The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	1115574	1122714	5099269		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1115574_1116213_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|1116209_1117472_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|1117468_1118377_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|1118572_1119340_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|1119390_1120047_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|1120152_1122714_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	1498507	1536488	5099269	terminase,lysis,holin,head,portal	Enterobacteria_phage(48.28%)	60	NA	NA
WP_000749077.1|1498507_1498699_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001706457.1|1498855_1499602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535474.1|1499603_1500890_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001163428.1|1501142_1501343_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545716.1|1501400_1501568_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_029701309.1|1501639_1501924_-	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_029701304.1|1501916_1502708_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_077697759.1|1502704_1502944_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	8.8e-38
WP_029701302.1|1502915_1503608_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_029701301.1|1503594_1503849_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_032153684.1|1503845_1504013_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701300.1|1504009_1504291_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_000753555.1|1504307_1504622_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_032153683.1|1504633_1505116_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_032153682.1|1505099_1506011_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
WP_000604111.1|1506007_1506316_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_001243355.1|1506400_1506553_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1506537_1506672_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000213975.1|1506898_1507099_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_077694523.1|1507177_1507558_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000618034.1|1507807_1508212_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_000028392.1|1508208_1508841_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1508944_1509160_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251072.1|1509279_1509573_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1509595_1509868_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_087503463.1|1509870_1510818_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
WP_001749476.1|1510814_1512191_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_000504483.1|1512246_1512705_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
WP_023146905.1|1512701_1513229_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
WP_024176095.1|1513225_1513408_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000566866.1|1513404_1513575_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_023146906.1|1513567_1514290_+	phage antirepressor protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
WP_000002250.1|1514289_1514580_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_023146907.1|1514576_1515101_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_001549462.1|1515101_1515464_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_000994516.1|1515460_1515649_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027554.1|1515645_1516164_+	DUF1133 domain-containing protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_077695449.1|1516281_1516512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000783734.1|1516759_1517083_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1517066_1517543_+	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_063123791.1|1517539_1518007_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
WP_021568311.1|1517994_1518147_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
WP_001058931.1|1518352_1518838_+	helicase	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807789.1|1519086_1519329_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_001700895.1|1519332_1519620_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
WP_031624844.1|1519629_1519809_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
WP_001436504.1|1519832_1520255_+	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_060579116.1|1520251_1521664_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_000852333.1|1521666_1523793_+|portal	portal protein p19	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_000426735.1|1523806_1524691_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.7	8.1e-145
WP_060579115.1|1524702_1525974_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
WP_000375637.1|1526016_1526202_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246750.1|1526176_1526659_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_085701391.1|1526667_1528086_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
WP_087503464.1|1528085_1529039_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_087503465.1|1529038_1529494_+	DUF2824 domain-containing protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
WP_087503466.1|1529496_1530189_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_087503467.1|1530198_1531530_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
WP_087503468.1|1531530_1533924_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_087503469.1|1534088_1536488_+|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
>prophage 3
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	1784057	1793500	5099269		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569374.1|1784057_1784984_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|1784988_1785720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216963.1|1785700_1785808_-	membrane protein	NA	NA	NA	NA	NA
WP_001240398.1|1785867_1786599_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|1786820_1788506_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1788502_1789222_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001295430.1|1789268_1789739_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1789780_1790242_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|1790366_1792367_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001520842.1|1792363_1793500_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	1804939	1870026	5099269	transposase,integrase,tRNA,tail,capsid,plate,terminase,holin,lysis,head,portal	Escherichia_phage(40.43%)	75	1832833:1832859	1865712:1865738
WP_001520834.1|1804939_1806973_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|1807104_1808214_+	protein mrp	NA	NA	NA	NA	NA
WP_001328276.1|1808476_1808758_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
WP_086776288.1|1808811_1809015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309126.1|1808920_1809430_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	7.5e-10
WP_000830468.1|1809764_1810307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000677340.1|1810387_1811062_+	fimbrial assembly chaperone protein StcB	NA	NA	NA	NA	NA
WP_001520833.1|1811077_1813558_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000702203.1|1813573_1814608_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1814689_1815028_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1815246_1816071_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1816191_1816464_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001195594.1|1816686_1817475_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|1817471_1818272_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|1818336_1819155_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|1819206_1819953_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|1819926_1820892_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|1820888_1821893_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|1821889_1823167_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1823423_1824476_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|1824705_1825560_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000182900.1|1826855_1827308_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1827338_1827623_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|1827626_1828982_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|1829029_1830070_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1830169_1830949_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1831030_1831930_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1832344_1832662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023154000.1|1832649_1832841_+	hypothetical protein	NA	NA	NA	NA	NA
