The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	1676088	1690375	5508219		Enterobacteria_phage(18.18%)	14	NA	NA
WP_049245722.1|1676088_1677036_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.1	2.7e-05
WP_087498398.1|1677028_1677871_+	glycosyltransferase	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	30.8	3.1e-13
WP_000043542.1|1678098_1679505_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|1679729_1680794_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_032735999.1|1680820_1681690_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	7.5e-111
WP_004206787.1|1681721_1682612_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_023297948.1|1682626_1683181_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_000704907.1|1683361_1684528_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004144151.1|1684951_1685074_-	small membrane protein	NA	NA	NA	NA	NA
WP_049139658.1|1685210_1685405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008804104.1|1685478_1686483_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
WP_071822030.1|1686996_1687281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049139657.1|1687560_1688976_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	4.0e-53
WP_032731030.1|1688998_1690375_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
>prophage 2
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	2634246	2645125	5508219		Escherichia_phage(87.5%)	9	NA	NA
WP_012541792.1|2634246_2634867_-	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
WP_087498784.1|2634859_2636125_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.6	1.5e-229
WP_008804983.1|2636136_2637039_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_008804982.1|2637299_2638061_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_039103359.1|2638078_2638939_-	class A beta-lactamase LEN-17	NA	A0A077SL40	Escherichia_phage	90.9	1.8e-144
WP_012968279.1|2639233_2639494_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	96.5	4.6e-40
WP_012541789.1|2639580_2640669_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.6	2.8e-208
WP_008804978.1|2640697_2641963_-	MFS transporter	NA	NA	NA	NA	NA
WP_087498785.1|2642017_2645125_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 3
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	2773369	2835001	5508219	head,tail,transposase,protease,plate,integrase	Vibrio_phage(56.1%)	70	2763817:2763832	2795203:2795218
2763817:2763832	attL	ATCGCGCTCTTTTTCG	NA	NA	NA	NA
WP_148237947.1|2773369_2774293_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_087759866.1|2774846_2775966_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_087499103.1|2776677_2778723_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.0	1.1e-16
WP_008805005.1|2778853_2779603_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_008805006.1|2779694_2780381_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805007.1|2780431_2780863_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.0	3.6e-21
WP_048267884.1|2781129_2782593_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.1e-42
WP_023322553.1|2782879_2784163_-	MFS transporter	NA	NA	NA	NA	NA
WP_008805010.1|2784277_2784604_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	4.2e-22
WP_004206035.1|2784748_2785090_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_087499102.1|2785168_2785729_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_008805013.1|2785722_2786433_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_008805014.1|2786534_2786804_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_087499101.1|2786954_2789390_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	5.6e-212
WP_008805016.1|2789400_2790018_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	5.8e-73
WP_016160963.1|2790019_2790877_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.3	3.4e-23
WP_087499100.1|2791342_2791906_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|2792087_2792312_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_087499099.1|2792314_2794408_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	51.2	1.2e-183
WP_087499098.1|2794444_2795392_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.1	4.9e-140
2795203:2795218	attR	CGAAAAAGAGCGCGAT	NA	NA	NA	NA
WP_004114539.1|2795396_2795636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|2795638_2795926_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_023301748.1|2795941_2796559_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.0e-65
WP_087499097.1|2796639_2797134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301746.1|2797126_2797432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301745.1|2797393_2797648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499096.1|2797715_2798270_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	2.3e-41
WP_023301743.1|2798266_2798659_+	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	63.3	3.8e-38
WP_032443156.1|2798664_2798985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301742.1|2799087_2799672_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.5	6.7e-39
WP_087499095.1|2799674_2799893_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.1	8.6e-24
WP_023301741.1|2799885_2800293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301740.1|2800280_2800892_+	hypothetical protein	NA	M4MB79	Vibrio_phage	40.4	2.9e-24
WP_023301739.1|2800888_2801119_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023301738.1|2801099_2801402_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	41.5	5.6e-13
WP_023301737.1|2801411_2801699_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_023301736.1|2801701_2801986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087499094.1|2801975_2802551_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	57.8	2.7e-48
WP_087499093.1|2802547_2804137_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.2	1.0e-198
WP_087499092.1|2804136_2805708_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	1.6e-156
WP_087499091.1|2805700_2806555_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	58.0	5.5e-90
WP_141749336.1|2806669_2807005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070544466.1|2807097_2808069_+	peptidase	NA	M1Q578	Vibrio_phage	47.6	5.9e-72
WP_064360136.1|2808071_2808974_+|head	phage head protein	head	M4MB71	Vibrio_phage	62.0	1.7e-105
WP_087499090.1|2809049_2809667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087499089.1|2809666_2810107_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.9e-33
WP_087499088.1|2810106_2810649_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.8	7.6e-61
WP_087499087.1|2810645_2811257_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.3	6.6e-37
WP_087499086.1|2811259_2811490_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_087499085.1|2811491_2812973_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	5.8e-164
WP_004114591.1|2812982_2813336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184309.1|2813339_2813723_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	5.1e-11
WP_087499084.1|2813821_2815615_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	30.1	3.0e-61
