The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	1115450	1122590	5099810		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1115450_1116089_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|1116085_1117348_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|1117344_1118253_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|1118448_1119216_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|1119266_1119923_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|1120028_1122590_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	1498361	1536342	5099810	integrase,holin,lysis,portal,head,terminase	Enterobacteria_phage(46.55%)	59	1490601:1490623	1539286:1539308
1490601:1490623	attL	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_000749077.1|1498361_1498553_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001706457.1|1498709_1499456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535474.1|1499457_1500744_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001163428.1|1500996_1501197_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545716.1|1501254_1501422_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_029701309.1|1501493_1501778_-	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_029701304.1|1501770_1502562_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_000951706.1|1502558_1502768_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_029701302.1|1502769_1503462_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_029701301.1|1503448_1503703_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_032153684.1|1503699_1503867_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701300.1|1503863_1504145_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_000753555.1|1504161_1504476_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_032153683.1|1504487_1504970_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_032153682.1|1504953_1505865_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
WP_000604111.1|1505861_1506170_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_001243355.1|1506254_1506407_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1506391_1506526_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000213975.1|1506752_1506953_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_077694523.1|1507031_1507412_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000618034.1|1507661_1508066_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_000028392.1|1508062_1508695_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1508798_1509014_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251072.1|1509133_1509427_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1509449_1509722_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_087503463.1|1509724_1510672_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
WP_001749476.1|1510668_1512045_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_000736913.1|1512118_1512559_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_023146905.1|1512555_1513083_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
WP_024176095.1|1513079_1513262_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000566866.1|1513258_1513429_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_023146906.1|1513421_1514144_+	phage antirepressor protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
WP_000002250.1|1514143_1514434_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_023146907.1|1514430_1514955_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_001549462.1|1514955_1515318_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_000994516.1|1515314_1515503_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027554.1|1515499_1516018_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000783734.1|1516613_1516937_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1516920_1517397_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_063123791.1|1517393_1517861_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
WP_021568311.1|1517848_1518001_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
WP_001058931.1|1518206_1518692_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807789.1|1518940_1519183_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_001700895.1|1519186_1519474_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
WP_031624844.1|1519483_1519663_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
WP_001436504.1|1519686_1520109_+	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_060579116.1|1520105_1521518_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_000852333.1|1521520_1523647_+|portal	portal protein p19	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_000426735.1|1523660_1524545_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.7	8.1e-145
WP_060579115.1|1524556_1525828_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
WP_000375637.1|1525870_1526056_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246750.1|1526030_1526513_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_085701391.1|1526521_1527940_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
WP_087503464.1|1527939_1528893_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_087503465.1|1528892_1529348_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
WP_087503466.1|1529350_1530043_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_087503467.1|1530052_1531384_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
WP_087503468.1|1531384_1533778_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_087503469.1|1533942_1536342_+|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
1539286:1539308	attR	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 3
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	1783911	1793354	5099810		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569374.1|1783911_1784838_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|1784842_1785574_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1785554_1785662_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1785721_1786453_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|1786674_1788360_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1788356_1789076_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1789122_1789593_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1789634_1790096_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|1790220_1792221_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001520842.1|1792217_1793354_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	1804793	1869880	5099810	integrase,holin,plate,tail,tRNA,transposase,capsid,portal,lysis,head,terminase	Escherichia_phage(41.3%)	74	1832687:1832713	1865566:1865592
WP_001520834.1|1804793_1806827_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|1806958_1808068_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001328276.1|1808330_1808612_+	YehE family protein	NA	NA	NA	NA	NA
WP_000526135.1|1808825_1809284_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000830468.1|1809618_1810161_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677340.1|1810241_1810916_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001520833.1|1810931_1813412_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000702203.1|1813427_1814462_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1814543_1814882_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1815100_1815925_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1816045_1816318_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195594.1|1816540_1817329_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|1817325_1818126_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|1818190_1819009_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|1819060_1819807_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|1819780_1820746_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|1820742_1821747_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|1821743_1823021_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1823277_1824330_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|1824559_1825414_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182900.1|1826709_1827162_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1827192_1827477_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|1827480_1828836_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|1828883_1829924_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1830023_1830803_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1830884_1831784_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1832198_1832516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023154000.1|1832503_1832695_+	hypothetical protein	NA	NA	NA	NA	NA
1832687:1832713	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_087503482.1|1832792_1833806_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