1832833:1832859	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_087503482.1|1832938_1833952_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
WP_000020919.1|1834067_1834367_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_029701703.1|1834488_1834764_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_029701701.1|1834941_1835442_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_000557703.1|1835505_1835730_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|1835729_1836032_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_029701699.1|1836031_1836256_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_029701698.1|1836252_1836528_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029401229.1|1838863_1840015_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029401228.1|1839965_1840958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029401227.1|1840954_1842379_-	histidine kinase	NA	NA	NA	NA	NA
WP_071811791.1|1842502_1842727_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.6e-19
WP_001533791.1|1842765_1843800_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_000156847.1|1843799_1845572_-|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_020233502.1|1845745_1846600_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_020233501.1|1846658_1847732_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_000203455.1|1847735_1848479_+|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_000988636.1|1848578_1849088_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|1849087_1849291_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1849294_1849576_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1849575_1850073_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|1850087_1850513_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|1850500_1850926_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|1850897_1851071_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|1851033_1851501_+|tail	tail fiber protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|1851493_1851946_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_021523179.1|1852017_1852803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233499.1|1852886_1853522_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127164.1|1853518_1853866_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|1853870_1854779_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|1854771_1855302_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_021523178.1|1855312_1857334_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_021523177.1|1857335_1857863_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_032142943.1|1858084_1858678_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_020233495.1|1859007_1860198_+|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|1860210_1860729_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|1860785_1861061_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1861093_1861213_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|1861205_1863653_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|1863667_1864147_+	hypothetical protein	NA	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|1864146_1865310_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000035493.1|1865355_1865610_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
WP_001520824.1|1865882_1867244_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
1865712:1865738	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1867391_1867724_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_000137877.1|1867903_1868626_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|1868622_1870026_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	1917431	1924949	5099269		Escherichia_phage(42.86%)	8	NA	NA
WP_087503483.1|1917431_1918826_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
WP_021523159.1|1918983_1919979_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|1920210_1921104_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_071779345.1|1921140_1921404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515524.1|1921475_1922561_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|1922560_1923460_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|1923517_1924396_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|1924400_1924949_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	2399016	2474579	5099269	transposase,tail,capsid,protease,terminase,lysis,head,portal	Enterobacteria_phage(39.66%)	96	NA	NA
WP_001260850.1|2399016_2399838_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2399937_2400021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2400113_2400449_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2400845_2402099_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|2402205_2403099_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523109.1|2403233_2404454_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_000919226.1|2404578_2405274_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_071593650.1|2405226_2406519_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_001520571.1|2406677_2407292_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
WP_020233477.1|2407334_2408189_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520568.1|2408190_2408808_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_072170800.1|2408818_2411242_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
WP_001551145.1|2411302_2413729_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2413927_2414233_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2414340_2415051_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2415053_2415614_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|2415648_2415990_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_001314753.1|2416124_2416451_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_071526504.1|2416487_2416676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|2416656_2417871_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2417882_2418902_+	oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2418959_2419088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153826.1|2419089_2420385_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
WP_087565618.1|2420425_2421997_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
WP_000624622.1|2422016_2422364_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2422363_2423041_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_077882484.1|2423017_2423119_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000005552.1|2423111_2423363_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048363.1|2423435_2425907_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|2426000_2426192_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000854559.1|2426188_2426377_-	division inhibition protein DicB	NA	NA	NA	NA	NA
WP_087503549.1|2426863_2427481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2427440_2427596_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|2427764_2428172_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2428252_2428480_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|2428463_2428985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077251938.1|2428911_2429931_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
WP_001151242.1|2429971_2430370_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_021523102.1|2430572_2431238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265627.1|2431446_2432061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345551.1|2432057_2433086_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000589005.1|2433569_2434883_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099121078.1|2434927_2435050_+	plasmid mobilization protein	NA	NA	NA	NA	NA
