The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	2010	59479	4706707	portal,integrase,head,tail,lysis,terminase,holin	Enterobacteria_phage(47.5%)	84	7276:7294	45927:45945
WP_087530439.1|2010_2457_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	89.2	2.4e-73
WP_140441739.1|2464_2671_-	hypothetical protein	NA	G9L683	Escherichia_phage	97.1	2.3e-26
WP_087530440.1|2747_4628_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.4	0.0e+00
WP_087530441.1|4735_5596_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	1.5e-159
WP_000166207.1|5588_5735_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000251073.1|5767_6061_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000276886.1|6169_6355_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|6435_7086_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
7276:7294	attL	TCCCGCCGAAATGCGGGAA	NA	NA	NA	NA
WP_000219338.1|7400_7700_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_021567300.1|7711_8335_+	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	99.0	2.7e-110
WP_072292373.1|8454_8730_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	1.5e-44
WP_021559315.1|8986_9592_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_000951325.1|9591_9975_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_001735525.1|9998_10292_+	DUF2856 family protein	NA	K7P836	Enterobacteria_phage	100.0	5.0e-51
WP_001214452.1|10302_10467_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_087530442.1|10463_11015_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	81.4	9.4e-75
WP_087530443.1|11011_11713_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	1.1e-51
WP_087530444.1|11709_12195_+	methyltransferase domain-containing protein	NA	H9C170	Pectobacterium_phage	75.8	6.3e-67
WP_087530445.1|12191_12812_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	58.6	6.2e-51
WP_000582234.1|12813_13569_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	1.1e-142
WP_087530446.1|13579_14224_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	54.9	5.3e-53
WP_025745176.1|14323_14623_+	hypothetical protein	NA	Q716F6	Shigella_phage	100.0	4.2e-53
WP_001163428.1|15059_15260_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_087530448.1|15509_16667_+|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	99.2	4.8e-222
WP_087530449.1|18881_19169_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.2	2.3e-24
WP_001085631.1|19183_19405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021563791.1|19404_20133_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	62.7	8.0e-74
WP_078081081.1|20220_20943_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	91.7	6.9e-118
WP_024191015.1|20932_21106_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_087530450.1|21229_21481_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	66.7	8.2e-10
WP_000275950.1|21527_21848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530451.1|21856_23860_-	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.6e-98
WP_087530452.1|23859_25275_-	acyltransferase	NA	I6RSG0	Salmonella_phage	79.9	1.5e-201
WP_087530453.1|25285_25978_-	DNA transfer protein	NA	I6S1K1	Salmonella_phage	93.5	2.1e-108
WP_087530454.1|25980_26436_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	6.3e-85
WP_087530455.1|26435_27137_-|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	96.6	1.3e-116
WP_048256722.1|27136_28555_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.6	5.4e-276
WP_000246750.1|28563_29046_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375637.1|29020_29206_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_087530456.1|29249_30521_-|head	head protein	head	Q9AYZ7	Salmonella_phage	95.0	7.6e-229
WP_000426736.1|30532_31417_-	hypothetical protein	NA	Q716H1	Shigella_phage	100.0	4.7e-145
WP_087530457.1|31430_33557_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_073527611.1|33559_34972_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	7.5e-278
WP_000179913.1|34968_35394_-	hypothetical protein	NA	Q716H4	Shigella_phage	90.8	5.0e-68
WP_000807788.1|35473_35716_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|35943_36486_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139676.1|36692_36845_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_021527495.1|36832_37300_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	4.2e-76
WP_087530458.1|37296_37773_-	glycoside hydrolase family protein	NA	K7P847	Enterobacteria_phage	99.4	6.4e-88
WP_000783734.1|37756_38080_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|38513_39137_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_087530459.1|39133_39799_-	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	99.1	2.9e-131
WP_000144614.1|39776_39983_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_087530460.1|39979_40591_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	2.7e-99
WP_000950975.1|40583_40760_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	9.7e-26
WP_087530461.1|40759_41119_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	96.6	1.2e-62
WP_001254220.1|41121_41298_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_087530462.1|41294_41822_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
WP_087530439.1|41818_42265_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	89.2	2.4e-73
WP_140441739.1|42272_42479_-	hypothetical protein	NA	G9L683	Escherichia_phage	97.1	2.3e-26
WP_087530440.1|42555_44436_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.4	0.0e+00
WP_087530441.1|44543_45404_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	1.5e-159
WP_000166207.1|45396_45543_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000251073.1|45575_45869_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000276886.1|45977_46163_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
45927:45945	attR	TTCCCGCATTTCGGCGGGA	NA	NA	NA	NA
WP_000856967.1|46243_46894_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219338.1|47208_47508_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_021567300.1|47519_48143_+	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	99.0	2.7e-110
WP_072292373.1|48262_48538_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	1.5e-44
WP_021559315.1|48794_49400_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_000951325.1|49399_49783_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_001735525.1|49806_50100_+	DUF2856 family protein	NA	K7P836	Enterobacteria_phage	100.0	5.0e-51
WP_001214452.1|50110_50275_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_087530442.1|50271_50823_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	81.4	9.4e-75
WP_087530443.1|50819_51521_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	1.1e-51
WP_087530444.1|51517_52003_+	methyltransferase domain-containing protein	NA	H9C170	Pectobacterium_phage	75.8	6.3e-67
WP_087530445.1|51999_52620_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	58.6	6.2e-51
WP_000582234.1|52621_53377_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	1.1e-142
WP_087530446.1|53387_54032_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	54.9	5.3e-53
WP_025745176.1|54131_54431_+	hypothetical protein	NA	Q716F6	Shigella_phage	100.0	4.2e-53
WP_001163428.1|54867_55068_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197016.1|55596_56844_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|56915_57830_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|58045_59479_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 2
