The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	173599	180536	4544416		uncultured_Caudovirales_phage(50.0%)	11	NA	NA
WP_080626760.1|173599_173923_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	35.7	1.4e-06
WP_080626761.1|174097_174433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626762.1|174429_174675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761925.1|174674_174848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626763.1|174848_175175_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	36.1	9.9e-08
WP_080626765.1|175526_175910_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.7	6.0e-20
WP_080626766.1|176681_177476_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	52.3	4.8e-64
WP_080626767.1|177445_177946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588499.1|177945_178149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626768.1|178145_179495_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.6	1.7e-125
WP_080626769.1|179516_180536_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	9.5e-73
>prophage 2
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	184265	273577	4544416	plate,integrase,portal,holin,protease,terminase,tail,transposase,head,tRNA,capsid	Bacillus_phage(44.9%)	99	236374:236389	273997:274012
WP_017474282.1|184265_185021_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.8	1.1e-52
WP_080626771.1|185043_185475_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	8.8e-12
WP_080626772.1|185515_186595_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	36.5	2.8e-14
WP_080626773.1|186800_189098_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	6.0e-123
WP_080626774.1|189098_190148_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	2.2e-80
WP_048356262.1|190147_190468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664248.1|190464_190983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626776.1|190988_191354_+	hypothetical protein	NA	M4HNF9	Bacillus_phage	38.1	1.7e-11
WP_080626777.1|191358_191616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626778.1|191612_191807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626779.1|191803_192004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761926.1|192000_192150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114555277.1|192143_192506_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	55.0	9.6e-28
WP_080626780.1|192512_194612_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.4	0.0e+00
WP_006640508.1|194643_194976_+	DUF1140 family protein	NA	NA	NA	NA	NA
WP_075876064.1|195014_195983_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	4.5e-149
WP_080626781.1|196033_196615_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	2.0e-43
WP_048354323.1|196614_196842_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	78.2	6.0e-20
WP_155761927.1|196842_197013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626782.1|197017_197575_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.4	8.7e-28
WP_080626783.1|197590_198655_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	51.9	2.4e-34
WP_016885220.1|198651_199212_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	46.4	6.7e-36
WP_080626784.1|199200_199587_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	37.0	2.0e-07
WP_080626785.1|199697_200972_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.9e-150
WP_080626786.1|200971_201361_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.3	2.5e-18
WP_080626787.1|201353_201842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626788.1|201930_202731_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	7.0e-71
WP_080626789.1|202763_203075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626790.1|203086_204514_-	lipase	NA	NA	NA	NA	NA
WP_017474209.1|204564_204909_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_080626791.1|205045_205264_+	helix-turn-helix transcriptional regulator	NA	A0A1Z1DA26	Bacillus_phage	43.1	1.3e-08
WP_080626792.1|206249_206528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885205.1|206517_206892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407310.1|206884_207433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075443.1|207433_207823_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
WP_080626793.1|208139_208439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626794.1|208849_209188_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_011197905.1|209306_209630_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	69.8	6.8e-33
WP_080626795.1|209604_211386_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.1	1.9e-246
WP_073411216.1|211397_212696_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.2	4.3e-86
WP_069500356.1|212649_213396_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	2.4e-57
WP_017474201.1|213395_214550_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_026080791.1|214590_215088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|215090_215330_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_080626796.1|215334_215670_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	50.5	1.1e-22
WP_080626797.1|215666_216089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197913.1|216085_216430_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	1.0e-15
WP_011197914.1|216438_217020_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073411210.1|216970_217285_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.6	2.1e-23
WP_011197916.1|217335_217671_+	hypothetical protein	NA	H0USX2	Bacillus_phage	40.7	1.2e-11
WP_080626798.1|217913_223214_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	42.6	8.1e-99
WP_069500360.1|223214_224036_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.5	1.5e-65
WP_069500361.1|224045_225572_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.3	8.4e-49
WP_087634998.1|227090_227663_+	hypothetical protein	NA	A0A2I7S7J8	Vibrio_phage	39.4	3.9e-07
WP_087634946.1|227683_229123_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	58.5	6.0e-97
WP_080626799.1|229135_229432_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	50.0	1.3e-17
WP_003181188.1|229432_229627_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003181190.1|229630_229894_+|holin	holin	holin	NA	NA	NA	NA
WP_080626800.1|229960_230896_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	65.9	9.6e-96
WP_011197925.1|230917_231175_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	52.9	2.3e-20