WP_000020919.1|1833921_1834221_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_029701703.1|1834342_1834618_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_029701701.1|1834795_1835296_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_000557703.1|1835359_1835584_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|1835583_1835886_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_029701699.1|1835885_1836110_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_029701698.1|1836106_1836382_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029401229.1|1838717_1839869_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029401228.1|1839819_1840812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029401227.1|1840808_1842233_-	histidine kinase	NA	NA	NA	NA	NA
WP_124759995.1|1842308_1842581_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	1.0e-18
WP_001533791.1|1842619_1843654_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_000156847.1|1843653_1845426_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_020233502.1|1845599_1846454_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_020233501.1|1846512_1847586_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_000203455.1|1847589_1848333_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_000988636.1|1848432_1848942_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|1848941_1849145_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1849148_1849430_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1849429_1849927_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|1849941_1850367_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|1850354_1850780_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|1850751_1850925_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|1850887_1851355_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|1851347_1851800_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_021523179.1|1851871_1852657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233499.1|1852740_1853376_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127164.1|1853372_1853720_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|1853724_1854633_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|1854625_1855156_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_021523178.1|1855166_1857188_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_021523177.1|1857189_1857717_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_032142943.1|1857938_1858532_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_020233495.1|1858861_1860052_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|1860064_1860583_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|1860639_1860915_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1860947_1861067_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|1861059_1863507_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|1863521_1864001_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|1864000_1865164_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|1865245_1865464_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001520824.1|1865736_1867098_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
1865566:1865592	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1867245_1867578_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1867757_1868480_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|1868476_1869880_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	1917285	1924803	5099810		Escherichia_phage(42.86%)	7	NA	NA
WP_087503483.1|1917285_1918680_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
WP_021523159.1|1918837_1919833_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|1920064_1920958_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|1921329_1922415_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|1922414_1923314_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|1923371_1924250_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|1924254_1924803_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	2399194	2474757	5099810	integrase,tail,transposase,capsid,lysis,portal,head,terminase,protease	Enterobacteria_phage(39.66%)	95	2406770:2406785	2443889:2443904
WP_001260850.1|2399194_2400016_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2400115_2400199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2400291_2400627_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2401023_2402277_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|2402383_2403277_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523109.1|2403411_2404632_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2404756_2405452_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071593650.1|2405404_2406697_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2406770:2406785	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_001520571.1|2406855_2407470_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
WP_020233477.1|2407512_2408367_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520568.1|2408368_2408986_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_072170800.1|2408996_2411420_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
WP_001551145.1|2411480_2413907_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2414105_2414411_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2414518_2415229_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2415231_2415792_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|2415826_2416168_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|2416302_2416629_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_001295394.1|2416834_2418049_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2418060_2419080_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2419137_2419266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523105.1|2419267_2420548_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_087565618.1|2420603_2422175_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
WP_000624622.1|2422194_2422542_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2422541_2423219_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_077882484.1|2423195_2423297_+	copper resistance protein	NA	NA	NA	NA	NA
WP_001296941.1|2423289_2423526_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048363.1|2423613_2426085_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|2426178_2426370_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2426366_2426555_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_148240173.1|2427041_2427617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2427618_2427774_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|2427942_2428350_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2428430_2428658_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|2428641_2429163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2429143_2430109_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151242.1|2430149_2430548_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_021523102.1|2430750_2431416_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001265627.1|2431624_2432239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345551.1|2432235_2433264_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000589005.1|2433747_2435061_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2435497_2435830_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2436032_2436338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2436362_2436602_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2436601_2436889_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2436960_2437116_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2437332_2437584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2437650_2437929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2437930_2438980_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2438993_2439746_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2440023_2440113_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2440167_2440380_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2440680_2440896_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000526135.1|2441346_2441805_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000839590.1|2442361_2442577_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2442581_2442893_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2442889_2443423_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2443419_2443917_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2443889:2443904	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2444279_2444492_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2444502_2444691_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2444693_2444759_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2444838_2444994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2445165_2445339_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2445490_2445901_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2445958_2446192_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453587.1|2446580_2447126_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|2447100_2449026_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2449022_2449229_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|2449225_2450827_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_020233915.1|2450807_2452127_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001708751.1|2452136_2452469_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|2452523_2453549_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_020233914.1|2453590_2453989_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000752979.1|2454000_2454354_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|2454365_2454944_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|2454940_2455336_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001349920.1|2455343_2456084_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|2456099_2456522_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|2456503_2456938_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_048219008.1|2456930_2459492_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