WP_087499083.1|2815611_2816871_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	41.7	8.4e-87
WP_087499082.1|2816863_2817955_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.1	2.9e-91
WP_087499081.1|2817945_2818485_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	45.5	3.3e-32
WP_087499080.1|2818481_2818934_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	1.5e-25
WP_087499079.1|2818920_2819997_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.6	1.6e-102
WP_087499078.1|2819981_2820566_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.7	6.3e-45
WP_087499077.1|2820568_2821381_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	55.3	1.4e-31
WP_087499076.1|2821380_2822256_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	41.8	3.1e-24
WP_049138359.1|2824205_2824505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087498628.1|2825129_2826425_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_012541855.1|2826377_2827073_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_032691385.1|2827200_2828421_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_016160960.1|2828545_2829448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805023.1|2829578_2830829_+	MFS transporter	NA	NA	NA	NA	NA
WP_016160959.1|2831168_2832656_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_043875352.1|2832831_2833251_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_072123164.1|2834263_2835001_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	3244847	3333864	5508219	terminase,head,tail,tRNA,transposase,integrase,portal,capsid,holin	Klebsiella_phage(50.0%)	93	3310793:3310808	3333397:3333412
WP_008807680.1|3244847_3245348_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_012542127.1|3245465_3245912_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023297405.1|3245895_3246687_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016160703.1|3246787_3247972_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_012968515.1|3248003_3248696_-	CTP synthase	NA	NA	NA	NA	NA
WP_087498518.1|3248841_3249351_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_016160702.1|3249337_3249694_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_008807687.1|3249683_3249923_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_012968528.1|3250224_3251238_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.5	4.9e-13
WP_004150782.1|3251295_3251397_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|3251396_3251471_+	protein YoaJ	NA	NA	NA	NA	NA
WP_012542130.1|3251590_3251716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004203731.1|3251775_3252039_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_087498517.1|3252169_3252808_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|3252897_3253812_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_012542131.1|3254469_3255513_-	type II asparaginase	NA	NA	NA	NA	NA
WP_040975781.1|3255821_3257030_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012542132.1|3257103_3258888_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_008807694.1|3258894_3259785_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012542133.1|3259905_3261408_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_049010387.1|3261483_3261894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160694.1|3262023_3262710_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_008807698.1|3263344_3263977_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3264550_3264748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542139.1|3264806_3265601_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087498516.1|3265678_3267730_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012968537.1|3267722_3267935_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_023297397.1|3267931_3268852_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_008807703.1|3268845_3269856_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012542145.1|3269852_3271259_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_087498515.1|3271314_3272202_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_008807706.1|3272218_3272725_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_008807707.1|3272751_3273246_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3273335_3273521_-	general stress protein	NA	NA	NA	NA	NA
WP_008807708.1|3274130_3275324_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012542149.1|3275431_3275659_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_048267755.1|3275713_3276259_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_008807711.1|3276580_3277054_+	OsmC family protein	NA	NA	NA	NA	NA
WP_023322374.1|3277191_3277515_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012542152.1|3277507_3277900_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_012542153.1|3277896_3278610_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087498514.1|3278947_3279421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022066233.1|3279417_3279756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000926747.1|3280154_3280322_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.6e-20
WP_126494456.1|3280629_3281010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047694554.1|3281423_3282488_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.7e-14
WP_047694552.1|3282912_3284349_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	53.7	2.4e-98
WP_108173210.1|3284410_3295627_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.9	0.0e+00
WP_023159867.1|3295689_3296283_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
WP_087499134.1|3296335_3296683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499133.1|3296715_3297426_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	9.4e-136
WP_087499132.1|3297427_3298183_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
WP_017898999.1|3298179_3298518_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_087499131.1|3298517_3301853_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.6	0.0e+00
WP_071836352.1|3301852_3302071_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3302085_3302451_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3302508_3302970_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_087499130.1|3303001_3303403_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.2	3.9e-62
WP_017880258.1|3303399_3303789_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3303769_3304108_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3304104_3304422_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_063002116.1|3304402_3304663_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|3304721_3306008_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_014907815.1|3306085_3307006_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_064141880.1|3307042_3308302_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	1.4e-222
WP_017898992.1|3308301_3308481_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_087499129.1|3308474_3310196_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.6	6.5e-191
WP_012542168.1|3310195_3310630_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
3310793:3310808	attL	CCGGCTGCGCCGGCAG	NA	NA	NA	NA
