The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	68098	75616	5051470		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|68098_68647_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|68651_69530_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|69587_70487_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|70486_71572_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|71943_72837_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|73068_74064_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_087503483.1|74221_75616_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
>prophage 2
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	123021	184076	5051470	portal,tRNA,head,terminase,lysis,tail,plate,integrase,transposase,holin,capsid	Escherichia_phage(42.22%)	71	127310:127336	160189:160215
WP_000675148.1|123021_124425_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|124421_125144_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|125323_125656_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|125803_127165_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
127310:127336	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|127437_127656_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|127737_128901_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_001565024.1|128900_129380_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_021523174.1|129394_131842_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|131834_131954_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_020233494.1|131986_132262_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251412.1|132318_132837_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233495.1|132849_134040_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_032142943.1|134369_134963_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_021523177.1|135184_135712_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|135713_137735_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_001285325.1|137745_138276_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|138268_139177_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|139181_139529_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|139525_140161_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_021523179.1|140244_141030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|141101_141554_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|141546_142014_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|141976_142150_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001512906.1|142121_142547_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_000736608.1|142534_142960_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|142974_143472_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|143471_143753_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|143756_143960_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|143959_144469_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203455.1|144568_145312_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_020233501.1|145315_146389_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|146447_147302_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156847.1|147475_149248_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001533791.1|149247_150282_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_124759995.1|150320_150593_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	1.0e-18
WP_029401227.1|150668_152093_+	histidine kinase	NA	NA	NA	NA	NA
WP_029401228.1|152089_153082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029401229.1|153032_154184_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029701698.1|156519_156795_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029701699.1|156791_157016_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_001754915.1|157015_157318_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_000557703.1|157317_157542_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_029701701.1|157605_158106_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_029701703.1|158283_158559_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_000020919.1|158680_158980_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_087503482.1|159095_160109_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
WP_023154000.1|160206_160398_-	hypothetical protein	NA	NA	NA	NA	NA
160189:160215	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_001303579.1|160385_160703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807371.1|161117_162017_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_000178552.1|162098_162878_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|162977_164018_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490663.1|164065_165421_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|165424_165709_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182900.1|165739_166192_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001308759.1|167487_168342_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|168571_169624_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858471.1|169880_171158_+	MFS transporter	NA	NA	NA	NA	NA
WP_001520828.1|171154_172159_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_001520829.1|172155_173121_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|173094_173841_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020233504.1|173892_174711_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000822277.1|174775_175576_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195594.1|175572_176361_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|176583_176856_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134572.1|176976_177801_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|178019_178358_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000702203.1|178439_179474_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_001520833.1|179489_181970_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677340.1|181985_182660_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|182740_183283_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000526135.1|183617_184076_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	199547	208990	5051470		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|199547_200684_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|200680_202681_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|202805_203267_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|203308_203779_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|203825_204545_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|204541_206227_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|206448_207180_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|207239_207347_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|207327_208059_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|208063_208990_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 4
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	421914	494540	5051470	portal,tRNA,head,terminase,lysis,integrase,holin	Enterobacteria_phage(46.77%)	91	453594:453616	502279:502301
WP_001283590.1|421914_422727_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|422726_423740_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699144.1|423805_424942_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
WP_001520944.1|425040_426036_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|426032_427211_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|427486_428707_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001520946.1|428865_430872_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|430927_431206_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089216.1|431239_431788_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_001520948.1|431787_432597_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043827.1|432596_433421_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|433424_434510_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001309606.1|434544_435477_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730805.1|435642_436194_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001520950.1|436263_437127_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001037531.1|437128_437674_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826833.1|437670_438150_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826023.1|438146_438638_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170521.1|438653_439403_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_020232969.1|439422_442062_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033306.1|442145_442712_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|443373_443859_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425037.1|444061_446206_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531924.1|446205_447516_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|447696_447981_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001520953.1|448352_449693_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001520954.1|450058_451306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|451484_452240_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|452533_453466_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