WP_001301033.1|2435319_2435652_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2435854_2436160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2436184_2436424_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2436423_2436711_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2436782_2436938_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2437154_2437406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2437472_2437751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2437752_2438802_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2438815_2439568_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_000087756.1|2439989_2440202_-	cold-shock protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2440502_2440718_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_072257317.1|2440966_2441212_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001309126.1|2441117_2441627_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	7.5e-10
WP_000839590.1|2442183_2442399_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2442403_2442715_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2442711_2443245_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2443241_2443739_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2444101_2444314_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2444324_2444513_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012602791.1|2444543_2444816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2444987_2445161_+	protein GnsB	NA	NA	NA	NA	NA
WP_000373090.1|2445312_2445723_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2445780_2446014_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_002425022.1|2446161_2446263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453587.1|2446402_2446948_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|2446922_2448848_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2448844_2449051_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|2449047_2450649_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_020233915.1|2450629_2451949_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001708751.1|2451958_2452291_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|2452345_2453371_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_020233914.1|2453412_2453811_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000752979.1|2453822_2454176_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|2454187_2454766_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|2454762_2455158_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001349920.1|2455165_2455906_+|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|2455921_2456344_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|2456325_2456760_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_048219008.1|2456752_2459314_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
WP_000847345.1|2459310_2459640_+|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_029702161.1|2459639_2460338_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_032153655.1|2460343_2461087_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_072170860.1|2460984_2461626_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
WP_021523093.1|2461686_2465166_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|2465233_2465833_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|2465897_2468297_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|2468293_2468575_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|2468584_2469289_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|2469299_2469593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2469820_2470411_-	Rac prophage; site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2470727_2470961_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_029701979.1|2471746_2473030_+	MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|2473118_2474579_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 7
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	2900683	2959125	5099269	integrase,tRNA,tail,capsid,terminase,lysis,holin,head,portal	Escherichia_phage(35.85%)	76	2908876:2908890	2959227:2959241
WP_000004751.1|2900683_2901790_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2901825_2902467_+	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2902470_2903841_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2904010_2904682_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2904681_2906142_+	sensor protein PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2906217_2907339_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_001522887.1|2907387_2908614_-	peptidase T	NA	NA	NA	NA	NA
WP_001299275.1|2908669_2908885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000531594.1|2908863_2910000_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2908876:2908890	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2909983_2910847_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937481.1|2911078_2911345_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_050496171.1|2911443_2912070_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2912014_2912152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885577.1|2912124_2912709_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216486.1|2912708_2915735_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_001233148.1|2915886_2916486_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000514726.1|2916553_2920246_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_000246319.1|2920589_2921270_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
WP_000194723.1|2921167_2921911_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001328631.1|2921921_2922620_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000847298.1|2922619_2922949_-|tail	tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082417.1|2922945_2925507_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000533402.1|2925487_2925901_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479111.1|2925927_2926359_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000235111.1|2926372_2927125_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000683079.1|2927132_2927528_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_087503545.1|2927524_2928100_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_001204533.1|2928115_2928469_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000012982.1|2928461_2928884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029702099.1|2928887_2929916_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000256814.1|2929973_2930321_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001253888.1|2930357_2931863_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_001322425.1|2931852_2933445_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_000258993.1|2933441_2933648_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001309424.1|2933631_2935560_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000235436.1|2935531_2936041_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_061092131.1|2936162_2936342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602757.1|2936315_2936636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322427.1|2936523_2936877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301956.1|2936999_2937380_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
WP_032142285.1|2937636_2938104_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001309423.1|2938252_2938468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|2938591_2939125_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|2939161_2940052_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|2940056_2940272_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001309421.1|2940421_2940583_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_001309419.1|2940579_2940783_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000871291.1|2941028_2941364_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_012602756.1|2941733_2942066_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
WP_001064909.1|2942143_2942833_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_000140038.1|2942825_2943194_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001265256.1|2943194_2944253_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_001309417.1|2944254_2944533_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001309416.1|2944599_2944851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2945067_2945223_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000786207.1|2945481_2945661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208092.1|2945781_2946768_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001229301.1|2946764_2947130_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000137948.1|2947131_2947539_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_000403791.1|2947634_2947991_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209475.1|2947968_2948430_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|2948426_2948723_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001304606.1|2948719_2949127_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
