The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019047	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome	5348368	1413047	1465440	5348368	head,integrase,holin,terminase	Enterobacteria_phage(18.97%)	71	1426955:1426970	1465190:1465205
WP_009486224.1|1413047_1413506_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
WP_014907147.1|1413638_1414547_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_004149226.1|1414556_1415438_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1415805_1416288_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023301637.1|1416624_1416825_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_077270000.1|1416865_1417354_-	AP2/ERF family transcription factor	NA	A0A2I7R856	Vibrio_phage	57.6	7.6e-28
WP_087525828.1|1417526_1417745_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	1.1e-13
WP_004146321.1|1417746_1417965_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_068987124.1|1417961_1419131_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.8	7.4e-146
WP_087525830.1|1419127_1419784_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	3.5e-113
WP_087525832.1|1419780_1420209_-	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
WP_087525835.1|1420205_1420886_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.2e-124
WP_087525837.1|1420882_1421800_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	94.4	8.1e-164
WP_087525840.1|1421809_1422094_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	2.3e-29
WP_087525843.1|1422182_1422377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087525845.1|1422476_1422692_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	50.0	3.7e-11
WP_077255239.1|1422824_1423100_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	65.9	1.6e-27
WP_023283327.1|1423674_1423878_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	5.9e-19
WP_004193999.1|1424074_1424428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071789738.1|1424629_1425319_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|1425423_1425657_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_060656969.1|1425696_1425981_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	57.4	8.1e-22
WP_087525849.1|1426154_1427240_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.6	5.7e-84
1426955:1426970	attL	TGAAAAATTCCCTTCG	NA	NA	NA	NA
WP_080782391.1|1427236_1428610_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.2	4.0e-167
WP_087525954.1|1428614_1428914_+	protein ren	NA	M1FPD5	Enterobacteria_phage	54.7	4.4e-18
WP_087525852.1|1428910_1429330_+	hypothetical protein	NA	T1SBJ7	Salmonella_phage	55.6	5.9e-21
WP_004146336.1|1429326_1429728_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	78.0	3.5e-55
WP_032438688.1|1430916_1431843_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	41.5	4.8e-55
WP_087525854.1|1431919_1432177_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	1.1e-25
WP_087525856.1|1432376_1432832_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	4.0e-55
WP_047720271.1|1432831_1433002_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	4.3e-15
WP_087525859.1|1432994_1433576_+	protein NinG	NA	E7C9S3	Salmonella_phage	49.8	1.1e-41
WP_087525862.1|1433572_1433797_+	protein ninY	NA	Q76H69	Enterobacteria_phage	62.5	4.4e-23
WP_032427735.1|1433793_1433934_+	YlcG family protein	NA	NA	NA	NA	NA
WP_087525955.1|1433933_1434617_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	5.8e-58
WP_068987107.1|1435044_1435416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068987106.1|1435417_1435624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157662378.1|1436096_1436402_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	96.9	4.3e-45
WP_068987105.1|1436388_1436838_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	1.4e-57
WP_009483899.1|1437095_1437611_+	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
WP_087525868.1|1437610_1439083_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.1	1.7e-248
WP_069377237.1|1439095_1440565_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	4.8e-150
WP_087525871.1|1440491_1441499_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	4.9e-114
WP_064172349.1|1441525_1441798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064172278.1|1441850_1443230_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	3.0e-130
WP_023339710.1|1443229_1443664_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	2.2e-26
WP_023339711.1|1443675_1444707_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	52.6	6.2e-96
WP_032428666.1|1444746_1445034_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
WP_087525874.1|1445036_1445417_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.8e-30
WP_032752624.1|1445416_1445590_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_023301678.1|1445589_1445952_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_087525877.1|1445954_1446380_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	6.6e-28
WP_032442345.1|1446376_1446769_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
WP_004151263.1|1446837_1447590_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_087525879.1|1447642_1448320_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_050849584.1|1448495_1449251_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.4	1.2e-61
WP_004151260.1|1449253_1449508_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_023328739.1|1449928_1450249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556004.1|1450300_1450618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074442813.1|1450712_1450940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029884072.1|1451042_1451546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087525882.1|1451640_1455081_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	46.3	1.4e-155
WP_087525883.1|1455121_1455301_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_080883263.1|1455277_1455547_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_086074300.1|1455730_1456150_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	5.9e-29
WP_023301685.1|1456149_1456620_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
WP_068987094.1|1456616_1457012_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.8	3.0e-35
WP_068987093.1|1456998_1459476_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	9.4e-199
WP_142726519.1|1459562_1462097_+	hypothetical protein	NA	A0A1I9SEN3	Klebsiella_phage	31.2	4.5e-63
WP_087525884.1|1463025_1464186_-|integrase	tyrosine-type recombinase/integrase	integrase	Q716F9	Shigella_phage	85.3	1.8e-192
WP_004149224.1|1464510_1465440_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1465190:1465205	attR	TGAAAAATTCCCTTCG	NA	NA	NA	NA
>prophage 2