WP_000847345.1|2459488_2459818_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_029702161.1|2459817_2460516_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_032153655.1|2460521_2461265_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_049286672.1|2461201_2461804_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|2461864_2465344_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|2465411_2466011_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|2466075_2468475_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|2468471_2468753_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|2468762_2469467_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|2469477_2469771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2469998_2470589_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2470905_2471139_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2471207_2471321_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_029701979.1|2471924_2473208_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|2473296_2474757_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 7
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	2900505	2958947	5099810	holin,integrase,tRNA,capsid,portal,lysis,head,terminase,tail	Escherichia_phage(38.18%)	77	2908698:2908712	2959049:2959063
WP_000004751.1|2900505_2901612_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2901647_2902289_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2902292_2903663_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2903832_2904504_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2904503_2905964_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2906039_2907161_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001522887.1|2907209_2908436_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2908685_2909822_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2908698:2908712	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2909805_2910669_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937481.1|2910900_2911167_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000240999.1|2911223_2911892_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2911836_2911974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885577.1|2911946_2912531_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216486.1|2912530_2915557_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_001233148.1|2915708_2916308_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000514726.1|2916375_2920068_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_000559722.1|2920048_2920390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032300536.1|2920411_2921044_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000194723.1|2920989_2921733_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001328631.1|2921743_2922442_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000847298.1|2922441_2922771_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082417.1|2922767_2925329_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000533402.1|2925309_2925723_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479111.1|2925749_2926181_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000235111.1|2926194_2926947_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000683079.1|2926954_2927350_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_087503545.1|2927346_2927922_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_001204533.1|2927937_2928291_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201530.1|2928283_2928658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029702099.1|2928709_2929738_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000256814.1|2929795_2930143_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001253888.1|2930179_2931685_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_001322425.1|2931674_2933267_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_000258993.1|2933263_2933470_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001309424.1|2933453_2935382_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000235436.1|2935353_2935863_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012602757.1|2936137_2936458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322427.1|2936345_2936699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2936821_2937148_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|2937458_2937926_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|2937928_2938060_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|2938074_2938257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322430.1|2938255_2938471_+	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	90.2	1.1e-23
WP_001092866.1|2938413_2938947_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|2938983_2939874_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|2939878_2940094_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001309419.1|2940401_2940605_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000871291.1|2940850_2941186_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309418.1|2941555_2941753_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_001064909.1|2941965_2942655_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_000140038.1|2942647_2943016_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001265256.1|2943016_2944075_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_001309417.1|2944076_2944355_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001309416.1|2944421_2944673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2944889_2945045_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000786207.1|2945303_2945483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208092.1|2945603_2946590_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001229301.1|2946586_2946952_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000137948.1|2946953_2947361_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_000403791.1|2947456_2947813_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209475.1|2947790_2948252_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|2948248_2948545_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|2948541_2948934_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450706.1|2948949_2949720_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_148240174.1|2949753_2950176_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
WP_000020541.1|2950207_2951248_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|2951219_2951771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912294.1|2951754_2951982_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2952058_2952466_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000379564.1|2952672_2952825_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000394557.1|2952836_2953211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935596.1|2953741_2954596_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000450218.1|2954606_2954795_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|2954791_2954995_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001542183.1|2955072_2957529_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_000003742.1|2957590_2957860_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2957828_2958947_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2959049:2959063	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	3320871	3377073	5099810	holin,integrase,transposase,capsid,portal,head,terminase,tail,protease	Enterobacteria_phage(36.21%)	77	3343599:3343615	3384948:3384964
WP_000526135.1|3320871_3321330_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001522649.1|3321518_3322223_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3322359_3322812_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598612.1|3322813_3323059_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3323051_3323537_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3323539_3324052_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3324073_3325063_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001522645.1|3325459_3326368_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