453594:453616	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_087503470.1|453777_454935_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
WP_100249830.1|455051_455744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050596990.1|455708_456440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503469.1|456559_458959_-|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
WP_087503468.1|459123_461517_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_087503467.1|461517_462849_-	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
WP_087503466.1|462858_463551_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_087503465.1|463553_464009_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
WP_087503464.1|464008_464962_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_085701391.1|464961_466380_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
WP_000246750.1|466388_466871_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375637.1|466845_467031_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_060579115.1|467073_468345_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
WP_000426735.1|468356_469241_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.7	8.1e-145
WP_000852333.1|469254_471381_-|portal	portal protein p19	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_060579116.1|471383_472796_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_001436504.1|472792_473215_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_031624844.1|473238_473418_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
WP_001700895.1|473427_473715_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
WP_000807789.1|473718_473961_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_001058931.1|474209_474695_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_021568311.1|474900_475053_-	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
WP_063123791.1|475040_475508_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
WP_000229389.1|475504_475981_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|475964_476288_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027554.1|476883_477402_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994516.1|477398_477587_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001549462.1|477583_477946_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_023146907.1|477946_478471_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_000002250.1|478467_478758_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_023146906.1|478757_479480_-	phage antirepressor protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
WP_000566866.1|479472_479643_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_024176095.1|479639_479822_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_023146905.1|479818_480346_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
WP_000736913.1|480342_480783_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001749476.1|480856_482233_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_087503463.1|482229_483177_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
WP_001244621.1|483179_483452_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|483474_483768_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001194218.1|483887_484103_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|484206_484839_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618034.1|484835_485240_+	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_077694523.1|485489_485870_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000213975.1|485948_486149_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000972063.1|486375_486510_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|486494_486647_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|486731_487040_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_032153682.1|487036_487948_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
WP_032153683.1|487931_488414_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_000753555.1|488425_488740_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|488756_489038_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|489034_489202_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|489198_489453_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_029701302.1|489439_490132_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_000951706.1|490133_490343_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_029701304.1|490339_491131_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_029701309.1|491123_491408_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_000545716.1|491479_491647_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_001163428.1|491704_491905_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001535474.1|492157_493444_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001706457.1|493445_494192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|494348_494540_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
502279:502301	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 5
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	870311	877451	5051470		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|870311_872873_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|872978_873635_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|873685_874453_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|874648_875557_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|875553_876816_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|876812_877451_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	3715858	3772060	5051470	portal,head,terminase,tail,integrase,transposase,holin,protease,capsid	Enterobacteria_phage(36.21%)	77	3707968:3707984	3749317:3749333
3707968:3707984	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_001540845.1|3715858_3716929_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
WP_001303849.1|3716906_3717125_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545741.1|3717164_3717332_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_072196869.1|3717264_3717468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060578272.1|3717432_3718311_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
WP_000951710.1|3718307_3718517_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_060578271.1|3718518_3718707_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
WP_060578270.1|3718879_3719374_-	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
WP_029701301.1|3719360_3719615_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_032153684.1|3719611_3719779_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701300.1|3719775_3720057_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_000753555.1|3720073_3720388_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_060578269.1|3720399_3720882_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
WP_000065840.1|3720865_3721777_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
WP_000604110.1|3721773_3722082_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_001308813.1|3722166_3722442_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_060578268.1|3722563_3722764_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_032194733.1|3722892_3723165_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_048970231.1|3723615_3724299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433877.1|3724298_3724619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002431456.1|3724742_3725450_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
WP_001180317.1|3725529_3725757_+	transcriptional regulator	NA	G9L677	Escherichia_phage	98.7	1.7e-35
WP_000442611.1|3725895_3726192_+	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