NZ_CP019047	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome	5348368	1690761	1697666	5348368	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1690761_1691625_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1691635_1692409_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1692649_1693543_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1693788_1695150_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1695468_1696191_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1696187_1697666_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP019047	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome	5348368	2736689	2747576	5348368		Escherichia_phage(87.5%)	9	NA	NA
WP_014907638.1|2736689_2739797_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_014907639.1|2739851_2741117_+	MFS transporter	NA	NA	NA	NA	NA
WP_014907640.1|2741147_2742236_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_014907641.1|2742322_2742583_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	2.1e-40
WP_002904004.1|2742880_2743741_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2743761_2744523_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2744783_2745686_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2745697_2746963_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2746955_2747576_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP019047	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome	5348368	3143943	3238664	5348368	portal,tail,tRNA,holin,transposase,terminase,capsid,head,integrase	Klebsiella_phage(47.62%)	100	3136473:3136490	3246813:3246830
3136473:3136490	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3143943_3144444_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3144561_3145008_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3144991_3145783_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015874675.1|3145884_3147069_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_014907799.1|3147100_3147793_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3147938_3148448_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3148434_3148791_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3148780_3149020_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3149320_3150334_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3150391_3150493_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3150492_3150567_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3150684_3150810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3150868_3151132_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3151262_3151901_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3151990_3152905_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_014907800.1|3153566_3154610_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3154912_3156121_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014907801.1|3156194_3157979_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3157985_3158876_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3158996_3160505_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3160815_3161502_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153244925.1|3161951_3162140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3162118_3162751_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3163317_3163515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907802.1|3163630_3164641_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3164637_3166044_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3166099_3166987_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_087525920.1|3167003_3167510_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3167536_3168031_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3168121_3168307_-	general stress protein	NA	NA	NA	NA	NA
WP_032421220.1|3168526_3168862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|3168929_3170123_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3170235_3170463_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_014907803.1|3170912_3171236_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3171228_3171621_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004213085.1|3171617_3172331_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3172603_3172756_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_014228924.1|3173075_3173399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228923.1|3173404_3174097_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014907806.1|3175932_3177360_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
WP_014907807.1|3177428_3190133_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.0	0.0e+00
WP_014228919.1|3190195_3190807_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|3190822_3191173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228918.1|3191204_3191915_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
WP_014907809.1|3191916_3192672_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
WP_014228916.1|3192668_3193007_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_041169041.1|3193006_3196342_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.6	0.0e+00
WP_014228914.1|3196574_3196940_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3196997_3197459_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|3197490_3197892_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014907812.1|3197888_3198278_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.1e-56
WP_014228910.1|3198258_3198597_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_041168975.1|3198593_3198911_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.6e-45
WP_014907814.1|3198891_3199152_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|3199210_3200497_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_014907815.1|3200574_3201495_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_012542166.1|3201531_3202791_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_032418045.1|3202790_3202970_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_012542167.1|3202963_3204685_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3204684_3205119_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3205367_3205799_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_014907819.1|3205795_3206119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168976.1|3206070_3206433_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	82.5	1.3e-56
WP_032749552.1|3206759_3206984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065888617.1|3207022_3207460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168977.1|3208408_3208759_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	37.7	6.0e-11
WP_023159886.1|3208755_3209253_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	4.3e-79
WP_021462597.1|3209252_3209468_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	1.0e-29
WP_077260858.1|3210479_3210920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317678.1|3210924_3211794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228895.1|3211822_3212167_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
WP_014907821.1|3212179_3213211_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	1.8e-95