WP_017898991.1|3310879_3311311_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
WP_014228902.1|3311307_3311625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|3311576_3311939_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_017898989.1|3312092_3312314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898988.1|3312420_3312609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|3313688_3314039_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_023279523.1|3314035_3314533_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017880269.1|3314532_3314748_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_023342896.1|3316171_3316774_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
WP_043875511.1|3316790_3317822_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	6.2e-96
WP_032735234.1|3317821_3318025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043875512.1|3318021_3318414_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_071599446.1|3318454_3318694_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.5e-16
WP_043875513.1|3318756_3318990_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	3.4e-26
WP_071839091.1|3319441_3319639_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_048271575.1|3320506_3326398_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_087759866.1|3326589_3327710_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_087499162.1|3327762_3328056_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_072041815.1|3328282_3328561_+	hypothetical protein	NA	A0A2I7RDR9	Vibrio_phage	59.2	4.2e-23
WP_012542206.1|3328613_3328859_+	excisionase	NA	NA	NA	NA	NA
WP_043875519.1|3328839_3329967_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	2.6e-119
WP_008806032.1|3330084_3331335_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_087499163.1|3331575_3332226_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_087499164.1|3332242_3332701_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012542211.1|3332757_3333864_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3333397:3333412	attR	CTGCCGGCGCAGCCGG	NA	NA	NA	NA
>prophage 5
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	3456115	3488863	5508219	terminase,head,tail,capsid,portal,plate,integrase	Enterobacteria_phage(43.33%)	40	3456005:3456025	3488933:3488953
3456005:3456025	attL	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
WP_049118723.1|3456115_3456499_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	56.7	3.4e-39
WP_075212584.1|3456596_3456845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499022.1|3456890_3458045_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	78.9	3.1e-173
WP_087499023.1|3458197_3459379_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	6.7e-155
WP_063106287.1|3459378_3459894_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	3.4e-63
WP_023328127.1|3459948_3460248_+	hypothetical protein	NA	B9A7B2	Serratia_phage	76.8	7.4e-34
WP_071836356.1|3460244_3460421_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_087499024.1|3460401_3463122_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	45.5	1.5e-128
WP_040197746.1|3463133_3463622_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.7e-54
WP_087499025.1|3463760_3464924_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.3	3.6e-44
WP_135769516.1|3465003_3465303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108173212.1|3465314_3467363_-	hypothetical protein	NA	A0A1W5PUZ2	Salmonella_phage	35.2	1.3e-15
WP_049118716.1|3467367_3467964_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.9	3.3e-41
WP_087498275.1|3467956_3468856_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	8.1e-92
WP_087498274.1|3468842_3469211_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.8	8.0e-30
WP_087498281.1|3469207_3469786_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.1	1.1e-62
WP_087498273.1|3469785_3470427_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.5	1.1e-42
WP_032427155.1|3470423_3470882_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	3.7e-32
WP_107645868.1|3471026_3471422_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_087498271.1|3471418_3471970_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.4e-31
WP_032424784.1|3471966_3472248_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
WP_032424783.1|3472238_3472439_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_046852171.1|3472438_3472936_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	9.1e-61
WP_087498270.1|3473038_3473959_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.7	8.5e-89
WP_032424780.1|3474006_3475056_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.8e-106
WP_087498269.1|3475080_3475914_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.4	2.7e-94
WP_087498268.1|3476074_3477796_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	1.1e-225
WP_087498267.1|3477795_3478842_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.2	3.2e-140
WP_087498266.1|3479444_3480434_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_087498265.1|3480662_3483257_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.6e-196
WP_101516551.1|3483357_3483633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087498264.1|3484116_3485082_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	50.3	1.6e-77
WP_087498263.1|3485090_3485669_-	3'-5' exoribonuclease	NA	F4YXP6	Roseobacter_phage	34.4	2.4e-12
WP_032414427.1|3485665_3485890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040209794.1|3485958_3486231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032414424.1|3486246_3486633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561575.1|3486649_3486847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328159.1|3487038_3487371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040150881.1|3487465_3487768_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
WP_087498262.1|3487855_3488863_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	2.0e-99
3488933:3488953	attR	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
>prophage 6
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	3618195	3627643	5508219	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_023297317.1|3618195_3619917_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.2	2.6e-14
WP_008805841.1|3619956_3620661_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3621012_3621231_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3621349_3623629_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3623659_3623977_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3624302_3624524_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_080928790.1|3624590_3626531_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_008805838.1|3626527_3627643_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5508219	4119547	4159801	5508219	transposase,holin,integrase	Escherichia_phage(30.0%)	54	4137182:4137241	4158610:4159831
WP_087498858.1|4119547_4119865_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
WP_087498859.1|4119864_4120104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087498860.1|4120651_4121068_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.7e-26