WP_000185505.1|3726224_3727124_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788893.1|3727120_3727822_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
WP_000145931.1|3727818_3728109_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|3728182_3728623_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254257.1|3728619_3728802_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000566869.1|3728798_3728969_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108039.1|3728961_3729573_+	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
WP_000512806.1|3729616_3730105_+	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_000839572.1|3730470_3730686_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193280.1|3730690_3731041_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992100.1|3731104_3731638_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228685.1|3731854_3732040_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001100260.1|3732257_3732524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532432.1|3732529_3733069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532429.1|3733207_3733558_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
WP_023153903.1|3733705_3734188_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140892.1|3734187_3735945_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001735009.1|3736092_3737319_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_000999828.1|3737311_3737911_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766108.1|3737925_3739143_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000719066.1|3739219_3739537_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_001147814.1|3739545_3739884_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_014639219.1|3739880_3740330_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001546001.1|3740326_3740671_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
WP_000097524.1|3740731_3741436_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001324129.1|3741435_3741822_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077628067.1|3741863_3742124_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_032180049.1|3742170_3745398_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_001330090.1|3745375_3745732_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001735013.1|3745731_3746430_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
WP_047626242.1|3746435_3747179_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
WP_000741589.1|3747076_3747724_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_087565616.1|3747784_3751264_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
3749317:3749333	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
WP_001228314.1|3751331_3751931_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_108161041.1|3752082_3754455_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_000654155.1|3754454_3754736_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_001314683.1|3754745_3755786_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_087503547.1|3755828_3756122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503546.1|3756334_3757666_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767391.1|3758411_3758888_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001309367.1|3758946_3760236_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000951213.1|3760322_3761363_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_021517032.1|3761359_3762514_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246795.1|3762500_3763256_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044837.1|3763248_3763926_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|3764504_3766526_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001522645.1|3766563_3767472_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
WP_001295301.1|3767868_3768858_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084639.1|3768879_3769392_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|3769394_3769880_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598612.1|3769872_3770118_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852287.1|3770119_3770572_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_001522649.1|3770708_3771413_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000526135.1|3771601_3772060_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	4118258	4191650	5051470	portal,tRNA,head,terminase,lysis,tail,integrase,transposase,holin,capsid	Escherichia_phage(36.84%)	90	4119386:4119401	4164094:4164109
WP_000526135.1|4118258_4118717_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000598207.1|4118838_4119798_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
4119386:4119401	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
WP_024166502.1|4119944_4123391_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|4123518_4124592_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|4124852_4126052_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|4126044_4126746_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|4126745_4127990_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|4128018_4128930_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4128945_4129767_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|4129903_4130689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|4130685_4131147_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|4131204_4132251_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|4132247_4133042_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|4133208_4134327_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4134295_4134565_-	excisionase	NA	NA	NA	NA	NA
WP_001542183.1|4134626_4137083_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_001093951.1|4137160_4137364_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|4137360_4137549_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|4137559_4138414_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|4138944_4139319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|4139330_4139483_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|4139689_4140097_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|4140173_4140401_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|4140384_4140936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|4140907_4141948_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_148240174.1|4141979_4142402_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
WP_000450706.1|4142435_4143206_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|4143221_4143614_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|4143610_4143907_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|4143903_4144365_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|4144342_4144699_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137948.1|4144794_4145202_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_001229301.1|4145203_4145569_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|4145565_4146552_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000786207.1|4146672_4146852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4147110_4147266_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|4147482_4147734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|4147800_4148079_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|4148080_4149139_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|4149139_4149508_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|4149500_4150190_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|4150402_4150600_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_000871291.1|4150969_4151305_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|4151550_4151754_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000284506.1|4152061_4152277_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|4152281_4153172_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|4153208_4153742_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001322430.1|4153684_4153900_-	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	90.2	1.1e-23
