypothetical protein	NA	A0A0E3JT25	Bacillus_phage	58.9	1.4e-148
WP_080626846.1|43470_44520_+	hypothetical protein	NA	A0A1D6X836	Bacillus_phage	41.6	1.2e-59
WP_071583464.1|44540_44960_+	hypothetical protein	NA	U5PXS9	Bacillus_phage	56.9	1.6e-29
WP_080626847.1|44989_45919_+	hypothetical protein	NA	A0A0E3X9I2	Bacillus_phage	58.7	3.6e-95
WP_071583466.1|45991_46390_+	hypothetical protein	NA	A0A0E3T6A9	Bacillus_phage	40.5	1.3e-14
WP_157664256.1|46443_46755_+	hypothetical protein	NA	A0A0E3T7L9	Bacillus_phage	59.4	9.1e-27
WP_155761930.1|46754_46916_+	hypothetical protein	NA	U5Q1C8	Bacillus_phage	58.7	1.0e-05
WP_142396723.1|46931_47438_+	hypothetical protein	NA	U5PWF3	Bacillus_phage	74.4	4.4e-63
WP_071583469.1|47466_47712_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_080626850.1|47779_48499_+	hypothetical protein	NA	A0A1D6X862	Bacillus_phage	36.0	2.3e-28
WP_080626851.1|48517_48988_+	hypothetical protein	NA	U5Q195	Bacillus_phage	59.5	4.0e-42
WP_157664257.1|49205_49703_+	hypothetical protein	NA	U5PWN1	Bacillus_phage	42.6	1.7e-27
WP_080626853.1|49695_50193_+	hypothetical protein	NA	U5PXK0	Bacillus_phage	37.2	6.8e-24
WP_080626854.1|50198_50663_+	hypothetical protein	NA	S5MLT8	Bacillus_phage	41.1	2.9e-29
WP_080626855.1|50675_56636_+|tail	phage tail tape measure protein	tail	A0A0E3M0Y3	Bacillus_phage	56.4	5.7e-08
WP_080626856.1|56635_56998_+	hypothetical protein	NA	A0A0E3T7M6	Bacillus_phage	55.4	2.6e-33
WP_157664258.1|57053_61124_+	hypothetical protein	NA	S5M839	Bacillus_phage	45.5	1.2e-137
WP_080626858.1|61143_63546_+	hypothetical protein	NA	U5PU90	Bacillus_phage	47.7	2.3e-165
WP_080626859.1|63566_64106_+	hypothetical protein	NA	A0A0C5K986	Enterococcus_phage	29.7	3.7e-15
WP_080626860.1|64127_64592_+	hypothetical protein	NA	G3MBS8	Bacillus_virus	33.6	3.1e-15
WP_080626861.1|64691_64994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626862.1|65021_66101_+	LysM peptidoglycan-binding domain-containing protein	NA	D6QWP3	uncultured_phage	33.6	3.4e-20
WP_080626863.1|66113_66398_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	42.2	6.6e-08
WP_080626864.1|66472_66838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626865.1|66896_67415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626866.1|67425_67977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626867.1|67973_68822_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	52.1	3.3e-79
WP_080626868.1|68808_69324_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.3	7.0e-24
WP_080626869.1|69334_70066_-	PD-(D/E)XK nuclease family protein	NA	U5Q092	Bacillus_phage	48.1	9.9e-64
WP_080626870.1|70065_70692_-	3'-5' exonuclease	NA	A0A0E3XAP0	Bacillus_phage	39.0	4.1e-26
WP_071583484.1|70719_70902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626871.1|70917_71928_-	toprim domain-containing protein	NA	S5M855	Bacillus_phage	48.7	2.8e-85
WP_071583486.1|71930_72110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626872.1|72165_73506_-	hypothetical protein	NA	A0A1D6X893	Bacillus_phage	53.1	5.9e-123
WP_080626873.1|73498_74038_-	hypothetical protein	NA	A0A0E3X9J6	Bacillus_phage	45.6	2.5e-32
WP_157664259.1|74067_74760_-	sigma-70 family RNA polymerase sigma factor	NA	U5Q0I1	Bacillus_phage	38.9	7.2e-32
WP_080626875.1|74828_75041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626876.1|75033_75420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626877.1|75492_75777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626878.1|75841_76285_-	hypothetical protein	NA	S5MLV8	Bacillus_phage	49.0	9.0e-28
WP_080626879.1|76343_77012_-	AAA family ATPase	NA	F8WPX9	Bacillus_phage	47.1	3.5e-39
WP_080626880.1|77042_77588_-	hypothetical protein	NA	A0A0E3X9N2	Bacillus_phage	26.0	2.4e-06
WP_080626881.1|77611_78151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626882.1|78180_79182_-	AAA family ATPase	NA	A0A0E3T6D1	Bacillus_phage	47.5	9.7e-70
WP_080626883.1|79171_79429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626884.1|79492_80443_-	hypothetical protein	NA	A0A0E3JJ53	Bacillus_phage	44.6	6.4e-55
WP_080626885.1|80551_81592_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3JQ77	Bacillus_phage	67.4	9.9e-134
WP_080626886.1|81667_83998_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0E3M3E9	Bacillus_phage	57.6	3.2e-257
WP_080626887.1|84009_84384_-	hypothetical protein	NA	U5PXN9	Bacillus_phage	49.5	5.5e-18