WP_051017642.1|3213410_3213803_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077260856.1|3213843_3214134_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|3214145_3214379_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_048333319.1|3215033_3216395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907823.1|3216738_3218502_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462584.1|3218814_3219255_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041169042.1|3219268_3219733_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.9e-60
WP_021462582.1|3219725_3220709_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
WP_014907826.1|3220760_3221315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3221317_3221533_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3221634_3222024_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_021462581.1|3222866_3223061_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021462580.1|3223103_3223448_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014907830.1|3223589_3225728_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	3.3e-99
WP_012542206.1|3225780_3226026_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|3226006_3227134_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3227251_3228502_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3228742_3229393_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3229409_3229868_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3229924_3231031_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3231085_3231727_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3231730_3233101_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_004213084.1|3233155_3233518_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|3233601_3234408_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3234690_3235362_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_015874641.1|3235361_3236828_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|3236913_3238035_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|3238172_3238664_-|transposase	transposase	transposase	NA	NA	NA	NA
3246813:3246830	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 5
NZ_CP019047	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 chromosome, complete genome	5348368	3487716	3497180	5348368	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012737718.1|3487716_3489438_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3489482_3490184_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3490537_3490756_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3490876_3493156_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3493186_3493504_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3493829_3494051_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3494127_3496068_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3496064_3497180_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP019048	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence	230606	50875	84356	230606	integrase,protease,transposase	Escherichia_phage(50.0%)	35	50057:50071	83265:83279
50057:50071	attL	TGATGAAAAAACAAT	NA	NA	NA	NA
WP_014839933.1|50875_52009_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017900677.1|52182_52437_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839878.1|52758_54150_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|54186_54759_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|54895_55486_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_002903955.1|55970_56873_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|57133_57895_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|57915_58776_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|58912_59617_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004193272.1|60414_62058_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004193269.1|62358_62751_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_004193267.1|62882_63386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193264.1|63395_63842_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_004193262.1|63789_64368_+	2-oxo-tetronate isomerase	NA	B5TK85	Pseudomonas_phage	34.0	2.0e-19
WP_004193260.1|64544_65453_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	4.3e-77
WP_017900990.1|65548_66193_-	quinolone resistance pentapeptide repeat protein QnrB4	NA	NA	NA	NA	NA
WP_004193248.1|66275_67250_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_003020532.1|67420_68089_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004193245.1|68143_68368_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_004193243.1|68367_68727_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004193241.1|68735_68966_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004236386.1|70316_71456_-	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193231.1|71566_72442_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|72445_72811_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|72703_73039_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|73032_73872_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|74276_75818_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|77546_78251_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001166628.1|79118_79574_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017901326.1|79704_80244_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_017901327.1|80240_80432_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_017901328.1|80610_81084_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_014839881.1|81086_82310_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014839882.1|82320_83277_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_024266325.1|83276_84356_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	5.6e-39
83265:83279	attR	ATTGTTTTTTCATCA	NA	NA	NA	NA
>prophage 2
NZ_CP019048	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence	230606	93188	119421	230606	integrase,transposase	Escherichia_phage(33.33%)	26	95941:96000	102097:103294
WP_100248964.1|93188_94354_-|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_014839892.1|94832_95483_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
95941:96000	attL	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTC	NA	NA	NA	NA
WP_014839893.1|96088_97105_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_001752311.1|97319_98351_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_017901373.1|98875_99061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252868.1|99076_99226_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_017901372.1|99389_100493_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	62.1	1.0e-120
WP_071600436.1|100551_101265_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014839893.1|102244_103261_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_048336589.1|103327_103441_+	small membrane protein	NA	NA	NA	NA	NA
102097:103294	attR	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCTTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCAGGCAAGGCGCTATCCAGGGATAACCGGGCAAACCGACGCATGGAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATACGGGACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCT	NA	NA	NA	NA