WP_001446668.1|4153898_4154081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|4154095_4154227_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|4154229_4154697_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|4155007_4155334_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|4155456_4155810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602757.1|4155697_4156018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|4156292_4156802_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|4156773_4158702_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|4158685_4158892_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|4158888_4160481_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|4160470_4161976_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|4162012_4162360_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_029702099.1|4162417_4163446_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|4163497_4163872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|4163864_4164218_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
4164094:4164109	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
WP_087503545.1|4164233_4164809_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|4164805_4165201_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|4165208_4165961_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|4165974_4166406_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|4166432_4166846_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|4166826_4169388_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|4169384_4169714_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|4169713_4170412_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|4170422_4171166_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|4171111_4171744_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000559722.1|4171765_4172107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000514726.1|4172087_4175780_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_001233148.1|4175847_4176447_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|4176598_4179625_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|4179624_4180209_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_001309429.1|4180181_4180319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240999.1|4180263_4180932_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|4180988_4181255_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|4181486_4182350_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4182333_4183470_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|4183719_4184946_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4184994_4186116_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|4186191_4187652_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4187651_4188323_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4188492_4189863_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4189866_4190508_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|4190543_4191650_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051470	4617398	4680675	5051470	portal,head,terminase,lysis,tail,integrase,transposase,capsid	Enterobacteria_phage(41.82%)	83	4648252:4648267	4685371:4685386
WP_000527786.1|4617398_4618859_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_029701979.1|4618947_4620231_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4620834_4620948_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4621016_4621250_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4621566_4622157_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|4622384_4622678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|4622688_4623393_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|4623402_4623684_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_032152843.1|4623680_4626080_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001542091.1|4626144_4626744_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|4626811_4630291_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|4630351_4630954_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|4630890_4631634_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_029702161.1|4631639_4632338_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|4632337_4632667_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_048219008.1|4632663_4635225_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
WP_000459457.1|4635217_4635652_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|4635633_4636056_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|4636071_4636812_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|4636819_4637215_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|4637211_4637790_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|4637801_4638155_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|4638166_4638565_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|4638606_4639632_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|4639686_4640019_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|4640028_4641348_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|4641328_4642930_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|4642926_4643133_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|4643129_4645055_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|4645029_4645575_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|4645963_4646197_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|4646254_4646665_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|4646816_4646990_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4647161_4647317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|4647396_4647462_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|4647464_4647653_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4647663_4647876_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4648238_4648736_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
4648252:4648267	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|4648732_4649266_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|4649262_4649574_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|4649578_4649794_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000526135.1|4650350_4650809_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000066484.1|4651259_4651475_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|4651775_4651988_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|4652042_4652132_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|4652409_4653162_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|4653175_4654225_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|4654226_4654505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|4654571_4654823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4655039_4655195_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|4655266_4655554_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|4655553_4655793_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|4655817_4656123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|4656325_4656658_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|4657094_4658408_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001345551.1|4658891_4659920_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|4659916_4660531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|4660739_4661405_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|4661607_4662006_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|4662046_4663012_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|4662992_4663514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|4663497_4663725_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|4663805_4664213_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|4664381_4664537_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_148240173.1|4664538_4665114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4665600_4665789_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|4665785_4665977_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|4666070_4668542_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001296941.1|4668629_4668866_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_077882484.1|4668858_4668960_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|4668936_4669614_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4669613_4669961_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_087565618.1|4669980_4671552_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
WP_021523105.1|4671607_4672888_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|4672889_4673018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|4673075_4674095_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|4674106_4675321_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|4675526_4675853_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|4675987_4676329_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|4676363_4676924_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|4676926_4677637_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|4677744_4678050_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|4678248_4680675_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
