The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	7258	38203	4855460	terminase,plate,capsid,transposase,head,tail,tRNA,holin	Enterobacteria_phage(89.29%)	35	NA	NA
WP_064506808.1|7258_9010_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262639.1|9164_10001_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	2.1e-147
WP_001055107.1|10024_11077_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_000632345.1|11122_11923_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063093.1|12024_12519_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000864901.1|12518_12719_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|12721_13045_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|13041_13434_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|13430_13838_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|13975_14443_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356320.1|14435_15071_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.5e-113
WP_101677603.1|15067_15649_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.1e-101
WP_000213447.1|15645_15996_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111925.1|15999_16896_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_001443704.1|16888_17419_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_064506814.1|17421_19584_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	75.5	4.2e-288
WP_064506815.1|19585_20113_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	2.0e-90
WP_000972164.1|20141_20675_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	9.3e-96
WP_000905059.1|21702_22302_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_000979954.1|22328_22817_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853388.1|22829_25637_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000333494.1|25623_25779_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665314.1|25787_26153_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290450.1|26207_26720_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005360.1|26719_27904_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	1.6e-225
WP_000132800.1|28061_29171_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	1.3e-195
WP_000488105.1|29213_29474_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|29664_29805_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_071529674.1|30001_30238_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215759.1|30182_30974_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	1.1e-65
WP_000615813.1|31203_32199_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127778.1|32195_33374_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|33666_34887_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683808.1|35045_37052_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399648.1|37222_38203_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	344261	352275	4855460	integrase	Enterobacteria_phage(50.0%)	7	335926:335940	353704:353718
335926:335940	attL	GTCCTGCACCTGCAT	NA	NA	NA	NA
WP_000162574.1|344261_344744_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_053286429.1|345504_346695_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	5.3e-107
WP_053286430.1|346732_348631_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.0	1.2e-55
WP_053286431.1|348627_350403_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_053286432.1|350712_351279_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	2.4e-57
WP_072135301.1|351295_351541_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	75.3	6.9e-30
WP_053286433.1|351537_352275_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	1.1e-78
353704:353718	attR	ATGCAGGTGCAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	432630	439770	4855460		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|432630_435192_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|435297_435954_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|436004_436772_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|436967_437876_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|437872_439135_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|439131_439770_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	679019	716034	4855460	tRNA,transposase,protease	Shigella_phage(42.86%)	31	NA	NA
WP_000858396.1|679019_679517_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|679611_680319_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|680398_681130_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|681142_682093_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|682201_682765_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|682764_683181_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055620.1|683356_684337_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|684354_685059_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|685076_685643_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|685639_685930_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|685937_686531_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239944.1|686523_687660_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|687814_688822_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|688938_689985_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|690160_690880_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|691063_691390_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786913.1|691389_692109_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|692269_693322_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|693349_693625_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001365878.1|693689_694769_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|694970_696227_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839746.1|696276_698412_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234522.1|698809_699517_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_085947772.1|700921_702135_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_085948316.1|704677_705951_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000264907.1|706042_706234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001682408.1|706840_707518_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|707517_707865_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|707884_709456_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_072135330.1|709803_713895_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.6	4.0e-295
WP_085948316.1|714760_716034_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 5
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	1232614	1257697	4855460	transposase	Stx2-converting_phage(50.0%)	22	NA	NA
WP_000381395.1|1232614_1234186_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624625.1|1234205_1234553_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	7.5e-46