WP_017901082.1|103519_104089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901081.1|104279_105026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901080.1|105092_105851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266320.1|106102_106837_-	PsiA protein	NA	NA	NA	NA	NA
WP_025999330.1|107467_108067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901076.1|109420_109753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901075.1|109763_110249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839897.1|110644_111916_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_017901073.1|112095_112590_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	5.5e-18
WP_014839898.1|112698_113520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901072.1|113764_114559_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_017901071.1|114939_115296_+	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	40.8	2.1e-11
WP_014839899.1|115669_116068_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024266306.1|116204_116813_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001567369.1|117356_117989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|118017_119421_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP019048	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence	230606	161921	175641	230606		Salmonella_phage(53.85%)	21	NA	NA
WP_080932144.1|161921_163160_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.4	1.3e-10
WP_099501131.1|164059_164449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900695.1|164522_164768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025999285.1|164764_165109_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_017900697.1|165390_166023_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
WP_017900698.1|166108_166543_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
WP_009654204.1|166632_166953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654227.1|167205_167493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900700.1|167585_168107_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
WP_017900701.1|168146_168779_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
WP_014839971.1|169035_169248_-	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900702.1|169737_170022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900703.1|170018_170426_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900705.1|170842_171916_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_014839970.1|171919_172144_-	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_087525963.1|172409_173144_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_062878103.1|173136_173325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|173471_173717_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_025999286.1|173781_174393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087525964.1|174435_174639_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	62.7	1.4e-15
WP_014839967.1|175320_175641_-	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
>prophage 1
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	0	5728	228613	transposase	uncultured_marine_virus(33.33%)	4	NA	NA
WP_087525966.1|1737_2853_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004213626.1|3203_3848_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_004213628.1|3832_5065_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_011154590.1|5521_5728_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
>prophage 2
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	10011	10233	228613		Streptococcus_phage(100.0%)	1	NA	NA
WP_004213643.1|10011_10233_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	63.5	3.6e-17
>prophage 3
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	15203	17590	228613		Moraxella_phage(50.0%)	3	NA	NA
WP_004212794.1|15203_15698_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
WP_004212796.1|16034_16433_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004212797.1|16750_17590_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
>prophage 4
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	23668	25344	228613		Bacillus_virus(50.0%)	2	NA	NA
WP_004212808.1|23668_24502_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
WP_004212810.1|24498_25344_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.0	1.9e-10
>prophage 5
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	39617	42819	228613		Vibrio_phage(50.0%)	3	NA	NA
WP_004214541.1|39617_40547_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
WP_004214540.1|40563_41388_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_011251272.1|41817_42819_+	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
>prophage 6
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	56941	122226	228613	integrase,transposase	Bacillus_phage(16.0%)	49	57921:57971	129639:129689
WP_048333456.1|56941_57865_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
57921:57971	attL	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGACG	NA	NA	NA	NA
WP_040217257.1|58315_59104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|59124_59568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333570.1|61111_61582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|61648_62572_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004213594.1|62805_63300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213592.1|63341_66311_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213590.1|66313_66871_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_000118563.1|67000_68077_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004213585.1|68073_70479_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000405672.1|70564_70999_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152084.1|71294_72695_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|72691_73372_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|73426_74356_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|74360_74741_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|74780_75677_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|75676_77494_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|77727_78177_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|78465_79203_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|79236_79434_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|79474_81922_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|82048_82489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|82575_85722_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213579.1|85732_87025_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|87138_87501_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|87529_88915_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213574.1|89104_89785_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_000555737.1|89777_91253_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|91503_91935_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|92078_92429_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|92815_93724_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213565.1|94360_95335_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_077250520.1|96267_97080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213560.1|97076_97856_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|98000_98930_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|99242_99401_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_011251294.1|101316_101562_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_011251296.1|102085_102952_+	ParA family protein	NA	NA	NA	NA	NA