WP_001118619.1|4121126_4122050_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_087499183.1|4122668_4123136_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.2	2.3e-58
WP_087499182.1|4123166_4123805_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	75.6	6.1e-94
WP_048294297.1|4124534_4124885_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	37.2	7.9e-11
WP_087499181.1|4124881_4125376_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	93.9	1.1e-87
WP_019704119.1|4125353_4125578_-|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_064184449.1|4126307_4126997_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	2.3e-62
WP_009483890.1|4126993_4127134_-	YlcG family protein	NA	NA	NA	NA	NA
WP_087499180.1|4127130_4127769_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	2.7e-73
WP_032413853.1|4127761_4127932_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_016831925.1|4127937_4128534_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_087499179.1|4128629_4128887_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	8.3e-26
WP_087499178.1|4129464_4129821_-	DUF5448 family protein	NA	T1SA95	Salmonella_phage	48.1	2.7e-22
WP_032413942.1|4130497_4131010_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	5.6e-74
WP_087499177.1|4131009_4131537_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	50.5	1.4e-22
WP_087499176.1|4131533_4131791_-	hypothetical protein	NA	A0A1P7WFV2	Pectobacterium_phage	51.9	1.6e-16
WP_087499175.1|4131787_4132219_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.5	1.2e-08
WP_032444948.1|4132215_4132518_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023304896.1|4132517_4133294_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.4	2.3e-95
WP_065520981.1|4133290_4134019_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.6	4.2e-38
WP_001548453.1|4134152_4134374_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_016831912.1|4134413_4134641_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	3.3e-18
WP_040227061.1|4134709_4135432_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	5.5e-75
WP_004178801.1|4135454_4135574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434121.1|4135772_4136489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|4136479_4137025_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
4137182:4137241	attL	GTGACCTGCTCCCCGTTGATTAATACACCGTGATGTTAGTAATGTCTTCATAAGCCACAT	NA	NA	NA	NA
WP_087759866.1|4137253_4138373_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_004151303.1|4138761_4138956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087499189.1|4139044_4139329_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
WP_087499188.1|4139344_4140190_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	1.5e-68
WP_087499187.1|4140186_4140867_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	5.7e-122
WP_032453664.1|4140863_4141292_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.7	1.5e-64
WP_060612979.1|4141288_4141945_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	7.9e-113
WP_016529280.1|4141941_4142163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064181876.1|4142159_4142432_+	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	69.3	1.1e-23
WP_087499186.1|4142428_4143151_+	hypothetical protein	NA	R9VWB9	Serratia_phage	64.8	6.3e-87
WP_087499185.1|4143147_4143366_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	53.6	8.9e-13
WP_004151317.1|4143367_4143703_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_021441323.1|4143579_4144743_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_032410641.1|4145746_4145995_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	72.8	1.2e-26
WP_050543111.1|4146008_4146383_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	46.5	7.4e-23
WP_009307977.1|4146576_4147209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071844733.1|4147307_4147460_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
WP_032451338.1|4147499_4147883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499184.1|4147885_4150453_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.5	4.5e-180
WP_048293623.1|4150936_4151917_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_087499202.1|4153372_4156069_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	28.4	7.2e-35
WP_048757587.1|4156109_4156406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032436814.1|4156859_4157405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040224010.1|4157780_4158542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|4158681_4159801_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
4158610:4159831	attR	GTGACCTGCTCCCCGTTGATTAATACACCGTGATGTTAGTAATGTCTTCATAAGCCACATGAGGACATCCCCATGAAGAAGCGTTTTTCCGACGAACAGATCATATGTATTCTCCGCGAGGCCGAAGCCGGCGTTTCTGCCCGTGAGCTCTGCCGTAAGCACGCCATTTCCGACGCCACCTTTTACACATGGCGTAAGAAGTATGGCGGTATGGAGGTGCCTGAGGTTAAGCGCCTGAAGTCGCTTGAGGAAGAGAACGCCAGACTCAAGAAGCTGCTTGCTGAAGCCATGCTGGATAAGGAGGCGCTTCAGGTGGCTCTTGGGCGAAAGTACTGACGACAGACCAGAAGCGGGAAGCCGTGGAAGTCATGTGCGAGGCTAAGGGTCTGTCGCAACGTCGTGCCTGCAGGCTGGCAGGTCTGTCCCTGTCAACCTGCCGATATTCGGCTCAGCGTCCGGCTGCTGACGCGCAGCTGTCTCTACGCATCACAGAGCTGGCACTTGAACGCCGCCGTTTTGGTTACCGGCGTATCTGGCAGCTTCTGCGACGTGAAGGTCTTTGCGTTAACCACAAGCGGGTTTACCGCATCTATCAACTTAATGGCCTGAGTGTAAAACGCAGACGACGTCGTAAAGGGCTGGCAACAGAACGTCTGCCGCTGCTCCGCCCGATGGCGCCCAATCTGACCTGGTCAATGGATTTCGTCATGGACGCACTGGCCACAGGTCGCAGGATCAAGTGCCTGACCTGCGTGGATGATTTCACAAAGGAATGCCTGACGGTCACTGTTGCCTTCGGGATTTCAGGCGTGCAGGTCACGCGTATTCTGGACAGCATTGCGCTGTTTCGCGGCTATCCGGCTATGATAAGAACCGATCAGGGCCCGGAGTTTACCTGCCGCGCACTCGATCAGTGGGCTTTTGAGCATGGTGTGGAGCTGCGACTTATCCAGCCCGGCAAGCCAACGCAGAACGGATTTATTGAGAGTTTTAACGGACGCTTTCGTGATGAATGCCTGAATGAGCACTGGTTCAGCGATATTGTTCACGCCAGGAAGATCATTAATGACTGGCGACTGGATTATAACGAGTGTCGACCACATTCATCACTGAATTACCTGACGCCGGCTGAATTTGCAGCGGGCTGGCGAAACGGGAAATATGAAGAAAAACCAACCGACATTACTAACTGAAGGTTGTATCTAACTCTGGGGGCAGGTCA	NA	NA	NA	NA
>prophage 1
NZ_CP028549	Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence	248112	36882	61645	248112	transposase,integrase	Stx2-converting_phage(40.0%)	23	32870:32884	43023:43037
32870:32884	attL	TCTGCTGCGGCTGGA	NA	NA	NA	NA
WP_108173204.1|36882_37800_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.4	1.2e-146
WP_004118231.1|38347_38515_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_048293736.1|38799_39927_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|39923_40517_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118228.1|40513_41362_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|41361_42282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087499148.1|42294_43899_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
43023:43037	attR	TCTGCTGCGGCTGGA	NA	NA	NA	NA
WP_004118225.1|43943_44891_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|44898_46632_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_087499147.1|48452_49991_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.0	8.5e-291
WP_072072241.1|50039_50456_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.2	5.4e-59
WP_137962955.1|51538_51691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZCV4	Stx2-converting_phage	98.0	1.7e-18
WP_137962954.1|51647_51932_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	96.4	1.3e-40