WP_000042533.1|3326405_3328427_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044837.1|3329005_3329683_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246795.1|3329675_3330431_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_021517032.1|3330417_3331572_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3331568_3332609_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001309367.1|3332695_3333985_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767391.1|3334043_3334520_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_087503546.1|3335265_3336597_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_087503547.1|3336809_3337103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|3337145_3338186_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|3338195_3338477_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_108161041.1|3338476_3340849_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001228314.1|3341000_3341600_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_087565616.1|3341667_3345147_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
3343599:3343615	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000741589.1|3345207_3345855_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_047626242.1|3345752_3346496_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
WP_001735013.1|3346501_3347200_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
WP_001330090.1|3347199_3347556_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_032180049.1|3347533_3350761_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_077628067.1|3350807_3351068_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|3351109_3351496_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097524.1|3351495_3352200_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001546001.1|3352260_3352605_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
WP_014639219.1|3352601_3353051_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|3353047_3353386_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|3353394_3353712_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|3353788_3355006_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|3355020_3355620_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001735009.1|3355612_3356839_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_001140892.1|3356986_3358744_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|3358743_3359226_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001532429.1|3359373_3359724_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
WP_001532432.1|3359862_3360402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|3360407_3360674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|3360891_3361077_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|3361293_3361827_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193280.1|3361890_3362241_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|3362245_3362461_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000512806.1|3362826_3363315_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_001108039.1|3363358_3363970_-	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
WP_000566869.1|3363962_3364133_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001254257.1|3364129_3364312_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000736913.1|3364308_3364749_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145931.1|3364822_3365113_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788893.1|3365109_3365811_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
WP_000185505.1|3365807_3366707_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000442611.1|3366739_3367036_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
WP_001180317.1|3367174_3367402_-	transcriptional regulator	NA	G9L677	Escherichia_phage	98.7	1.7e-35
WP_002431456.1|3367481_3368189_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
WP_000433877.1|3368312_3368633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048970231.1|3368632_3369316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032194733.1|3369766_3370039_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_060578268.1|3370167_3370368_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_001308813.1|3370489_3370765_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_000604110.1|3370849_3371158_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065840.1|3371154_3372066_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
WP_060578269.1|3372049_3372532_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
WP_000753555.1|3372543_3372858_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|3372874_3373156_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|3373152_3373320_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|3373316_3373571_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_060578270.1|3373557_3374052_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
WP_060578271.1|3374224_3374413_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
WP_000951710.1|3374414_3374624_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_060578272.1|3374620_3375499_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
WP_072196869.1|3375463_3375667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545741.1|3375599_3375767_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3375806_3376025_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001540845.1|3376002_3377073_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
3384948:3384964	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 9
NZ_CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099810	4488236	4555004	5099810	integrase,transposase,tRNA,protease	Vibrio_phage(14.29%)	60	4493016:4493033	4560808:4560825
WP_001232412.1|4488236_4489241_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312481.1|4489243_4490503_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4490588_4491869_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4491944_4492253_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|4492338_4493289_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
4493016:4493033	attL	TTTCCGCCAGCGCATCGC	NA	NA	NA	NA
WP_001122460.1|4493281_4495129_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_020233522.1|4495138_4496476_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4496494_4496956_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001315155.1|4496927_4498475_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294198.1|4498473_4499613_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4499595_4499649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4500512_4501058_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041976.1|4501152_4502205_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4502301_4503270_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236793.1|4503291_4506615_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|4506765_4508268_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4508486_4509464_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_029702085.1|4509788_4511597_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4511589_4512324_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208763.1|4512334_4512730_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|4512740_4513100_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001522354.1|4513162_4514296_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001522351.1|4514383_4514917_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
WP_000118482.1|4514913_4515231_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000526135.1|4515477_4515936_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000239596.1|4516116_4516263_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977754.1|4516373_4516499_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4516550_4517117_-	elongation factor P	NA	NA	NA	NA	NA
WP_001522349.1|4517158_4518187_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001522346.1|4518421_4519291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4519340_4519694_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4519831_4521478_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4521521_4521815_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_001522339.1|4522090_4523347_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267445.1|4523362_4523839_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4524175_4525612_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4525729_4527031_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|4527145_4527484_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068919.1|4527459_4529157_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4529193_4529769_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_029701734.1|4530148_4531414_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.0e-80
WP_000147021.1|4531669_4532713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333708.1|4532855_4533086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447126.1|4534406_4534958_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071526750.1|4536772_4538215_-	amino acid permease	NA	NA	NA	NA	NA