WP_004902347.1|102951_103983_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|103982_104420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211835.1|110260_110797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|113116_114127_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211841.1|114856_116023_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004117790.1|116022_116994_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004902307.1|118199_118382_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004215130.1|118578_119019_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|119015_119366_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|119396_120989_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|121257_122226_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
129639:129689	attR	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGACG	NA	NA	NA	NA
>prophage 7
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	131813	132698	228613		Salmonella_phage(100.0%)	1	NA	NA
WP_004210308.1|131813_132698_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	4.4e-50
>prophage 8
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	142951	144451	228613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011251307.1|142951_144451_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
>prophage 9
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	153186	153828	228613		Streptomyces_phage(100.0%)	1	NA	NA
WP_004026586.1|153186_153828_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
>prophage 10
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	157621	178113	228613	protease,transposase	Caulobacter_phage(27.27%)	17	NA	NA
WP_004026596.1|157621_158701_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_087525969.1|158702_159476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|159468_160611_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_011251317.1|160622_161681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196925.1|161991_162576_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251319.1|162572_163724_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|163746_164202_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026607.1|164225_165266_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026609.1|165315_165894_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_000301240.1|165980_166556_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_011251320.1|166640_167882_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_011251321.1|168218_168854_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004144375.1|170585_171446_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_077250518.1|172287_175245_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004210220.1|175258_175786_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004210218.1|175898_176912_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004225018.1|177117_178113_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
>prophage 11
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	193625	193886	228613		Erwinia_phage(100.0%)	1	NA	NA
WP_004213925.1|193625_193886_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
>prophage 12
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	205630	206140	228613		Synechococcus_phage(100.0%)	1	NA	NA
WP_004145290.1|205630_206140_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
>prophage 13
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	212653	215149	228613	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_004213252.1|212653_213481_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_065802044.1|214225_215149_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	2.5e-165
>prophage 14
NZ_CP019049	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence	228613	222611	224786	228613		Acinetobacter_phage(100.0%)	1	NA	NA
WP_087525975.1|222611_224786_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	4.8e-05
>prophage 1
NZ_CP019050	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166c, complete sequence	111083	6912	73021	111083	tail,integrase	Salmonella_phage(77.05%)	70	22585:22610	40749:40774
WP_032439760.1|6912_8358_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.1	1.3e-38
WP_004109805.1|8453_8777_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032439761.1|8790_9483_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	1.2e-119
WP_032439763.1|9485_9737_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.7	1.2e-24
WP_077255323.1|9939_10461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313115.1|10700_11366_+	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_019704530.1|11365_11728_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_040177234.1|11787_12846_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.2	2.3e-61
WP_004110190.1|13139_13865_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.6e-127
WP_032422984.1|13929_15270_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.5	2.7e-240
WP_040177212.1|15422_16541_+	DNA primase	NA	J9Q720	Salmonella_phage	90.8	9.1e-202
WP_039817658.1|16575_17742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040177213.1|18030_18819_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.8	6.9e-71
WP_050484095.1|18898_19366_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
WP_087525977.1|19496_19649_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.0e-15
WP_040177216.1|19645_19945_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.6	4.3e-26
WP_040177236.1|20613_22122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071961432.1|22273_23119_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	1.6e-89
22585:22610	attL	TGGTAAAACCTTCCTGGCGACGGCCG	NA	NA	NA	NA
WP_040177220.1|23139_23358_+	hypothetical protein	NA	A0A0S2SYN9	Pseudomonas_phage	59.5	3.9e-08
WP_040177222.1|23366_23612_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_040177223.1|23804_24332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040177225.1|24322_24739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134908349.1|24997_25858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422994.1|26102_27203_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.2e-17
WP_014342091.1|27197_27578_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_040177322.1|28180_30460_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.3	1.0e-247