WP_016885193.1|231618_231885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885192.1|231905_233420_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016885191.1|233483_233699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069500365.1|233858_234677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069500366.1|234749_235079_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.6	2.2e-07
236374:236389	attL	TTAAAAATTCAAGAGG	NA	NA	NA	NA
WP_003179971.1|237883_238093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179974.1|239295_239511_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|239504_239855_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|239913_240252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|240277_242002_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_100224395.1|242276_242564_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.8	6.4e-19
WP_009329006.1|242794_243235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583540.1|247045_248371_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|248617_248836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|249223_249988_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017474999.1|250393_252169_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|252371_253139_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_087634947.1|253135_254149_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|254145_254982_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|254995_256126_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071583541.1|256156_256615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|256611_256818_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|257367_257580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|257687_258434_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_080626803.1|258399_259869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699457.1|259858_260767_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|260763_261048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|261155_261425_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|261749_262379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583959.1|262459_263608_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|263671_264577_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085959525.1|264611_265094_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003180021.1|265185_265800_+	YhbD family protein	NA	NA	NA	NA	NA
WP_003180023.1|265814_266525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180026.1|266539_267241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328994.1|267641_269537_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.6	3.3e-103
WP_071583884.1|270618_272211_-	hypothetical protein	NA	I3VYZ3	Thermoanaerobacterium_phage	24.6	1.2e-32
WP_087634948.1|272382_272571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583886.1|272692_273577_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	40.4	4.1e-56
273997:274012	attR	TTAAAAATTCAAGAGG	NA	NA	NA	NA
>prophage 3
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	289908	347484	4544416	holin,tail	Bacillus_phage(88.0%)	74	NA	NA
WP_080626823.1|289908_290148_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	58.9	1.7e-17
WP_080626824.1|290169_290358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626825.1|290461_290674_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_080626826.1|290670_290991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634952.1|290980_291340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634953.1|291435_292110_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	49.3	2.8e-41
WP_157664254.1|292084_292285_+	hypothetical protein	NA	O64134	Bacillus_phage	57.4	4.2e-09
WP_087634955.1|292284_294039_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	43.4	2.7e-123
WP_155761929.1|294258_294411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634956.1|294462_294690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626830.1|294915_295662_+	DUF3603 family protein	NA	A0A109ZRE1	Bacillus_phage	34.9	3.5e-32
WP_087634999.1|295684_296077_+	dCMP deaminase family protein	NA	F8WPT6	Bacillus_phage	72.8	2.8e-49
WP_157664255.1|296060_296330_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	38.8	4.5e-06
WP_071583448.1|296453_296687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626833.1|296689_296887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583450.1|297072_297474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626834.1|297470_297782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626835.1|297881_298664_+	hypothetical protein	NA	A0A0E3T6A0	Bacillus_phage	35.3	2.8e-32
WP_080626836.1|298673_299162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626837.1|299136_299838_+	hypothetical protein	NA	A0A0E3X9H9	Bacillus_phage	38.6	1.5e-37
WP_080626838.1|299851_300349_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	51.2	1.3e-30
WP_080626839.1|300447_301092_+	hypothetical protein	NA	A0A1D6X8E5	Bacillus_phage	39.3	5.2e-08
WP_080626840.1|301220_301499_+	hypothetical protein	NA	U5PY47	Bacillus_phage	50.0	8.7e-13
WP_080626841.1|301498_302056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626842.1|302078_302852_+	hypothetical protein	NA	U5Q178	Bacillus_phage	50.2	3.4e-70
WP_080626843.1|302913_303216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583460.1|303694_304372_+	hypothetical protein	NA	A0A1D6X837	Bacillus_phage	33.3	1.5e-21
WP_080626844.1|304371_305958_+	hypothetical protein	NA	S5MLT2	Bacillus_phage	36.7	1.2e-93
WP_080626845.1|306050_307409_+	hypothetical protein	NA	A0A0E3JT25	Bacillus_phage	58.9	1.4e-148
WP_080626846.1|307425_308475_+	hypothetical protein	NA	A0A1D6X836	Bacillus_phage	41.6	1.2e-59
WP_071583464.1|308495_308915_+	hypothetical protein	NA	U5PXS9	Bacillus_phage	56.9	1.6e-29
WP_080626847.1|308944_309874_+	hypothetical protein	NA	A0A0E3X9I2	Bacillus_phage	58.7	3.6e-95
WP_071583466.1|309946_310345_+	hypothetical protein	NA	A0A0E3T6A9	Bacillus_phage	40.5	1.3e-14
WP_142396724.1|310407_310710_+	hypothetical protein	NA	A0A0E3T7L9	Bacillus_phage	58.2	2.2e-25
WP_155761930.1|310709_310871_+	hypothetical protein	NA	U5Q1C8	Bacillus_phage	58.7	1.0e-05
WP_142396723.1|310886_311393_+	hypothetical protein	NA	U5PWF3	Bacillus_phage	74.4	4.4e-63
WP_071583469.1|311421_311667_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_087634957.1|311734_312454_+	hypothetical protein	NA	A0A1D6X862	Bacillus_phage	36.0	2.9e-28
WP_087634958.1|312472_312943_+	hypothetical protein	NA	U5Q195	Bacillus_phage	59.5	5.2e-42
WP_087634959.1|313205_313658_+	hypothetical protein	NA	U5PWN1	Bacillus_phage	43.2	4.1e-28