WP_000450706.1|2949127_2949898_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_087503550.1|2949931_2950597_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
WP_000705383.1|2951397_2951949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912294.1|2951932_2952160_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2952236_2952644_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000379564.1|2952850_2953003_+	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_000394557.1|2953014_2953389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935596.1|2953919_2954774_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000450218.1|2954784_2954973_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|2954969_2955173_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_001542183.1|2955250_2957707_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_000003742.1|2957768_2958038_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2958006_2959125_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2959227:2959241	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5099269	3320452	3376654	5099269	transposase,integrase,tail,capsid,protease,terminase,holin,head,portal	Enterobacteria_phage(37.29%)	79	3343180:3343196	3384529:3384545
WP_001309126.1|3320452_3320962_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	7.5e-10
WP_072170856.1|3320867_3321083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522649.1|3321099_3321804_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3321940_3322393_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598612.1|3322394_3322640_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3322632_3323118_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3323120_3323633_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_001295301.1|3323654_3324644_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
WP_001522645.1|3325040_3325949_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
WP_000042533.1|3325986_3328008_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044837.1|3328586_3329264_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246795.1|3329256_3330012_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_021517032.1|3329998_3331153_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3331149_3332190_-	biotin synthase	NA	NA	NA	NA	NA
WP_001309367.1|3332276_3333566_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767391.1|3333624_3334101_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_071593692.1|3334015_3334195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503546.1|3334846_3336178_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_087503547.1|3336390_3336684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|3336726_3337767_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|3337776_3338058_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_108161041.1|3338057_3340430_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001228314.1|3340581_3341181_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_087565616.1|3341248_3344728_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
3343180:3343196	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000741589.1|3344788_3345436_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_047626242.1|3345333_3346077_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
WP_001735013.1|3346082_3346781_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
WP_001330090.1|3346780_3347137_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_032180049.1|3347114_3350342_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_077628067.1|3350388_3350649_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|3350690_3351077_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097524.1|3351076_3351781_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001546001.1|3351841_3352186_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
WP_014639219.1|3352182_3352632_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|3352628_3352967_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|3352975_3353293_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|3353369_3354587_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|3354601_3355201_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001735009.1|3355193_3356420_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_001140892.1|3356567_3358325_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|3358324_3358807_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001532429.1|3358954_3359305_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
WP_001532432.1|3359443_3359983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|3359988_3360255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|3360472_3360658_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|3360874_3361408_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193280.1|3361471_3361822_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|3361826_3362042_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000512806.1|3362407_3362896_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_001108039.1|3362939_3363551_-	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
WP_000566869.1|3363543_3363714_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001254257.1|3363710_3363893_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000504483.1|3363889_3364348_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
WP_000145931.1|3364403_3364694_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788893.1|3364690_3365392_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
WP_000185505.1|3365388_3366288_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000442611.1|3366320_3366617_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
WP_001180317.1|3366755_3366983_-	transcriptional regulator	NA	G9L677	Escherichia_phage	98.7	1.7e-35
WP_002431456.1|3367062_3367770_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
WP_000433877.1|3367893_3368214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048970231.1|3368213_3368897_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_032194733.1|3369347_3369620_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_060578268.1|3369748_3369949_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_001308813.1|3370070_3370346_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_000604110.1|3370430_3370739_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_021557662.1|3370735_3371647_+	hypothetical protein	NA	K7PKG9	Enterobacteria_phage	99.0	1.1e-168
WP_032153683.1|3371630_3372113_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_000753555.1|3372124_3372439_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|3372455_3372737_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|3372733_3372901_+	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|3372897_3373152_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_060578270.1|3373138_3373633_+	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
WP_060578271.1|3373805_3373994_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
WP_000230699.1|3373923_3374205_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	1.5e-44
WP_060578272.1|3374201_3375080_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
WP_072196869.1|3375044_3375248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545741.1|3375180_3375348_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3375387_3375606_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001540845.1|3375583_3376654_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
3384529:3384545	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 1
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	46555	0	11104	46555	transposase	Escherichia_phage(40.0%)	9	NA	NA
WP_087503542.1|741_1494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053514996.1|1737_2661_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
WP_001039463.1|3354_3741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|3749_3941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|4953_5709_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001327128.1|5709_5904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503541.1|5977_6181_+	hypothetical protein	NA	Q71TE9	Escherichia_phage	92.9	9.5e-17