WP_000671169.1|4538346_4540716_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_001331566.1|4540820_4542290_-	amino acid permease	NA	NA	NA	NA	NA
WP_071591535.1|4543236_4543461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564031.1|4543854_4544202_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_029702159.1|4544271_4544622_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	4.0e-39
WP_001189111.1|4545289_4546798_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_011478084.1|4547106_4547478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702173.1|4547821_4548646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564033.1|4548693_4549017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001564034.1|4549081_4549726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|4549746_4550016_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001564035.1|4550094_4550733_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.9e-56
WP_001564037.1|4550717_4551950_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	5.0e-60
WP_032153628.1|4552090_4552744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|4553730_4555004_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
4560808:4560825	attR	GCGATGCGCTGGCGGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP028585	Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence	92537	0	92104	92537	head,portal,holin,integrase,plate,tail,transposase	Escherichia_phage(86.79%)	115	55708:55724	68979:68995
WP_087503506.1|117_921_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
WP_087503507.1|991_1450_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
WP_072650276.1|1603_2062_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
WP_032342084.1|2080_2473_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
WP_032342068.1|2631_4329_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
WP_087503508.1|4476_4755_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
WP_087503509.1|4822_6481_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
WP_000801017.1|6524_7259_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_087503510.1|7326_7899_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
WP_000012433.1|7907_8399_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_000187854.1|8453_9005_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_000021878.1|9020_9728_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|10109_10865_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_001025048.1|11253_12075_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
WP_087503511.1|16531_16906_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
WP_023908648.1|16902_18333_+	bleomycin hydrolase	NA	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
WP_023908647.1|18343_19189_+	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
WP_001396839.1|19580_19730_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_108161039.1|19732_21619_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	53.0	6.4e-107
WP_000072166.1|21618_22233_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_001573915.1|22239_22695_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	3.1e-31
WP_087503512.1|22722_23163_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	54.9	3.5e-40
WP_000904922.1|23222_23795_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_053919841.1|24011_24338_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
WP_000526264.1|24337_24784_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_073714457.1|24773_25394_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
WP_087503513.1|25386_27324_+|head	head protein	head	A0A222YWA3	Escherichia_phage	98.3	0.0e+00
WP_060877123.1|27323_27698_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_080028495.1|27814_29023_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_060877101.1|29129_30515_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
WP_071992514.1|31029_32262_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	9.6e-237
WP_001191134.1|32275_33274_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
WP_087503520.1|33474_34437_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
WP_000245715.1|34851_35076_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_052936018.1|35075_35783_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
WP_001344836.1|35782_35980_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
WP_001273800.1|36012_36498_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_087503521.1|36649_43486_+	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
WP_074470334.1|43522_43957_+	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
WP_074470335.1|43959_44220_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
WP_086252943.1|44554_44851_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_001238268.1|44865_45066_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_050586432.1|45080_45362_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
WP_000077919.1|45475_46684_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
WP_024134673.1|48042_48228_-	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
WP_000467090.1|49043_49478_+	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_000579539.1|49477_49642_+	DUF3927 family protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000488304.1|50675_50867_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_001130998.1|51073_51259_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000435256.1|51367_51760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031325887.1|52140_53121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000897063.1|53120_54629_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_000888609.1|54656_54896_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
55708:55724	attL	TTTAGTTTTCTAACATA	NA	NA	NA	NA
WP_087503522.1|56088_57117_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
WP_087503523.1|57191_57536_+	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
WP_087503524.1|57532_58009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000640903.1|58005_58500_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
WP_060877112.1|58514_59177_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
WP_087503525.1|59183_59951_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
WP_087503526.1|59940_61035_+	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
WP_001216041.1|61070_61451_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
WP_001190712.1|61450_61672_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_032153799.1|61744_62134_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
WP_032153798.1|62257_62509_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
WP_001408980.1|62511_62712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503527.1|62823_63594_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	73.0	3.1e-116
WP_087503528.1|63590_63899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503529.1|63898_64192_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
WP_063074823.1|64204_64621_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
WP_087503530.1|64906_65167_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
WP_087503531.1|65163_65853_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
WP_000951710.1|65849_66059_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_000797279.1|66060_66249_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_047647121.1|66594_67041_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
WP_087503532.1|67037_67658_-	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
WP_060877081.1|67654_67846_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
WP_108161037.1|67842_67929_-	DUF4752 family protein	NA	NA	NA	NA	NA
WP_087503533.1|67942_68938_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
WP_087503534.1|69034_69703_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
68979:68995	attR	TATGTTAGAAAACTAAA	NA	NA	NA	NA
WP_108161038.1|69739_70948_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
WP_001092152.1|71059_71371_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
WP_023908608.1|71367_71592_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
WP_023908607.1|71569_71863_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
WP_023908606.1|71859_72108_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
WP_087503498.1|72104_72746_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
WP_087503499.1|72742_73252_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
WP_050552930.1|73241_73526_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
WP_000240859.1|73555_74179_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
WP_087503500.1|74451_75030_+	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
WP_071526433.1|75702_75822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022630900.1|75840_76056_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
WP_072275558.1|76055_76982_+	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
WP_000717724.1|77041_77353_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