WP_048293743.1|52428_53385_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_071885283.1|53413_54403_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.6	1.7e-13
WP_048293744.1|54392_55391_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	3.6e-16
WP_048293754.1|55407_56238_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048293745.1|56246_57185_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048293746.1|57239_58835_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048293747.1|59078_60077_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065813252.1|60063_60759_+	creatininase family protein	NA	NA	NA	NA	NA
WP_094955508.1|61096_61363_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	52.2	2.0e-14
WP_094955509.1|61366_61645_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP028549	Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence	248112	70121	116825	248112	transposase,protease	Shigella_phage(23.08%)	42	NA	NA
WP_077264177.1|70121_71468_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|71679_72162_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|72149_72416_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004206660.1|72860_73091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|73104_73308_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004206662.1|73368_73860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077270148.1|74094_74298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676094.1|74243_74948_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_087499209.1|76190_76667_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	29.0	8.8e-05
WP_000928911.1|76971_77322_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001324897.1|77483_77795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|77939_79059_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_107645905.1|79056_80191_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
WP_070544277.1|83218_85261_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000443938.1|85253_86705_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_108173202.1|86729_87898_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	5.6e-178
WP_004118209.1|88186_88450_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|88464_88728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118812.1|88921_89203_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004118809.1|89237_89807_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004118798.1|89912_92762_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	2.6e-128
WP_023205099.1|93679_93820_+|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_064794594.1|93907_94366_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_094955523.1|94388_95303_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_013307890.1|95405_96293_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_023329026.1|96382_97024_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_070544272.1|97072_98218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786814.1|98207_98648_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_023326110.1|98651_100361_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_001514138.1|100363_100861_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_004118756.1|100838_101804_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323730.1|101828_102980_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_025714249.1|103823_104819_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
WP_001554382.1|105012_105441_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_148237944.1|105761_106685_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.3e-174
WP_004118212.1|108304_109378_-	FUSC family protein	NA	NA	NA	NA	NA
WP_004187073.1|109643_110153_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_032425473.1|111351_112275_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_071785921.1|112319_112385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328882.1|112500_113166_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032425473.1|113424_114348_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_077253754.1|116711_116825_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	4.7e-10
>prophage 3
NZ_CP028549	Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence	248112	169929	216012	248112	integrase,transposase,protease	Acinetobacter_phage(20.0%)	42	181667:181683	209554:209570
WP_012540224.1|169929_171009_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	3.5e-41
WP_011251315.1|171008_171965_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_087499070.1|171975_173199_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_012540108.1|173201_173660_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_148237945.1|173923_174118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499071.1|174926_175565_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087499072.1|175589_176231_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026585.1|176231_176870_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087499075.1|176962_178003_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087499073.1|178002_179736_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026579.1|179763_181263_+	LPS kinase	NA	NA	NA	NA	NA
181667:181683	attL	AAATAAAGTTTCATCCT	NA	NA	NA	NA
WP_021567590.1|182178_183330_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	1.7e-25
WP_021567591.1|183349_184312_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032731988.1|184298_184787_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_001446206.1|184798_185041_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_016241867.1|185817_187524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032731987.1|187527_187968_-	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	35.6	6.9e-12
WP_024146425.1|187957_188563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023205312.1|188519_189212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637111.1|189204_189396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545589.1|189392_190304_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_032174377.1|191141_191753_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_021567627.1|191849_192737_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_021567628.1|192839_193754_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_032174845.1|193776_194235_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_032174385.1|195662_197093_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_021567632.1|197109_199971_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
WP_032174387.1|200068_200641_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_024238610.1|201056_201320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032174388.1|201876_203499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032174390.1|204995_206606_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_087499159.1|206598_208659_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032174391.1|208672_209500_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_029884669.1|209623_210352_-	hypothetical protein	NA	NA	NA	NA	NA