4685371:4685386	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP022228	Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence	92538	0	92111	92538	holin,tail,head,transposase,portal,integrase,plate	Escherichia_phage(87.74%)	114	607:621	64752:64766
607:621	attL	CCGCTGGTGGCTGAT	NA	NA	NA	NA
WP_001408980.1|759_960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153798.1|962_1214_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
WP_032153799.1|1337_1727_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
WP_001190712.1|1799_2021_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216041.1|2020_2401_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
WP_087503526.1|2436_3531_-	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
WP_087503525.1|3520_4288_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
WP_060877112.1|4294_4957_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
WP_000640903.1|4971_5466_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
WP_087503524.1|5462_5939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503523.1|5935_6280_-	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
WP_087503522.1|6354_7383_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
WP_000888609.1|8575_8815_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_000897063.1|8842_10351_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_031325887.1|10350_11331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|11711_12104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|12212_12398_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|12604_12796_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000579539.1|13829_13994_-	DUF3927 family protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000467090.1|13993_14428_-	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_024134673.1|15243_15429_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
WP_000077919.1|16787_17996_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
WP_050586432.1|18109_18391_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
WP_001238268.1|18405_18606_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_086252943.1|18620_18917_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_074470335.1|19251_19512_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
WP_074470334.1|19514_19949_-	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
WP_087503521.1|19985_26822_-	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
WP_001273800.1|26973_27459_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_001344836.1|27491_27689_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
WP_052936018.1|27688_28396_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
WP_000245715.1|28395_28620_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_087503520.1|29034_29997_-	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
WP_001191134.1|30197_31196_-	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
WP_071992514.1|31209_32442_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	9.6e-237
WP_060877101.1|32956_34342_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
WP_080028495.1|34448_35657_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_060877123.1|35773_36148_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_087503513.1|36147_38085_-|head	head protein	head	A0A222YWA3	Escherichia_phage	98.3	0.0e+00
WP_073714457.1|38077_38698_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
WP_000526264.1|38687_39134_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_053919841.1|39133_39460_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
WP_000904922.1|39676_40249_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_087503512.1|40308_40749_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	54.9	3.5e-40
WP_032143395.1|40759_41233_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_000072166.1|41239_41854_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_108161039.1|41853_43740_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	53.0	6.4e-107
WP_001396839.1|43742_43892_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_023908647.1|44283_45129_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
WP_023908648.1|45139_46570_-	bleomycin hydrolase	NA	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
WP_087503511.1|46566_46941_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
WP_001025048.1|51397_52219_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
WP_001077897.1|52607_53363_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|53744_54452_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187854.1|54467_55019_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_000012433.1|55073_55565_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_087503510.1|55573_56146_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
WP_000801017.1|56213_56948_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_087503509.1|56991_58650_-|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
WP_087503508.1|58717_58996_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
WP_032342068.1|59143_60841_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
WP_032342084.1|60999_61392_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
WP_072650276.1|61410_61869_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
WP_087503507.1|62022_62481_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
WP_087503506.1|62551_63355_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
WP_074417202.1|63354_63639_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
WP_001217888.1|63905_64862_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
64752:64766	attR	CCGCTGGTGGCTGAT	NA	NA	NA	NA
WP_052930744.1|64874_65213_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
WP_087503505.1|65491_66133_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
WP_087503504.1|66125_66410_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
WP_087503503.1|66554_67460_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
WP_000812238.1|67452_68133_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_087503502.1|68116_69022_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
WP_087503501.1|69081_69735_-|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
WP_069936439.1|69731_70712_-|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
WP_000203293.1|70715_71483_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_063074813.1|71479_72271_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
WP_000162415.1|72433_72736_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|72806_73145_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_001022420.1|73201_73402_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
WP_080077649.1|73423_74152_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
WP_063074560.1|74185_75379_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
WP_000542383.1|75371_75701_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_032323276.1|75793_76075_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_032323275.1|76083_76365_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
WP_000410954.1|76701_77355_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
WP_032323273.1|77638_78247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001396850.1|78432_78660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000717724.1|78656_78968_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
WP_072275558.1|79027_79954_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
WP_022630900.1|79953_80169_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
WP_071526433.1|80187_80307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503500.1|80979_81558_-	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
WP_000240859.1|81830_82454_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
WP_050552930.1|82483_82768_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
WP_087503499.1|82757_83267_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
WP_087503498.1|83263_83905_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
WP_023908606.1|83901_84150_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
WP_023908607.1|84146_84440_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