WP_001396850.1|77349_77577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032323273.1|77762_78371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410954.1|78654_79308_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
WP_032323275.1|79644_79926_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
WP_032323276.1|79934_80216_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_000542383.1|80308_80638_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_063074560.1|80630_81824_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
WP_080077649.1|81857_82586_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
WP_001022420.1|82607_82808_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
WP_000806445.1|82864_83203_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|83273_83576_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_063074813.1|83738_84530_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
WP_000203293.1|84526_85294_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_069936439.1|85297_86278_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
WP_087503501.1|86274_86928_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
WP_087503502.1|86987_87893_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
WP_000812238.1|87876_88557_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_087503503.1|88549_89455_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
WP_087503504.1|89599_89884_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
WP_087503505.1|89876_90518_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
WP_052930744.1|90796_91135_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
WP_001217888.1|91147_92104_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
>prophage 1
NZ_CP028587	Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence	150853	1262	88640	150853	protease,transposase,integrase	Escherichia_phage(43.48%)	94	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2678_3848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4694_4967_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|6209_8180_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8186_8978_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001317493.1|9716_10499_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|12597_12972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|12996_13701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|14327_14885_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000210409.1|15026_15608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|15612_15951_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|15980_16310_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|16523_17630_+	alkene reductase	NA	NA	NA	NA	NA
WP_087503554.1|17695_18064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|18009_18714_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049802299.1|19596_19860_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|19852_20239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|20246_20933_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|20910_21537_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|21615_22821_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001323225.1|23811_23994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449408.1|24015_24174_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|24163_24670_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|24852_25668_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_071528361.1|25826_26012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118029.1|26014_27901_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|27941_28469_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|28572_29952_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|29954_31238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|31227_32358_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|32362_33058_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|33044_33530_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|33554_34040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546935.1|35325_36330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000734115.1|36769_37522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000090196.1|37763_38636_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000872613.1|38766_39990_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032152933.1|40175_40949_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|41525_42230_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336397.1|42708_43065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|43010_43595_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|43594_44833_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|44829_45735_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067858.1|45856_46561_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077788461.1|46537_46720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|46901_47174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|47192_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47301_48141_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48134_48482_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|48687_49476_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|49606_50080_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|50237_51251_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_122997045.1|51219_51744_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|51780_52485_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000239590.1|53762_54638_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|54684_55017_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|57338_58043_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|59236_59779_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|59791_60652_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|60758_61463_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|62094_62925_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|63055_63610_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|63753_64458_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|65059_65665_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|65759_68657_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|68793_69195_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|69127_69385_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|69477_70131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071889078.1|70320_70707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152935.1|71069_71927_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|71919_71994_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_072163418.1|72077_72188_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083821.1|72228_72486_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071529016.1|72452_72704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|72890_73913_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000005489.1|74384_74738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152936.1|75150_75729_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_059330006.1|76567_76930_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|76926_77277_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080227.1|77307_77529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001496175.1|77885_78365_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000514417.1|78445_79849_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000154545.1|79896_80901_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000440183.1|80985_81897_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410951.1|81907_83128_-	arginine deiminase	NA	NA	NA	NA	NA
WP_032336874.1|84887_84962_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_071586949.1|85045_85162_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083833.1|85197_85455_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|85738_85888_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_023149666.1|85943_86186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072142979.1|86131_86365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149734.1|87068_88640_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
>prophage 1
NZ_CP028588	Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence	42856	11795	19910	42856	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_148240171.1|11795_12182_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.9	1.7e-59
WP_032667561.1|12178_12526_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
WP_032667560.1|12576_14115_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
WP_005012528.1|14225_15440_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_032667557.1|15473_16907_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
WP_108082295.1|17055_17752_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
WP_123615964.1|17906_18743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053514996.1|18986_19910_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