209554:209570	attR	AGGATGAAACTTTATTT	NA	NA	NA	NA
WP_029884668.1|210368_211202_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_029884667.1|211538_211943_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004210285.1|212001_212280_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210286.1|212373_212586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118067.1|213330_213534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023288299.1|213563_213878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|214121_214574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048326507.1|215076_216012_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
>prophage 1
NZ_CP028550	Klebsiella variicola strain WCHKP19 plasmid p2_020019, complete sequence	110186	1549	109866	110186	portal,integrase,tail,terminase	Salmonella_phage(90.72%)	116	10653:10669	47469:47485
WP_014342074.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_032440513.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
WP_032440514.1|2093_2273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130939747.1|2796_4386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499054.1|4723_5800_-	recombinase	NA	J9Q736	Salmonella_phage	95.5	1.2e-195
WP_019704549.1|5802_6069_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_046882033.1|6068_7013_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.4e-171
WP_087499053.1|7073_8078_-	regulator	NA	J9Q7Z3	Salmonella_phage	90.0	1.5e-147
WP_087499052.1|8197_8629_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_107645894.1|8692_9679_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_087499051.1|9710_10154_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.2	5.6e-70
WP_087499050.1|10150_13669_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.4	0.0e+00
10653:10669	attL	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_071994325.1|13643_13847_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	3.3e-25
WP_087499049.1|13849_15082_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.1	1.8e-211
WP_087499048.1|15178_17482_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	66.4	3.6e-245
WP_046882092.1|17598_17811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046882039.1|18083_18464_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_107645893.1|18458_19559_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_087499047.1|19812_20277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087499046.1|20248_20668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107645892.1|20984_21344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087499045.1|21408_21819_-	toxin YafO	NA	NA	NA	NA	NA
WP_087499044.1|21828_22446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499043.1|22540_22786_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	1.2e-13
WP_087499042.1|22782_23169_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.4	2.9e-46
WP_087499041.1|23178_23955_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	2.9e-90
WP_087499040.1|24198_24915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047066207.1|26689_26989_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.6	6.7e-27
WP_023279478.1|26985_27138_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	84.0	7.1e-17
WP_087499039.1|27134_27350_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	1.9e-23
WP_064360417.1|27333_27513_-	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	2.7e-15
WP_087499038.1|27509_28832_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.7	7.4e-227
WP_064360418.1|28831_29299_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	9.8e-49
WP_087499064.1|29378_30167_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	9.0e-71
WP_148237946.1|30323_31457_-	enolase	NA	NA	NA	NA	NA
WP_087499036.1|31552_32668_-	DNA primase	NA	J9Q720	Salmonella_phage	91.1	6.3e-203
WP_087499035.1|32821_34162_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.5	7.7e-240
WP_087499034.1|34226_34952_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	6.2e-127
WP_087499033.1|35124_36843_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	29.0	5.2e-15
WP_032734135.1|36885_37248_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_087499032.1|37247_37913_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	84.6	4.4e-103
WP_004109769.1|38340_38610_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_087499031.1|38613_39138_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087499030.1|39165_39507_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	79.2	1.5e-27
WP_087499029.1|39575_40268_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	90.0	6.4e-121
WP_004109805.1|40281_40605_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_087499028.1|40695_42141_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
WP_108173205.1|42263_54398_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	62.3	6.3e-30
47469:47485	attR	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_019704527.1|54414_55026_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|55013_55811_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|55803_56502_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|56588_56924_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_087499121.1|56967_61500_-	tape measure protein	NA	J9Q712	Salmonella_phage	71.4	0.0e+00
WP_004109830.1|61507_61741_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|61857_62175_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|62236_62983_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109842.1|63050_63443_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.8	1.4e-48
WP_087499120.1|63444_63918_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.0	7.3e-76
WP_087499119.1|63908_64253_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	91.2	8.2e-53
WP_048331549.1|64350_65184_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.8	3.7e-131
WP_047066290.1|65183_65618_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.7	7.6e-64
WP_046882061.1|65665_66094_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	2.3e-28
WP_004109857.1|66172_67051_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|67077_67977_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_026005939.1|67999_69589_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	2.3e-275
WP_004109863.1|69606_70863_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|70865_71507_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|71682_71949_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_087499118.1|71958_72858_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	96.6	1.2e-164
WP_019704585.1|72854_73109_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_046882064.1|73101_73740_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	3.9e-109
WP_023279438.1|73736_74405_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_021313132.1|74404_75085_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_087499117.1|75172_76732_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	1.7e-278
WP_004109887.1|76734_77010_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_064351790.1|77060_77498_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.7	7.3e-14