WP_080626853.1|313650_314148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634960.1|314154_314619_+	hypothetical protein	NA	S5MLT8	Bacillus_phage	43.2	2.7e-30
WP_087634961.1|314631_320592_+|tail	phage tail tape measure protein	tail	A0A0E3M0Y3	Bacillus_phage	56.4	3.3e-08
WP_080626856.1|320591_320954_+	hypothetical protein	NA	A0A0E3T7M6	Bacillus_phage	55.4	2.6e-33
WP_087634962.1|320970_325080_+	hypothetical protein	NA	A0A1D6X857	Bacillus_phage	45.3	2.1e-142
WP_071583473.1|325099_327502_+	hypothetical protein	NA	S6B662	Bacillus_phage	47.9	1.2e-163
WP_080626859.1|327522_328062_+	hypothetical protein	NA	A0A1L2JY73	Aeribacillus_phage	42.0	2.8e-07
WP_087634963.1|328084_328534_+	hypothetical protein	NA	A0A0H3UZD0	Geobacillus_virus	47.0	1.3e-29
WP_071583476.1|328647_328950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634964.1|328977_330057_+	LysM peptidoglycan-binding domain-containing protein	NA	O64040	Bacillus_phage	68.7	2.9e-19
WP_087634965.1|330069_330354_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	41.1	1.1e-07
WP_087634966.1|330431_330794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583479.1|330851_331472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634967.1|331483_332035_-	hypothetical protein	NA	U5Q1A7	Bacillus_phage	40.6	4.0e-25
WP_087634968.1|332031_332880_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	50.0	6.9e-77
WP_071583482.1|332866_333382_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	42.1	2.4e-24
WP_081364473.1|333392_334124_-	PD-(D/E)XK nuclease family protein	NA	S5M851	Bacillus_phage	40.0	7.1e-54
WP_087634969.1|334400_335411_-	toprim domain-containing protein	NA	S5M855	Bacillus_phage	48.7	1.3e-85
WP_071583486.1|335413_335593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583487.1|335648_336989_-	hypothetical protein	NA	A0A1D6X893	Bacillus_phage	52.8	2.2e-122
WP_071583488.1|336981_337521_-	AAA family ATPase	NA	A0A0E3X9J6	Bacillus_phage	46.8	1.7e-33
WP_157665550.1|337550_338243_-	sigma-70 family RNA polymerase sigma factor	NA	U5Q0I1	Bacillus_phage	39.4	1.9e-32
WP_071583490.1|338313_338526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583491.1|338518_338905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583492.1|338977_339262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583493.1|339326_339770_-	hypothetical protein	NA	S5MLV8	Bacillus_phage	49.7	6.2e-29
WP_071583494.1|339828_340497_-	AAA family ATPase	NA	F8WPX9	Bacillus_phage	47.5	1.2e-39
WP_071583495.1|340528_341074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087634971.1|341097_341637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583497.1|341666_342668_-	AAA family ATPase	NA	A0A0E3T6D1	Bacillus_phage	47.2	1.3e-69
WP_087634972.1|342667_342916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583499.1|342979_343930_-	hypothetical protein	NA	A0A1D6X8A5	Bacillus_phage	43.4	1.1e-51
WP_087634973.1|344038_345079_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3JQ77	Bacillus_phage	67.4	1.7e-133
WP_087634974.1|345153_347484_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0E3M3E9	Bacillus_phage	57.7	1.1e-257
>prophage 4
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	671676	742700	4544416	plate,portal,holin,terminase,coat,tail	Bacillus_phage(26.32%)	86	NA	NA
WP_009328811.1|671676_672126_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|672276_672765_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|672896_673409_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|673479_673878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|673926_674313_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|674459_674816_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|675102_675312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|675391_675523_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|675652_675910_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|675948_678231_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|678352_678610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|678649_679237_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|679332_680319_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328799.1|680315_681206_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|681228_681624_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|681788_682208_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|682217_682727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|682791_683514_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|683504_683837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|684030_684519_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|684599_685547_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|685855_686980_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_011197788.1|686969_688145_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|688190_689381_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|689554_690124_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|690113_690398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|690573_691947_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_016885898.1|693838_693922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|694360_694540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|694573_695152_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|695238_695526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|695733_696624_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|696944_698774_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_080626901.1|698801_700520_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|700577_701465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|701556_702429_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|702476_702854_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|702897_703446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|703898_704633_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|704688_706113_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_075223542.1|706128_706707_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075223543.1|706719_707055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|707083_707497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|707871_708354_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|710624_711272_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|711285_711942_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|712130_712484_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|712656_712917_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|712906_713203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624211.1|713203_714034_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_035317447.1|713933_714734_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	6.1e-59
