The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021529	Pediococcus acidilactici strain SRCM101189 chromosome, complete genome	2025732	516701	526186	2025732		Enterococcus_phage(33.33%)	8	NA	NA
WP_065124524.1|516701_518129_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.8	8.5e-11
WP_008841791.1|518139_518715_-	ABC superfamily ATP-binding cassette transporter membrane protein	NA	NA	NA	NA	NA
WP_002831168.1|519164_519905_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	3.1e-17
WP_065124525.1|520427_522578_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	4.7e-255
WP_065124526.1|522588_523176_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.4	1.0e-50
WP_065124527.1|523190_523967_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	3.1e-07
WP_065124528.1|523947_525009_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_065124529.1|525010_526186_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	5.2e-83
>prophage 2
NZ_CP021529	Pediococcus acidilactici strain SRCM101189 chromosome, complete genome	2025732	850632	902121	2025732	terminase,tail,portal,plate,tRNA,capsid,holin	Lactobacillus_phage(56.0%)	66	NA	NA
WP_005916670.1|850632_851370_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005916672.1|851550_852216_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.0	2.7e-20
WP_004165726.1|852199_852955_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_002831503.1|853070_853442_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_065124819.1|853676_854267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831506.1|854564_854891_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	34.3	1.2e-05
WP_065124818.1|854912_855245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831508.1|855641_856091_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_005916684.1|856103_857063_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002831510.1|857089_857326_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_065124817.1|857352_858297_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_065124816.1|858381_859110_+	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	28.2	1.7e-07
WP_065124815.1|859125_860352_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_065124814.1|860356_860782_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_002831515.1|860793_861204_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002831516.1|861220_862588_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_008842117.1|862577_863402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831518.1|863418_864186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124813.1|864202_864961_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_065124812.1|866361_867168_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_144235586.1|867169_868021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081276412.1|868035_869232_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	39.1	4.6e-18
WP_065124811.1|869304_869712_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_008840853.1|869723_870086_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.2e-15
WP_065124810.1|870228_870459_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008840855.1|870455_870593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124809.1|870595_870820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124808.1|870886_871102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124825.1|871204_871651_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065124807.1|871651_871933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157420393.1|871934_872078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124806.1|872170_873064_+	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	31.1	2.9e-25
WP_065124805.1|873066_873903_+	hypothetical protein	NA	Q9G0C9	Lactococcus_phage	42.7	1.2e-12
WP_065124804.1|873895_874729_+	helix-turn-helix domain-containing protein	NA	A0A097BYA5	Leuconostoc_phage	53.5	2.9e-43
WP_021361655.1|874733_875456_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	67.0	4.1e-86
WP_065124803.1|875400_875808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124802.1|875810_876257_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	62.5	2.8e-37
WP_065124801.1|876267_876615_+	DUF1642 domain-containing protein	NA	NA	NA	NA	NA
WP_065124800.1|876611_876836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153903504.1|876855_877014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124799.1|877353_877785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124798.1|878397_879066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032540563.1|879134_879821_+|terminase	terminase	terminase	V5URT8	Oenococcus_phage	42.5	2.5e-16
WP_021361666.1|879804_881118_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	60.5	3.3e-150
WP_050585101.1|881129_882659_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	54.2	2.3e-147
WP_081276410.1|882655_883789_+	hypothetical protein	NA	U3PFU0	Lactobacillus_phage	30.6	6.9e-40
WP_021361667.1|883888_884461_+	phage minor structural GP20 family protein	NA	Q9T1B8	Listeria_phage	39.0	3.5e-24
WP_065124797.1|884473_885343_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	66.8	8.6e-107
WP_065124796.1|885413_885830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124795.1|885826_886177_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	57.1	3.9e-26