WP_001682408.1|1234552_1235230_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_158292524.1|1235270_1235432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843494.1|1235465_1235663_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|1235703_1238181_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758229.1|1238278_1238719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219104.1|1238805_1241952_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001381488.1|1241962_1243255_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|1243368_1243722_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475507.1|1243749_1245135_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|1245324_1246005_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|1245997_1247479_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|1247723_1248155_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|1248302_1248653_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_085947772.1|1249144_1250358_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001097216.1|1252472_1252772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087530436.1|1253124_1253433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1253667_1255239_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1255258_1255606_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|1255605_1256283_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_085948316.1|1256424_1257697_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 6
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	1471641	1482290	4855460	integrase	Enterobacteria_phage(100.0%)	12	1471459:1471481	1482777:1482799
1471459:1471481	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001697482.1|1471641_1472832_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	85.0	1.8e-195
WP_001697485.1|1472824_1474921_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001697486.1|1474922_1475576_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_021574826.1|1475780_1476353_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	97.9	3.8e-95
WP_071666152.1|1476367_1476613_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	98.8	1.5e-40
WP_087530357.1|1476609_1477344_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.4e-129
WP_001149156.1|1477895_1478162_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_087530358.1|1478158_1478758_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	3.9e-50
WP_001244665.1|1478750_1479038_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459318.1|1479030_1479486_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|1479621_1479942_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_087530359.1|1479956_1482290_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
1482777:1482799	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	2006684	2064039	4855460	transposase,integrase,tRNA	Stx2-converting_phage(37.5%)	50	2051810:2051827	2070848:2070865
WP_001295074.1|2006684_2008202_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|2008438_2009896_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295383.1|2009954_2012102_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|2012181_2013516_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187170.1|2013881_2015420_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001339397.1|2015962_2016640_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2016639_2016987_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2017006_2018578_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000492897.1|2018930_2020466_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001280513.1|2020536_2021382_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839254.1|2021466_2021664_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761714.1|2021675_2022164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094436.1|2022160_2022538_-	toxin	NA	NA	NA	NA	NA
WP_015953067.1|2022584_2022962_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692312.1|2023040_2023262_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186756.1|2023330_2023807_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860054.1|2023821_2024307_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	3.8e-11
WP_001175142.1|2024397_2025216_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
WP_001278287.1|2025305_2025539_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097312.1|2025544_2026222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282927.1|2026369_2027050_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010416.1|2027252_2028137_-	GTPase	NA	NA	NA	NA	NA
WP_000126799.1|2028242_2029205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499035.1|2029201_2030071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154675835.1|2031718_2031892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075462.1|2032071_2032803_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001100705.1|2033312_2033765_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_087530368.1|2034207_2035481_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
WP_000792543.1|2035628_2037677_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_001089067.1|2038897_2040103_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001349381.1|2040181_2040808_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|2040785_2041472_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|2041479_2041866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|2041858_2042179_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|2042622_2043828_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_087530369.1|2044287_2045496_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	1.2e-234
WP_000654934.1|2046557_2049068_+	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_000381395.1|2049099_2050671_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2050690_2051038_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|2051037_2051715_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
2051810:2051827	attL	GGTTATGCCATTTTCCGG	NA	NA	NA	NA
WP_000265730.1|2051845_2052580_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000261303.1|2052616_2053198_+	protein papJ	NA	NA	NA	NA	NA
WP_000597712.1|2053207_2053744_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000723802.1|2053770_2054292_+	P fimbrial minor subunit PapE	NA	NA	NA	NA	NA
WP_000620429.1|2054366_2054867_+	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_000758687.1|2054910_2055921_+	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_001350744.1|2056280_2057027_+	porin family protein	NA	NA	NA	NA	NA
WP_001026222.1|2057201_2058701_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000344091.1|2058809_2062325_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218820.1|2062776_2064039_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
2070848:2070865	attR	GGTTATGCCATTTTCCGG	NA	NA	NA	NA
>prophage 8
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	2472360	2490182	4855460	terminase,capsid,protease,head,integrase,tail,portal	uncultured_Caudovirales_phage(66.67%)	21	2472317:2472338	2487822:2487843
2472317:2472338	attL	GTATATCACTCGGTGTATCACT	NA	NA	NA	NA
WP_000929256.1|2472360_2473584_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	57.4	2.1e-135
WP_016236857.1|2473580_2474384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165816.1|2474479_2474764_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_016236858.1|2474784_2475468_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	50.0	4.6e-23
WP_087530437.1|2475457_2476375_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_087530371.1|2476367_2476688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261489.1|2476694_2476994_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_087530372.1|2476990_2479114_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.7	2.8e-175
WP_087530373.1|2479325_2479748_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016231462.1|2479765_2480014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530374.1|2480288_2481458_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.8	1.1e-162