WP_042937291.1|8780_9608_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	39.9	6.4e-51
WP_016809498.1|9625_11104_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	3.1e-197
>prophage 2
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	46555	16574	18561	46555		uncultured_virus(100.0%)	2	NA	NA
WP_004201176.1|16574_18215_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|18270_18561_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
>prophage 3
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	46555	24053	25013	46555	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_087503566.1|24053_25013_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	7.1e-46
>prophage 4
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	46555	29851	33500	46555	integrase	Escherichia_phage(33.33%)	4	27297:27310	41786:41799
27297:27310	attL	TGGCTGTCGCCAGT	NA	NA	NA	NA
WP_004098982.1|29851_30727_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004098977.1|31359_31986_+	hypothetical protein	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_006788217.1|32105_32285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032667567.1|32708_33500_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
41786:41799	attR	ACTGGCGACAGCCA	NA	NA	NA	NA
>prophage 5
NZ_CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	46555	41110	46213	46555	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_032667578.1|41110_41488_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
WP_032667561.1|41484_41832_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
WP_032667560.1|41882_43421_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
WP_000110241.1|43537_44746_+	hypothetical protein	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_032667557.1|44779_46213_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
>prophage 1
NZ_CP022227	Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence	150823	10315	53084	150823	integrase,transposase	Escherichia_phage(53.85%)	51	13533:13592	61295:62115
WP_001317493.1|10315_11098_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|11094_12117_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|13196_13571_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
13533:13592	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|13595_14300_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|14926_15484_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_000210409.1|15625_16207_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|16211_16550_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|16579_16909_-	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|17122_18229_+	alkene reductase	NA	NA	NA	NA	NA
WP_087503554.1|18294_18663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|18608_19313_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049802299.1|20195_20459_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|20451_20838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|20845_21532_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|21509_22136_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001089068.1|22214_23420_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001323225.1|24410_24593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309995.1|24545_24773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949452.1|24762_25269_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|25451_26267_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
WP_071528361.1|26425_26611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372824.1|26553_28500_+	iron permease	NA	NA	NA	NA	NA
WP_000178050.1|28540_29068_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|29171_30551_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|30553_31837_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077476243.1|31796_32957_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|32961_33657_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_012602139.1|33574_34129_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|34153_34639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000733497.1|34760_35504_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_021546935.1|35924_36929_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000734115.1|37368_38121_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000090196.1|38362_39235_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
WP_000872613.1|39365_40589_+	aminotransferase	NA	NA	NA	NA	NA
WP_032152933.1|40774_41548_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|42124_42829_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336397.1|43307_43664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|43609_44194_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|44193_45432_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|45428_46334_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067858.1|46455_47160_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077788461.1|47136_47319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|47500_47773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|47791_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47900_48740_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48733_49081_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|49286_50075_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|50205_50679_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|50836_51850_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_077249629.1|51788_52343_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|52379_53084_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
61295:62115	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 2
NZ_CP022227	Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence	150823	57937	74512	150823	protease,transposase	Escherichia_phage(60.0%)	18	NA	NA
WP_108164767.1|57937_58642_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.5e-138
WP_002063889.1|59835_60378_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
WP_000557452.1|60390_61251_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|61357_62062_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|62693_63524_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|63654_64209_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|64352_65057_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|65658_66264_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|66358_69256_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_012602142.1|69291_69396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602143.1|69392_69857_-	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_000616807.1|70076_70730_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071889078.1|70919_71306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152935.1|71668_72526_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|72518_72593_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
WP_072163418.1|72676_72787_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083821.1|72827_73085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|73489_74512_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP022228	Escherichia coli strain WCHEC96200 plasmid p_WCHEC96200, complete sequence	92538	0	66056	92538	integrase,holin,transposase,portal,tail,head	Escherichia_phage(82.05%)	87	13592:13608	26863:26879
WP_080077649.1|0_729_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
WP_063074560.1|762_1956_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
WP_000542383.1|1948_2278_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_032323276.1|2370_2652_-	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_032323275.1|2660_2942_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
WP_000410954.1|3278_3932_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
WP_032323273.1|4215_4824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001396850.1|5009_5237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000717724.1|5233_5545_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
WP_072275558.1|5604_6531_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
WP_022630900.1|6530_6746_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
WP_071526433.1|6764_6884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503500.1|7556_8135_-	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
WP_000240859.1|8407_9031_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