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	335482	343248	4706707	transposase,integrase	Escherichia_phage(66.67%)	6	333270:333283	340385:340398
333270:333283	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|335482_335965_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|336707_337937_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|337975_338392_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_053881476.1|338615_340214_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	98.1	9.7e-306
WP_087530467.1|340215_341934_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	92.7	4.7e-282
340385:340398	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_087530468.1|342085_343248_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
>prophage 3
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	412968	420108	4706707		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|412968_415530_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141329.1|415635_416292_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	7.3e-50
WP_001297141.1|416342_417110_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|417305_418214_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590385.1|418210_419473_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|419469_420108_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	2406057	2468246	4706707	transposase,tRNA,plate,protease	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001346129.1|2406057_2407410_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2407439_2409872_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2409993_2410479_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2410482_2411508_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2411612_2412068_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2412071_2412860_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|2412859_2414008_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2414004_2414601_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2414637_2418120_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2418132_2419092_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|2419190_2421332_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2421388_2421778_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|2421842_2423141_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2423189_2423450_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2423436_2423637_-	YaeP family protein	NA	NA	NA	NA	NA
WP_053881358.1|2423802_2424348_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|2424344_2424767_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|2424780_2425491_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399647.1|2425740_2426721_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|2426923_2427748_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|2427800_2429519_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2429630_2430338_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2430334_2430739_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2430856_2431672_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2431711_2432365_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2432357_2433389_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|2433576_2434149_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|2439908_2440712_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|2440708_2441623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2441863_2442664_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|2442741_2443512_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2443559_2444918_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|2444989_2445745_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|2445778_2446501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2446497_2446965_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2447029_2447761_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|2448300_2449086_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|2449222_2449702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|2449711_2450626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2450669_2451152_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087750.1|2451175_2452528_-	membrane protein	NA	NA	NA	NA	NA
WP_122985538.1|2452538_2455973_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|2456081_2457494_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|2457498_2458242_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614394.1|2458238_2460998_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	2.7e-82
WP_000343298.1|2461006_2461768_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|2461772_2463104_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2463106_2463631_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|2463627_2464908_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2464932_2466015_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2465978_2467829_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|2467832_2468246_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	2770154	2838269	4706707	transposase,tRNA,portal,integrase,capsid,head,lysis,tail,terminase,protease	Enterobacteria_phage(63.33%)	81	2780316:2780362	2829743:2829789
WP_000912345.1|2770154_2771540_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2771575_2772097_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2772204_2772417_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|2772418_2773285_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|2773765_2774308_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|2774527_2775220_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001347862.1|2775250_2777860_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_087530503.1|2777872_2778880_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|2778890_2779406_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2779408_2780041_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2780316:2780362	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|2780375_2781539_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|2781394_2781766_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|2781737_2782016_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|2782063_2782282_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|2782380_2782662_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|2782672_2782864_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|2782836_2783019_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186886.1|2783015_2783696_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	4.3e-130
WP_000100845.1|2783692_2784478_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995433.1|2784483_2784780_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|2784855_2785062_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_001221207.1|2786744_2787206_-	hypothetical protein	NA	G9L674	Escherichia_phage	98.7	1.1e-76
WP_000712397.1|2787286_2787979_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	1.5e-109
WP_000184665.1|2788089_2788317_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_087530504.1|2788347_2788887_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	3.4e-61