WP_064164530.1|77653_78184_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	84.5	1.0e-70
WP_123609186.1|78193_78493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|78817_79468_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|79518_79722_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_048269902.1|80314_80797_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	1.6e-70
WP_087499115.1|81002_81284_-	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	1.2e-41
WP_004109918.1|81410_81818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704579.1|81937_82249_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.0	2.3e-30
WP_004109924.1|82385_82745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142669771.1|83554_83767_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	66.7	2.5e-12
WP_087499113.1|84284_85511_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.1	4.7e-119
WP_060527990.1|85681_85999_-	hypothetical protein	NA	J9Q750	Salmonella_phage	75.2	4.1e-43
WP_001554382.1|86197_86626_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_064146275.1|86806_87070_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.7e-29
WP_107645895.1|87221_87950_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	68.0	2.0e-80
WP_087499063.1|88011_89697_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	90.2	8.1e-311
WP_064184673.1|89825_90404_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.5	1.7e-55
WP_087499062.1|90531_90687_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	59.2	3.7e-05
WP_019704567.1|90686_91112_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_032414138.1|91214_91403_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
WP_060877018.1|91399_91678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499061.1|93265_93499_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	82.9	7.8e-31
WP_023279507.1|93696_94290_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_087499060.1|94474_95308_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	3.3e-63
WP_014342174.1|95432_95990_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_046882083.1|95999_96419_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	3.8e-52
WP_087499059.1|96482_97127_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	1.4e-93
WP_046882085.1|97126_97603_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	8.4e-72
WP_032423043.1|97599_98013_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
WP_047065804.1|98014_99118_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.4	2.3e-181
WP_047065805.1|99311_100187_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.4	7.7e-140
WP_087499058.1|100264_101407_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	3.4e-212
WP_087499057.1|101537_103841_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_040177334.1|103916_104486_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_048331488.1|104495_105242_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	62.1	4.1e-81
WP_087499056.1|105231_107148_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	9.5e-300
WP_072196416.1|107144_107378_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_047065810.1|107377_108463_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.5	5.4e-183
WP_021313777.1|108651_109146_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_021313778.1|109221_109866_-	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
>prophage 1
NZ_CP028551	Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence	74191	0	67921	74191	transposase	Escherichia_phage(31.82%)	50	NA	NA
WP_000764642.1|470_728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302476.1|1495_2362_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_006797591.1|3287_4493_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_086073836.1|4489_5467_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_023302472.1|5548_6820_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_006796638.1|6819_7251_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_042934531.1|7582_8506_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	2.5e-173
WP_023285886.1|8737_10162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032427351.1|10158_13098_-	AAA family ATPase	NA	A0A2K9L5A2	Tupanvirus	23.8	9.9e-22
WP_000861580.1|13175_13367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|13375_13762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|15575_16580_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071993214.1|16906_17068_+	replication initiation protein	NA	NA	NA	NA	NA
WP_077256206.1|17599_17911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413495.1|18157_19714_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.0	1.9e-104
WP_032413496.1|19710_20916_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032413497.1|21039_24162_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	3.5e-25
WP_065809885.1|24606_25683_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|26568_27720_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_032413498.1|29196_29553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413499.1|29678_29936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087499201.1|29980_31101_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.3e-51
WP_023302470.1|31954_32575_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_020805503.1|32744_33698_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_017900922.1|33960_34239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413487.1|34411_34747_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_108173206.1|34853_35771_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.0	2.4e-168
WP_001118616.1|38161_39085_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_048293623.1|39758_40739_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_022631502.1|41474_41675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148237947.1|41975_42899_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_004099052.1|43316_45509_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_015632388.1|45638_46922_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|47058_47763_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_025714801.1|48164_48773_+	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_000820818.1|48868_49570_+	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_000813718.1|49581_52068_+	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_045618225.1|52058_53054_+	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_000677445.1|53067_53703_+	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_025714822.1|53737_54454_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|55572_55896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307208.1|56328_59226_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|59320_59926_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|60585_61767_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|62193_62508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|62762_63119_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|63108_63510_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|63506_63797_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|63871_66838_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|66916_67921_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP028553	Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence	117244	2955	54423	117244	transposase,integrase	Escherichia_phage(25.0%)	69	23828:23887	36349:37169