WP_024226531.1|2481512_2482073_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	2.2e-87
WP_122987288.1|2482116_2483289_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.2	2.4e-205
WP_000004557.1|2483281_2483584_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.9	2.1e-28
WP_001145897.1|2483583_2484024_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001353110.1|2484312_2484669_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_087530375.1|2484652_2486314_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	4.0e-278
WP_001449337.1|2486319_2486601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680691.1|2487907_2488444_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
2487822:2487843	attR	GTATATCACTCGGTGTATCACT	NA	NA	NA	NA
WP_000651599.1|2488484_2489147_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2489255_2490182_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 9
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	2882522	2942425	4855460	transposase,protease,lysis,integrase,tRNA,tail	Enterobacteria_phage(39.29%)	60	2928288:2928334	2945656:2945702
WP_001295836.1|2882522_2883146_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|2883116_2883803_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561866.1|2883799_2886214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014696.1|2886642_2890932_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000877768.1|2890971_2891340_+	immunity protein	NA	NA	NA	NA	NA
WP_001347856.1|2891339_2892053_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
WP_085947771.1|2892049_2893212_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001158001.1|2893736_2894831_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460129.1|2894899_2895826_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776392.1|2896055_2896538_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|2896615_2897431_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001347858.1|2897520_2899302_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	4.1e-39
WP_000943584.1|2899314_2900091_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765854.1|2900189_2901068_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_042031515.1|2901237_2902692_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|2902751_2904113_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_029402360.1|2904169_2905471_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|2905492_2906638_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540968.1|2906766_2907552_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001347861.1|2907562_2908798_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703911.1|2908819_2909869_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580860.1|2910185_2911853_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495407.1|2911862_2913122_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001331011.1|2913132_2913948_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|2913944_2914838_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815510.1|2915042_2916110_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|2916106_2916616_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212253.1|2916733_2917456_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|2917458_2917953_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|2918126_2919512_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2919547_2920069_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2920176_2920389_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|2920390_2921257_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|2921737_2922280_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|2922499_2923192_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001347862.1|2923222_2925832_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|2925844_2926852_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|2926862_2927378_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2927380_2928013_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2928288:2928334	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|2928347_2929511_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_012599996.1|2929366_2929822_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_000206814.1|2929737_2930043_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	4.1e-48
WP_001242717.1|2930042_2930405_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008165.1|2930395_2930932_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001204780.1|2931790_2932174_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737266.1|2932363_2933461_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|2934033_2934249_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_072002730.1|2934248_2934473_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	2.0e-23
WP_001228695.1|2934622_2934805_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2934895_2935189_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|2935548_2935743_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|2936131_2936677_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_072020952.1|2936651_2937698_+	hypothetical protein	NA	K7PHC9	Enterobacteria_phage	66.5	4.9e-48
WP_000885616.1|2937697_2938273_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2938370_2938961_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2939277_2939511_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2939579_2939693_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|2940058_2940727_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_085948316.1|2940830_2942104_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_087530380.1|2942122_2942425_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
2945656:2945702	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 10
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	3969887	4001897	4855460	integrase,transposase,tail,lysis	Enterobacteria_phage(22.22%)	42	3964644:3964657	3997382:3997395
3964644:3964657	attL	CTGACGCAGATTGC	NA	NA	NA	NA
WP_001593356.1|3969887_3970469_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_001611687.1|3970468_3972166_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	61.6	1.4e-174
WP_001101168.1|3972427_3972970_-	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_001593363.1|3973075_3973348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192451.1|3973313_3973658_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839561.1|3973662_3973878_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000381395.1|3973972_3975544_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3975563_3975911_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|3975910_3976588_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001348108.1|3976836_3977211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|3977382_3977811_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|3978177_3978309_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762863.1|3979212_3980034_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000904114.1|3980030_3980405_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_023277547.1|3980417_3981467_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_001332495.1|3981468_3981747_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_021541900.1|3982205_3982418_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.3e-29