WP_050552930.1|9060_9345_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
WP_087503499.1|9334_9844_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
WP_087503498.1|9840_10482_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
WP_023908606.1|10478_10727_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
WP_023908607.1|10723_11017_+	DUF4752 domain-containing protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
WP_023908608.1|10994_11219_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
WP_001092152.1|11215_11527_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
WP_108161038.1|11638_12847_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
WP_087503534.1|12883_13552_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
13592:13608	attL	TTTAGTTTTCTAACATA	NA	NA	NA	NA
WP_087503533.1|13648_14644_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
WP_108161037.1|14657_14744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060877081.1|14740_14932_+	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
WP_087503532.1|14928_15549_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
WP_047647121.1|15545_15992_+	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
WP_000797279.1|16337_16526_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_077882281.1|16455_16737_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	2.5e-44
WP_087503531.1|16733_17423_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
WP_087503530.1|17419_17680_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
WP_063074823.1|17965_18382_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
WP_087503529.1|18394_18688_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
WP_087503528.1|18687_18996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503527.1|18992_19763_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	73.0	3.1e-116
WP_001408980.1|19874_20075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153798.1|20077_20329_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
WP_032153799.1|20452_20842_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
WP_001190712.1|20914_21136_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216041.1|21135_21516_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
WP_087503526.1|21551_22646_-	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
WP_087503525.1|22635_23403_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
WP_060877112.1|23409_24072_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
WP_000640903.1|24086_24581_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
WP_087503524.1|24577_25054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503523.1|25050_25395_-	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
WP_087503522.1|25469_26498_-|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
WP_000888609.1|27690_27930_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
26863:26879	attR	TATGTTAGAAAACTAAA	NA	NA	NA	NA
WP_000897063.1|27957_29466_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_031325887.1|29465_30446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|30826_31219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|31327_31513_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|31719_31911_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000579539.1|32944_33109_-	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000467090.1|33108_33543_-	tellurite resistance protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_024134673.1|34358_34544_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
WP_000077919.1|35902_37111_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
WP_050586432.1|37224_37506_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
WP_001238268.1|37520_37721_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_086252943.1|37735_38032_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_074470335.1|38366_38627_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
WP_074470334.1|38629_39064_-	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
WP_087503521.1|39100_45937_-	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
WP_001273800.1|46088_46574_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_001344836.1|46606_46804_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
WP_052936018.1|46803_47511_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
WP_000245715.1|47510_47735_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_087503520.1|48149_49112_-	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
WP_001191134.1|49312_50311_-	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
WP_071802339.1|50324_51593_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	1.7e-244
WP_060877101.1|52071_53457_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
WP_080028495.1|53563_54772_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_060877123.1|54888_55263_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_087503513.1|55262_57200_-|head	head protein	head	A0A222YWA3	Escherichia_phage	98.3	0.0e+00
WP_073714457.1|57192_57813_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
WP_000526264.1|57802_58249_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_053919841.1|58248_58575_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
WP_000904922.1|58791_59364_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_087503512.1|59423_59864_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	54.9	3.5e-40
WP_032143395.1|59874_60348_+|tail	phage tail collar protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_000072166.1|60354_60969_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_108161039.1|60968_62855_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	53.0	6.4e-107
WP_001396839.1|62857_63007_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_023908647.1|63398_64244_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
WP_023908648.1|64254_65685_-	bleomycin hydrolase	NA	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
WP_087503511.1|65681_66056_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
>prophage 2
NZ_CP022228	Escherichia coli strain WCHEC96200 plasmid p_WCHEC96200, complete sequence	92538	70512	92517	92538	tail,plate	Escherichia_phage(100.0%)	29	NA	NA
WP_001025048.1|70512_71334_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
WP_001077897.1|71722_72478_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|72859_73567_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187854.1|73582_74134_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_000012433.1|74188_74680_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_087503510.1|74688_75261_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
WP_000801017.1|75328_76063_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_087503509.1|76106_77765_-|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
WP_087503508.1|77832_78111_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
WP_032342068.1|78258_79956_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
WP_032342084.1|80114_80507_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
WP_072650276.1|80525_80984_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
WP_087503507.1|81137_81596_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
WP_087503506.1|81666_82470_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
WP_074417202.1|82469_82754_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
WP_001217888.1|83020_83977_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
WP_052930744.1|83989_84328_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
WP_087503505.1|84606_85248_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
WP_087503504.1|85240_85525_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
WP_087503503.1|85669_86575_-	DNA methylase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
WP_000812238.1|86567_87248_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_087503502.1|87231_88137_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
WP_087503501.1|88196_88850_-|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
WP_069936439.1|88846_89827_-|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
WP_000203293.1|89830_90598_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_063074813.1|90594_91386_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
WP_000162415.1|91548_91851_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|91921_92260_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_001022420.1|92316_92517_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