WP_123003534.1|2788973_2789903_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	5.2e-110
WP_000788890.1|2789899_2790601_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000145903.1|2790597_2790900_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	4.4e-42
WP_001070451.1|2790967_2791300_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|2791391_2791499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|2791556_2793083_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_001351655.1|2793194_2793518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|2793979_2794336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130332.1|2794425_2794527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|2794523_2794979_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|2794978_2795149_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|2795141_2795432_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|2795428_2795791_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|2795787_2795928_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|2796013_2796397_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|2796585_2797668_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|2798257_2798473_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|2798472_2798970_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|2799186_2799369_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|2799459_2799753_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|2800113_2800308_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453580.1|2800697_2801243_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027295.1|2801217_2803143_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|2803139_2803346_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001297098.1|2803342_2804944_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123319.1|2804924_2806244_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297109.1|2806253_2806586_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|2806641_2807667_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158905.1|2807708_2808107_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752979.1|2808118_2808472_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_087530506.1|2808483_2809062_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	1.0e-79
WP_000683105.1|2809058_2809454_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|2809461_2810202_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|2810217_2810640_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|2810621_2811056_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840244.1|2811048_2813610_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.5	0.0e+00
WP_000847379.1|2813606_2813936_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|2813935_2814634_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|2814639_2815383_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2815319_2815952_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_087530507.1|2816012_2819426_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_001233071.1|2819496_2820096_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|2820160_2823121_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|2823120_2823696_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2823793_2824384_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2824700_2824934_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2825002_2825116_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|2825481_2826150_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|2826206_2826512_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|2826695_2828180_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087530508.1|2828366_2829320_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|2829832_2830594_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2829743:2829789	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|2830776_2831667_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|2831667_2834640_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|2834626_2836864_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|2837132_2838269_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	4371691	4435450	4706707	tRNA,portal,integrase,capsid,head,plate,tail,lysis,terminase,holin	Escherichia_phage(40.91%)	71	4376749:4376776	4408174:4408201
WP_000675150.1|4371691_4373095_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|4373091_4373814_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|4374004_4374337_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4374545_4374842_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4374843_4375140_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4375242_4376604_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4376749:4376776	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|4376876_4377095_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_087530539.1|4377176_4378340_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
WP_087530540.1|4378339_4378819_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	96.9	2.1e-83
WP_087530541.1|4378833_4381281_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.7	0.0e+00
WP_000785970.1|4381273_4381393_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4381425_4381701_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_021563754.1|4381757_4382276_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	9.4e-93
WP_001286716.1|4382288_4383479_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_000836023.1|4383809_4384187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530542.1|4384625_4385153_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.3	9.8e-90
WP_087530543.1|4385156_4387406_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	56.5	2.7e-136
WP_001285325.1|4387416_4387947_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121497.1|4387939_4388848_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127164.1|4388852_4389200_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_087530544.1|4389196_4389832_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	7.2e-111
WP_001001795.1|4389898_4390351_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
WP_001461852.1|4390343_4390811_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_001374011.1|4390918_4391344_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	1.4e-65
WP_087530545.1|4391331_4391757_-	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	5.0e-60
WP_001144101.1|4391771_4392269_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4392268_4392550_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|4392553_4392757_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_087530546.1|4392756_4393266_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	9.5e-90
WP_001593490.1|4393365_4394109_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_001774099.1|4394112_4395186_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
WP_087530547.1|4395244_4396099_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	2.8e-134
WP_087530548.1|4396272_4398045_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_087530549.1|4398044_4399079_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.0e-200