WP_065124794.1|886176_886521_+	hypothetical protein	NA	O03933	Lactobacillus_phage	43.2	1.4e-15
WP_065124793.1|886520_886916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124791.1|887544_888012_+	Ig domain-containing protein	NA	A0A220BZ11	Staphylococcus_phage	48.4	3.0e-21
WP_065124790.1|888087_888480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124789.1|888489_889110_+	hypothetical protein	NA	O03936	Lactobacillus_phage	41.6	7.1e-31
WP_065124788.1|889143_894261_+	tape measure protein	NA	O03937	Lactobacillus_phage	29.4	7.5e-25
WP_065124787.1|894262_895087_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	25.9	3.0e-16
WP_081276409.1|895092_896214_+	hypothetical protein	NA	O03938	Lactobacillus_phage	42.1	2.8e-78
WP_065124785.1|896206_896437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124784.1|896417_896828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124783.1|896817_897855_+|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	35.5	6.8e-18
WP_065124782.1|897867_898689_+	collagen-like protein	NA	NA	NA	NA	NA
WP_065124781.1|898704_900195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144235585.1|900270_900516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124779.1|900515_900770_+|holin	holin	holin	NA	NA	NA	NA
WP_065124778.1|900753_902121_+	1,4-beta-N-acetylmuramidase	NA	A0A1X9IGI4	Lactococcus_phage	60.5	2.7e-78
>prophage 3
NZ_CP021529	Pediococcus acidilactici strain SRCM101189 chromosome, complete genome	2025732	1058386	1066949	2025732		Synechococcus_phage(33.33%)	9	NA	NA
WP_008840996.1|1058386_1058968_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	8.8e-23
WP_008840997.1|1058967_1060014_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	38.7	2.7e-54
WP_065124110.1|1060016_1061486_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	3.6e-57
WP_065124111.1|1061470_1063675_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	1.1e-145
WP_065124112.1|1063692_1064367_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_065124113.1|1064363_1064624_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_065124114.1|1064610_1065345_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	4.8e-42
WP_138492686.1|1065322_1066486_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_065124116.1|1066466_1066949_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	7.0e-18
>prophage 4
NZ_CP021529	Pediococcus acidilactici strain SRCM101189 chromosome, complete genome	2025732	1107432	1114754	2025732	tRNA	Staphylococcus_phage(28.57%)	8	NA	NA
WP_008841054.1|1107432_1108278_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
WP_008841055.1|1108325_1108553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008841056.1|1108674_1109157_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	39.1	3.6e-22
WP_005917050.1|1109174_1110125_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.0e-113
WP_008841057.1|1110129_1112025_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.9e-50
WP_065124147.1|1112027_1113236_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.5	2.9e-44
WP_008841059.1|1113351_1114221_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.8	1.2e-55
WP_065124148.1|1114283_1114754_-	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
>prophage 5
NZ_CP021529	Pediococcus acidilactici strain SRCM101189 chromosome, complete genome	2025732	1181049	1241248	2025732	transposase,terminase,tail,integrase,protease,portal,capsid,head,holin	Lactobacillus_phage(71.79%)	79	1198820:1198850	1241380:1241410
WP_144235580.1|1181049_1182333_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	1.6e-45
WP_065124177.1|1182383_1183142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124178.1|1183239_1183764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124179.1|1183908_1184577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124180.1|1184577_1185096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124181.1|1185061_1186324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124182.1|1186700_1187195_-	hypothetical protein	NA	A0A097BY45	Enterococcus_phage	34.8	6.5e-19
WP_065124183.1|1187239_1187446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124184.1|1187448_1187727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124185.1|1187723_1187909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157420395.1|1187893_1188055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124186.1|1188205_1188430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124188.1|1188634_1188904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124190.1|1189083_1190019_-	DnaD domain protein	NA	Q9AZA0	Lactobacillus_prophage	49.5	2.8e-39
WP_065124191.1|1190035_1190497_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	66.2	1.7e-37
WP_065124192.1|1190640_1191453_+	DUF4393 domain-containing protein	NA	A0A0N7GFI3	Staphylococcus_phage	24.3	3.8e-08
WP_065124193.1|1191432_1191678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124194.1|1191731_1192070_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_065124195.1|1193032_1193530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124196.1|1193492_1193699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124197.1|1193706_1194156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124198.1|1194152_1194386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124199.1|1194655_1195036_+	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	39.3	2.8e-14