WP_087525978.1|30556_31789_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.1	6.3e-212
WP_077255319.1|31969_34333_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	87.0	0.0e+00
WP_077255320.1|34329_35031_+	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	6.4e-20
WP_077255321.1|35052_36222_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	93.1	6.8e-208
WP_040120269.1|36218_36662_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	1.5e-59
WP_021313788.1|36862_37282_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_021313787.1|37292_37592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440517.1|37731_38163_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_040177324.1|38282_39290_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.0	4.6e-144
WP_032734154.1|39350_40295_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	2.4e-171
WP_019704549.1|40294_40561_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_019704550.1|40563_41640_+	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
40749:40774	attR	TGGTAAAACCTTCCTGGCGACGGCCG	NA	NA	NA	NA
WP_032423093.1|42349_42685_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	4.7e-37
WP_014342074.1|42684_42897_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_040177328.1|43349_44447_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.3e-72
WP_021313778.1|44768_45413_+	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
WP_087525979.1|45488_45983_+	GNAT family acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	5.8e-60
WP_021313776.1|46170_47256_+	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_040177331.1|47485_49402_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	9.5e-300
WP_110539817.1|49427_50138_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.3	3.3e-72
WP_040177334.1|50147_50717_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_040177336.1|50792_53096_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_014342181.1|53226_54369_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342180.1|54446_55322_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
WP_040177338.1|55515_56619_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	1.5e-180
WP_087525980.1|56620_57034_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	1.8e-54
WP_032423042.1|57030_57507_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	80.3	1.3e-72
WP_040177340.1|57506_58151_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	6.2e-94
WP_023279504.1|58214_58634_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_050485941.1|58856_59438_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
WP_032423056.1|59434_59983_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
WP_032423057.1|60108_60942_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
WP_023279507.1|61126_61720_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_087525981.1|61917_62145_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	1.3e-30
WP_087525982.1|62723_63311_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	79.2	1.1e-89
WP_032734169.1|63468_64008_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.5	1.7e-28
WP_019704567.1|64308_64734_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|64733_64889_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_021313149.1|65016_65595_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
WP_087525983.1|65723_65939_+	DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	3.2e-15
WP_087525984.1|66000_69120_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.7	2.0e-25
WP_032413268.1|69112_70312_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087525985.1|70313_71468_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	24.0	3.0e-06
WP_040120289.1|71464_73021_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
>prophage 2
NZ_CP019050	Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166c, complete sequence	111083	76966	105757	111083	tail,terminase	Salmonella_phage(94.59%)	39	NA	NA
WP_029463945.1|76966_77185_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	79.2	2.0e-25
WP_029463946.1|77197_77410_+	hypothetical protein	NA	J9Q804	Salmonella_phage	76.5	1.3e-24
WP_040177193.1|77546_77858_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	4.0e-30
WP_004109918.1|77977_78385_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.8e-23
WP_021313142.1|78512_78887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040177196.1|78889_79171_+	hypothetical protein	NA	J9Q753	Salmonella_phage	81.7	2.2e-40
WP_021313140.1|79376_79859_+	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
WP_004109904.1|80450_80654_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|80704_81355_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_123827665.1|81679_81979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342147.1|81988_82519_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_019704582.1|82674_83112_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_004109887.1|83162_83438_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_021313133.1|83440_85000_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
WP_021313132.1|85083_85764_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_014342142.1|85763_86432_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_019704584.1|86428_87067_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_019704585.1|87059_87314_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_026005938.1|87310_88210_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
WP_004109869.1|88219_88486_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|88661_89303_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|89305_90562_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_087525988.1|90579_92169_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.4	7.4e-274
WP_014342135.1|92191_93091_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_004109857.1|93117_93996_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342134.1|94074_94503_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_021313129.1|94550_94985_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_032439750.1|94984_95818_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.2e-131
WP_004109848.1|95915_96260_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_004109845.1|96250_96724_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_014342130.1|96725_97118_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_004109839.1|97185_97932_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109835.1|97993_98311_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109830.1|98427_98661_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_048292502.1|98668_103204_+	tape measure protein	NA	J9Q712	Salmonella_phage	69.7	0.0e+00
WP_032423010.1|103247_103583_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_004109820.1|103669_104368_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|104360_105158_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|105145_105757_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