WP_000675355.1|4399414_4400299_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_087530550.1|4400368_4401874_-	hypothetical protein	NA	Q858T2	Yersinia_virus	28.3	1.5e-05
WP_087530551.1|4402230_4404516_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|4404505_4404781_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_049143762.1|4404777_4405002_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	2.9e-35
WP_001277957.1|4405001_4405304_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|4405303_4405528_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_063610063.1|4405590_4406091_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	3.8e-91
WP_087530552.1|4406268_4406544_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	3.7e-48
WP_000020919.1|4406665_4406965_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|4407080_4408094_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000716757.1|4408358_4408676_-	hypothetical protein	NA	NA	NA	NA	NA
4408174:4408201	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|4409090_4409990_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|4410071_4410851_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|4410950_4411991_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|4412038_4413394_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|4413397_4413682_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|4413712_4414165_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001585872.1|4414174_4415437_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|4415465_4416320_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_032296503.1|4416629_4417682_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|4417938_4419216_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|4419212_4420217_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|4420213_4421179_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4421152_4421899_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|4421950_4422769_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822270.1|4422833_4423634_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195622.1|4423630_4424419_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|4424641_4424914_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000153067.1|4426077_4426416_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|4426497_4427532_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_032296504.1|4427545_4430026_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|4430041_4430716_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|4430796_4431339_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|4431631_4431913_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|4432175_4433285_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|4433416_4435450_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 7
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	4447961	4457403	4706707		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|4447961_4449098_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001331478.1|4449094_4451095_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|4451219_4451681_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4451721_4452192_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4452238_4452958_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4452954_4454640_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4454861_4455593_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4455652_4455760_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4455740_4456472_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|4456476_4457403_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP019558	Escherichia coli strain KSC207 chromosome, complete genome	4706707	4690122	4703819	4706707	integrase,tail	Salmonella_phage(35.71%)	16	4678431:4678446	4704562:4704577
4678431:4678446	attL	ACGCTTCAGATCAATT	NA	NA	NA	NA
WP_087530448.1|4690122_4691280_+|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	99.2	4.8e-222
WP_087530449.1|4693494_4693782_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.2	2.3e-24
WP_001085631.1|4693796_4694018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021563791.1|4694017_4694746_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	62.7	8.0e-74
WP_078081081.1|4694833_4695556_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	91.7	6.9e-118
WP_024191015.1|4695545_4695719_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_087530450.1|4695842_4696094_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	66.7	8.2e-10
WP_000275950.1|4696140_4696461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530451.1|4696469_4698473_-	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.6e-98
WP_087530452.1|4698472_4699888_-	acyltransferase	NA	I6RSG0	Salmonella_phage	79.9	1.5e-201
WP_087530453.1|4699898_4700591_-	DNA transfer protein	NA	I6S1K1	Salmonella_phage	93.5	2.1e-108
WP_087530454.1|4700593_4701049_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	6.3e-85
WP_087530455.1|4701048_4701750_-|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	96.6	1.3e-116
WP_048256722.1|4701749_4703168_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.6	5.4e-276
WP_000246750.1|4703176_4703659_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375637.1|4703633_4703819_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
4704562:4704577	attR	AATTGATCTGAAGCGT	NA	NA	NA	NA
>prophage 1
NZ_CP019559	Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence	277790	204753	222498	277790	transposase,integrase	Escherichia_phage(50.0%)	22	221207:221266	222623:222745
WP_001324699.1|204753_206310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087530563.1|206350_207799_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000351437.1|207798_209922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000090707.1|209908_210751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001371925.1|211505_211886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447900.1|211943_212609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|212668_213124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|213164_213401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100635.1|213426_213720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|213897_214302_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001352368.1|215484_216693_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001166628.1|216920_217376_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|217447_217813_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|217828_218104_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|218131_218557_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|218595_220281_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|220298_220664_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|220660_220897_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|220880_221000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|220962_221175_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
221207:221266	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001375131.1|221412_221670_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
WP_001389365.1|221733_222498_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
222623:222745	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATTTGGTATCTCTCATAAACGGATGTTTTTGAGAGAACTATCTTCGGCCTTCACACGCACGAAA	NA	NA	NA	NA