WP_023908608.1|84417_84642_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
WP_001092152.1|84638_84950_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
WP_108161038.1|85061_86270_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
WP_087503534.1|86306_86975_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
WP_087503533.1|87071_88067_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
WP_108161037.1|88080_88167_+	DUF4752 family protein	NA	NA	NA	NA	NA
WP_060877081.1|88163_88355_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
WP_087503532.1|88351_88972_+	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
WP_047647121.1|88968_89415_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
WP_000797279.1|89760_89949_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000951710.1|89950_90160_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_087503531.1|90156_90846_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
WP_087503530.1|90842_91103_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
WP_063074823.1|91388_91805_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
WP_087503529.1|91817_92111_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
>prophage 1
NZ_CP022227	Escherichia coli strain WCHEC96200 plasmid pCTXM15_000200, complete sequence	150853	1262	88640	150853	integrase,protease,transposase	Escherichia_phage(43.48%)	94	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2678_3848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4694_4967_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|6209_8180_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8186_8978_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001317493.1|9716_10499_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|12597_12972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|12996_13701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|14327_14885_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000210409.1|15026_15608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|15612_15951_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|15980_16310_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|16523_17630_+	alkene reductase	NA	NA	NA	NA	NA
WP_087503554.1|17695_18064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|18009_18714_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049802299.1|19596_19860_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|19852_20239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|20246_20933_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|20910_21537_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|21615_22821_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001323225.1|23811_23994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449408.1|24015_24174_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|24163_24670_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|24852_25668_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_071528361.1|25826_26012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118029.1|26014_27901_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|27941_28469_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|28572_29952_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|29954_31238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|31227_32358_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|32362_33058_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|33044_33530_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|33554_34040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546935.1|35325_36330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000734115.1|36769_37522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000090196.1|37763_38636_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000872613.1|38766_39990_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032152933.1|40175_40949_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|41525_42230_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336397.1|42708_43065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|43010_43595_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|43594_44833_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|44829_45735_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067858.1|45856_46561_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077788461.1|46537_46720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|46901_47174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|47192_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47301_48141_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48134_48482_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|48687_49476_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|49606_50080_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|50237_51251_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_122997045.1|51219_51744_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|51780_52485_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000239590.1|53762_54638_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|54684_55017_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|57338_58043_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|59236_59779_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|59791_60652_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|60758_61463_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|62094_62925_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|63055_63610_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|63753_64458_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|65059_65665_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|65759_68657_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|68793_69195_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|69127_69385_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|69477_70131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071889078.1|70320_70707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152935.1|71069_71927_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|71919_71994_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_072163418.1|72077_72188_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083821.1|72228_72486_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071529016.1|72452_72704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|72890_73913_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000005489.1|74384_74738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152936.1|75150_75729_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_059330006.1|76567_76930_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|76926_77277_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080227.1|77307_77529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001496175.1|77885_78365_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000514417.1|78445_79849_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000154545.1|79896_80901_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000440183.1|80985_81897_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410951.1|81907_83128_-	arginine deiminase	NA	NA	NA	NA	NA
WP_032336874.1|84887_84962_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_071586949.1|85045_85162_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083833.1|85197_85455_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|85738_85888_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_023149666.1|85943_86186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072142979.1|86131_86365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149734.1|87068_88640_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
>prophage 1
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	45476	11268	19383	45476	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_148240171.1|11268_11655_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.9	1.7e-59
WP_032667561.1|11651_11999_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
WP_032667560.1|12049_13588_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
WP_005012528.1|13698_14913_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_032667557.1|14946_16380_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
WP_108082295.1|16528_17225_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
WP_123615964.1|17379_18216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053514996.1|18459_19383_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