WP_155589718.1|714730_714904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180798.1|715004_715346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|715342_715546_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|715666_716170_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|716312_717113_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|717109_718408_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|718411_719926_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|719933_720782_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|720799_721735_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|721822_722203_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|722199_722556_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080626902.1|722552_723041_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.2	3.8e-35
WP_003180824.1|723053_723494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|723494_723719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|723718_725065_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|725066_725510_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|725692_726142_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|726183_726321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626903.1|726324_730107_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|730099_730756_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|730812_731793_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|731789_732098_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|732116_732542_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|732534_733578_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|733564_734485_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|734498_734885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|734900_736106_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|736143_737175_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|737277_737547_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|737561_737825_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|737875_738940_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
WP_003180863.1|739041_739719_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|739741_740758_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180867.1|740778_741876_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003180869.1|741851_742700_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 5
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	1736746	1748925	4544416		Staphylococcus_phage(55.56%)	14	NA	NA
WP_080626939.1|1736746_1737340_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.0e-14
WP_009327962.1|1737329_1738085_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|1738267_1738363_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|1738483_1739005_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|1739015_1739390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|1739491_1739956_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|1739990_1741187_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|1741208_1741856_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183120.1|1741867_1742956_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	6.6e-64
WP_003183125.1|1743922_1746109_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|1746235_1746673_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|1746831_1747137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|1747126_1748257_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_080626940.1|1748487_1748925_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	43.3	3.2e-17
>prophage 6
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	2140441	2232347	4544416	plate,holin,portal,protease,coat,terminase,tail,head,tRNA,capsid	Bacillus_phage(78.85%)	104	NA	NA
WP_003183980.1|2140441_2141587_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	5.5e-85
WP_069500660.1|2141615_2142644_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2142684_2142885_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2142877_2143882_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_003183986.1|2143891_2144497_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2144619_2145141_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003183988.1|2145383_2146034_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2146311_2146491_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2146586_2147051_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003183992.1|2147111_2147822_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2148235_2148415_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_003183994.1|2148506_2148833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2148974_2149697_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080626953.1|2149823_2150459_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184005.1|2150631_2151684_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003184007.1|2151799_2152909_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2152930_2153770_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2153750_2155325_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|2155425_2156604_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2156572_2157115_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2157158_2158028_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2158036_2158480_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_080626954.1|2158593_2159880_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2159912_2160491_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2160716_2160998_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2161010_2161352_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2161364_2161673_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2161829_2162696_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|2162688_2163480_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2163625_2164054_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_061578553.1|2164053_2164374_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2164418_2165225_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2165227_2165908_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2165962_2166481_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2166477_2167386_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2167416_2168427_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_080626955.1|2169026_2169611_+	hypothetical protein	NA	Q9ZXD6	Bacillus_phage	26.1	6.3e-05