WP_157420397.1|1195048_1195186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157420399.1|1195217_1195466_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065124200.1|1195521_1196058_+	hypothetical protein	NA	Q38183	Lactococcus_phage	47.6	1.4e-35
WP_065124201.1|1196219_1196774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124202.1|1196914_1197223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124203.1|1197367_1198516_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.2	4.8e-89
1198820:1198850	attL	AGGTACTAATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
WP_024862287.1|1199927_1200170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024862286.1|1200287_1200647_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	5.4e-15
WP_002830385.1|1200662_1200926_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	82.8	8.8e-31
WP_036672440.1|1200925_1202056_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.4	2.4e-45
WP_002830387.1|1202100_1202460_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	78.2	1.1e-44
WP_002830389.1|1202474_1202723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830391.1|1202764_1202974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830394.1|1202966_1203194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830396.1|1206320_1208705_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	89.9	0.0e+00
WP_002830397.1|1208769_1210539_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	89.3	0.0e+00
WP_065124204.1|1210615_1215466_-	transglycosylase SLT domain-containing protein	NA	A0A2P0ZLG0	Lactobacillus_phage	51.8	9.8e-293
WP_002831798.1|1215495_1215681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831799.1|1215725_1216100_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	96.0	3.2e-58
WP_002831800.1|1216176_1216866_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.2	1.0e-107
WP_065124205.1|1216879_1217260_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	4.1e-61
WP_002831803.1|1217259_1217667_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	87.9	3.9e-62
WP_002831805.1|1217669_1218017_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	67.0	1.8e-39
WP_002831807.1|1218006_1218339_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.2	1.0e-44
WP_002831808.1|1218411_1219644_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.9	4.1e-211
WP_065124206.1|1219643_1220387_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	95.1	9.2e-126
WP_065124207.1|1220364_1221528_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	93.2	1.4e-208
WP_065124208.1|1221530_1221725_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	6.3e-26
WP_065124209.1|1221714_1223613_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.5	0.0e+00
WP_065124210.1|1223615_1224065_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.3	3.0e-79
WP_081276383.1|1224269_1224737_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	1.8e-82
WP_065124212.1|1225243_1225687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036672512.1|1225887_1226076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124213.1|1226262_1226511_-	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	59.5	3.7e-23
WP_036672515.1|1226897_1227143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058121180.1|1227143_1227437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830736.1|1227603_1227975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609172.1|1228153_1228789_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_065124215.1|1228788_1229016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124216.1|1229015_1229447_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	55.6	1.5e-40
WP_065124217.1|1229443_1229860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124218.1|1229859_1231092_-	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	36.6	7.7e-61
WP_065124219.1|1231081_1231876_-	hypothetical protein	NA	A0A0A0RQ10	Bacillus_phage	53.4	1.0e-34
WP_065124220.1|1231896_1232424_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	48.5	1.1e-29
WP_065124221.1|1232423_1233179_-	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	55.3	4.4e-67
WP_081276381.1|1233179_1233635_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_065124223.1|1233861_1234479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124224.1|1234748_1235078_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002830432.1|1235091_1235814_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	51.1	2.2e-55
WP_065124225.1|1235827_1236037_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065124226.1|1236292_1236634_+	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	38.1	2.3e-15
WP_036672412.1|1236642_1237050_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.1	6.8e-14
WP_002830434.1|1237112_1238240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036672414.1|1238386_1238584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002830435.1|1238990_1239992_+	Abi family protein	NA	M1PS09	Streptococcus_phage	35.7	1.2e-48
WP_002830436.1|1240132_1241248_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	51.9	2.2e-99
1241380:1241410	attR	AGGTACTAATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