WP_004197635.1|2955_3750_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|3947_4964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|4974_5289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380813.1|5315_5675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|5879_6185_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|6186_6405_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_071571078.1|6456_6651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100792567.1|6574_6913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899886.1|7035_7233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023783.1|7222_7513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023782.1|7509_8637_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015344964.1|8670_10263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023780.1|10469_11249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023779.1|11261_11762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023778.1|12036_12300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023777.1|12296_12863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|12893_13388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337418.1|13431_13800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|13833_14037_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_017899889.1|14085_14343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653916.1|14418_14673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013609504.1|14808_15585_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|15825_16149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077268901.1|16327_16561_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	51.3	1.7e-17
WP_013023770.1|17387_18569_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_048337419.1|18932_19145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025999349.1|19266_19455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023768.1|19760_20618_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|20610_20688_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152385.1|20919_21171_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_052145515.1|21306_21816_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
WP_001323889.1|21989_23567_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
23828:23887	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|23890_24595_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|24716_25622_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|25618_26857_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|26856_27441_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|27386_27743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|27933_28698_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|28785_28899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|29204_29705_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|29723_29903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|29832_30672_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|30665_31013_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749984.1|31129_31975_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_001749985.1|32155_32629_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749986.1|32761_33214_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|33310_33865_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845048.1|34156_35170_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015344971.1|35138_35423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|35640_36345_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|37526_38084_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
36349:37169	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTTTTCTGCCCAATCTTTCTGGCGTCACGGATGATAACGGCCAGCATGGCGTCCAGAACGTCCAATGCATCATCCAGCGCCAGCGTTTCCCATGCAAGGACAAAGGCAACCAGAACCGCCATCCTTTTCTGCGGTGACATCCTGGCAATATTGAACACCGAAGTCATACCAGCATAACGTGCGAGATTTTTCAGGCGCACAGCCGGGAGTGTACTCAGGTTTTCAGCATGCAGGCCAAAATCGTTCAGAGTTTTCCAGCGTTCAATTGCTTCATTAAACGCCGGACCACTGATGGTCACAGGGCCCTTTTTCAGTGATTCCAGTAAAGACAGGCGGCTGCAATCAGTTGGCCCCAGCAGCATCTCCAGCTGTGAACGCTGTTCGGCTGACGGTATCAGTGCCAGTTTGTTCCACAGGCGCAACGTCGCCTTTTCCCTTACCTCTGAAATCAACCGGGTCAGCGTAGTGGCTCCGGGGAGAATAATACGATGTTGCATAAGCCACCCTGTCGCCAGATCGAAAAGCAGGCCAGGACGTTCGTTGCTTATCCAGCTCCGGGTATATAAAAGACGGGTAAGGCGAAATGTCCAGGGCCAGGCAAATTCACGATACTGATAGTGCTGACGTATCAGCGCTGCATGCTCACGGCGGGTATTTTCCCTCTGACCGTATTCTGCAAGAACGGTGATATCACGAATCCCGAGCTGTCTGGCGGTAAAATGCCGGACGCCGGAAGGAATATGATTCATATCGGTGAGG	NA	NA	NA	NA
WP_000027057.1|38266_39127_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_013023839.1|39385_39862_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000239590.1|39908_40784_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001516695.1|44116_44773_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|45054_46446_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|46482_47055_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|47191_47782_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_077256884.1|47832_48408_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_000780222.1|48554_48836_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|48816_49146_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_048337415.1|49381_49639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|49672_50377_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152383.1|50564_50873_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_014343480.1|50869_51520_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_014343481.1|51575_52220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107319072.1|52269_52866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013609537.1|53032_53626_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023834.1|53697_54423_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
>prophage 1
NZ_CP028554	Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence	89738	13507	20469	89738		Aeromonas_phage(16.67%)	10	NA	NA
WP_032635043.1|13507_14104_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_022644913.1|14643_15162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|15507_16155_+	P-loop NTPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_032072061.1|16145_16421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644911.1|16621_16822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053390141.1|16923_18195_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	2.5e-147
WP_044596206.1|18206_18656_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644908.1|18652_18898_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_022644907.1|19101_19332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606931.1|19767_20469_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	34.4	9.6e-24