WP_080626956.1|2169709_2170078_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_035338316.1|2170300_2171422_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_025807654.1|2171674_2173291_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|2173303_2173720_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_080626957.1|2173750_2174704_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	1.2e-61
WP_069500507.1|2174751_2175015_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_069500916.1|2175030_2175300_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_039072971.1|2175363_2175546_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_069500506.1|2175542_2175866_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	5.8e-08
WP_080626958.1|2175878_2177318_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	40.5	9.4e-58
WP_080626959.1|2177356_2178910_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	77.2	7.3e-234
WP_080626960.1|2178946_2180656_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.1	3.6e-218
WP_017475032.1|2180668_2181505_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
WP_080626961.1|2181504_2185395_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	65.1	0.0e+00
WP_009329202.1|2185592_2185928_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_080626962.1|2185988_2186597_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	1.4e-55
WP_009329204.1|2186596_2186977_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	3.0e-32
WP_009329205.1|2186973_2187357_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	70.9	4.1e-45
WP_009329206.1|2187349_2187724_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	63.9	1.2e-36
WP_080626963.1|2187653_2188004_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	59.1	2.8e-32
WP_009329208.1|2188019_2188469_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|2188494_2189811_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_025807960.1|2189851_2190481_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330396.1|2190470_2191715_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	6.1e-207
WP_009330378.1|2191902_2193612_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_017475038.1|2193611_2194145_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_017475039.1|2194231_2194558_-	hypothetical protein	NA	Q9T203	Bacillus_phage	56.5	3.7e-31
WP_087634980.1|2194526_2194901_-	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	5.8e-60
WP_017475040.1|2195060_2195705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185368.1|2195923_2196148_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|2196897_2197278_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|2197390_2197768_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_009329249.1|2197783_2198299_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_017695850.1|2198302_2198473_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_017474566.1|2198469_2199009_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_080626964.1|2199005_2199443_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	1.5e-62
WP_080626965.1|2199420_2199792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626966.1|2200013_2202446_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_017474381.1|2202506_2202947_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.0	2.9e-71
WP_017474382.1|2202965_2203319_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	56.6	3.9e-26
WP_080626967.1|2203308_2204244_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.0	3.2e-160
WP_057957666.1|2204247_2204805_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_048355993.1|2205264_2205456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626968.1|2205606_2205846_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	3.3e-16
WP_048355991.1|2206095_2206539_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.9	4.9e-42
WP_048355990.1|2206570_2207050_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.9	1.3e-43
WP_080626969.1|2207089_2208478_+	recombinase family protein	NA	Q9T200	Bacillus_phage	60.5	6.9e-159
WP_009329283.1|2208490_2208877_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003184048.1|2208931_2209504_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|2209657_2210689_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|2210892_2211642_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|2211784_2213089_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|2213164_2215807_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|2216268_2216460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|2216479_2217502_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|2217529_2218987_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|2219135_2220431_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|2220456_2221431_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_080626970.1|2221434_2222226_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009329302.1|2222215_2223157_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011198166.1|2223196_2224027_-	cytochrome c	NA	NA	NA	NA	NA
WP_009329306.1|2224032_2225394_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2225582_2226068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2226116_2226704_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_080626971.1|2226700_2229025_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	7.7e-187
WP_080626972.1|2229243_2230899_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2231081_2232347_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 7
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	2574640	2614172	4544416	plate,integrase,holin,portal,protease,terminase,coat,tail,transposase,head,capsid	Bacillus_phage(63.89%)	49	2572341:2572400	2614265:2614340
2572341:2572400	attL	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAA	NA	NA	NA	NA
WP_087635001.1|2574640_2575075_+	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	47.9	3.4e-27
WP_080627000.1|2575071_2575476_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_080627001.1|2575477_2575675_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	65.0	3.9e-15
WP_080627002.1|2575971_2577471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080627003.1|2577485_2577884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627004.1|2577929_2579009_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	53.0	5.2e-45
WP_080627005.1|2579060_2579324_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.3e-31
WP_071583811.1|2579339_2579609_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.3e-25
WP_080627006.1|2579671_2579854_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_080627007.1|2579850_2580174_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_080627106.1|2580186_2581533_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	42.3	1.9e-65
WP_080627008.1|2581549_2584195_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	1.4e-293
WP_080627009.1|2584231_2585944_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.6	1.2e-216
WP_080627010.1|2585956_2586793_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.1	1.3e-107
WP_080627011.1|2586792_2591262_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-70
WP_043054229.1|2591470_2591836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054228.1|2591889_2592507_-|tail	tail protein	tail	NA	NA	NA	NA
WP_043054227.1|2592521_2592905_-	phage protein	NA	NA	NA	NA	NA
WP_043054226.1|2592901_2593300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627012.1|2593299_2593608_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	9.7e-13
WP_003185351.1|2593597_2593900_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_065643430.1|2593920_2594346_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.0	2.9e-15
WP_075646713.1|2594368_2595649_-|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.8	2.6e-75
WP_080627013.1|2595718_2596450_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	8.9e-57
WP_071583905.1|2596394_2597705_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.3	3.2e-105
WP_035316082.1|2597705_2597897_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_071583906.1|2597909_2599619_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.8	2.1e-210
WP_071583907.1|2599615_2600131_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	6.3e-33
WP_080627014.1|2600361_2600736_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.8e-29
WP_080627015.1|2600762_2601071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|2601285_2601510_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003185369.1|2602248_2602629_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_080627017.1|2603003_2603828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627107.1|2603911_2604106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087634983.1|2604229_2604646_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.6	6.6e-65
WP_003185375.1|2604730_2604901_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
WP_080627019.1|2604897_2605437_-	nuclease	NA	Q9ZXC2	Bacillus_phage	91.1	5.9e-90
WP_080627020.1|2605433_2605871_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	4.2e-62
WP_080627021.1|2606139_2608578_-	DNA primase	NA	D6R422	Bacillus_phage	80.3	0.0e+00
WP_061578359.1|2608638_2609079_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
WP_080627022.1|2609078_2610011_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.4	1.2e-154
WP_080627023.1|2610014_2610572_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.6e-69
WP_080627024.1|2610664_2610907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627025.1|2611000_2611267_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.2	9.5e-17
WP_017474831.1|2611390_2611660_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	50.0	8.4e-21
WP_026587143.1|2611665_2611851_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_087634984.1|2612119_2612548_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.0	4.2e-46
WP_080627027.1|2612556_2612979_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	61.6	2.0e-45
WP_080627028.1|2613023_2614172_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	34.6	3.6e-52
2614265:2614340	attR	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAACATGTTGACTTTGTAT	NA	NA	NA	NA
>prophage 8
NZ_CP021669	Bacillus licheniformis strain SRCM100141 chromosome, complete genome	4544416	4294535	4304459	4544416		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|4294535_4295831_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|4295905_4296622_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|4296623_4296878_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|4296874_4297558_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|4297541_4299770_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|4299745_4301176_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|4301299_4302340_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_080626734.1|4302336_4302924_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.1e-28
WP_003179539.1|4302920_4304459_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 1
NZ_CP021670	Bacillus licheniformis strain SRCM100141 plasmid pBL141-2 sequence	205000	26850	34738	205000		Bacillus_phage(87.5%)	18	NA	NA
WP_080623745.1|26850_28026_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	42.9	1.6e-68
WP_080623743.1|28006_28390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087635023.1|28447_29155_-	single-stranded DNA-binding protein	NA	A0A2H4J1P3	uncultured_Caudovirales_phage	37.0	7.0e-06
WP_080623740.1|29218_29404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623739.1|29400_29760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623738.1|29746_30025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623737.1|30037_30331_-	hypothetical protein	NA	S5MM68	Bacillus_phage	46.5	1.7e-06
WP_080623736.1|30372_30732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623890.1|30840_31992_-	AAA family ATPase	NA	A0A172JHS6	Bacillus_phage	41.9	4.2e-69
WP_080623734.1|32068_32485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623733.1|32555_32765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623732.1|32830_33055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623730.1|33054_33261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623729.1|33257_33446_-	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	62.7	2.0e-13
WP_080623728.1|33442_33637_-	hypothetical protein	NA	R4JF30	Bacillus_phage	90.5	6.7e-28
WP_080623726.1|33757_33949_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	69.4	4.7e-18
WP_080623725.1|34048_34258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623724.1|34267_34738_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	67.1	2.1e-22