WP_001557860.1|3982462_3982570_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_023277548.1|3982978_3983980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639476.1|3983995_3984958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151216.1|3985149_3985572_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_001262357.1|3985612_3986683_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|3986754_3987180_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3987163_3987406_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|3987797_3988136_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|3988428_3988584_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171952.1|3988743_3988962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|3988965_3989130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3989529_3989718_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_029364064.1|3989714_3989906_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_047673069.1|3989999_3992471_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.0	1.9e-58
WP_001296941.1|3992558_3992795_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876976.1|3992829_3994110_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|3994111_3994240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|3994297_3995317_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|3995328_3996543_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3996748_3997075_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|3997209_3997551_+	DUF1283 family protein	NA	NA	NA	NA	NA
3997382:3997395	attR	GCAATCTGCGTCAG	NA	NA	NA	NA
WP_001138581.1|3997585_3998146_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3998148_3998859_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3998966_3999272_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|3999470_4001897_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
>prophage 11
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	4358234	4426350	4855460	transposase	Stx2-converting_phage(20.0%)	57	NA	NA
WP_001400497.1|4358234_4358906_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	2.4e-80
WP_101677608.1|4358945_4359158_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	88.5	9.3e-23
WP_000381395.1|4359160_4360732_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4360751_4361099_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|4361098_4361776_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_085948316.1|4363191_4364464_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_105962285.1|4364693_4364876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000879833.1|4365569_4366367_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001070440.1|4367096_4367429_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274295.1|4367762_4368077_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994405.1|4368291_4369950_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|4369942_4370938_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|4370930_4371617_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213311.1|4371616_4372990_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|4373008_4373452_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620104.1|4373448_4374576_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|4374680_4375145_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|4375149_4376154_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|4376150_4376564_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|4376566_4376932_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001400527.1|4376931_4377669_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|4377678_4377948_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983992.1|4377956_4378742_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|4379031_4379655_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|4379698_4379941_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|4380049_4380277_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_029402400.1|4380574_4381390_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_087530409.1|4381386_4383081_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.9e-17
WP_000009307.1|4383251_4383434_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|4383512_4384430_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|4384602_4385523_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785987.1|4385511_4385982_-	very short patch repair endonuclease	NA	NA	NA	NA	NA
WP_001157222.1|4385962_4387381_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_087530410.1|4387447_4388143_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.5	4.0e-06
WP_000824417.1|4389105_4390293_+	porin	NA	Q1MVN1	Enterobacteria_phage	52.4	6.5e-97
WP_001373147.1|4390416_4390629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218232.1|4390884_4391736_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826805.1|4391843_4393202_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.9e-05
WP_001339045.1|4393201_4393873_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|4394005_4394419_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740094.1|4394527_4395532_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001241500.1|4395532_4396168_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007805.1|4396424_4397075_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|4397417_4397948_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001373148.1|4398700_4399498_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001352368.1|4400668_4401877_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000480513.1|4409566_4410619_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378595.1|4410933_4412250_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060247.1|4412351_4413806_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|4414148_4414865_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011020.1|4418031_4418982_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|4419083_4420001_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986347.1|4420459_4421395_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166155.1|4421456_4422536_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|4422547_4423291_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973198.1|4423287_4423833_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001373172.1|4425198_4426350_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
>prophage 12
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	4475360	4566948	4855460	plate,terminase,capsid,transposase,head,lysis,tail,tRNA,integrase,portal,holin	Escherichia_phage(37.5%)	92	4534287:4534314	4565132:4565159
WP_001067855.1|4475360_4476065_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039465.1|4476181_4476568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373131.1|4477177_4477462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114141283.1|4477729_4477945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183060.1|4479065_4479959_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|4480201_4481197_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001115987.1|4481354_4482749_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
WP_000862667.1|4482759_4483980_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_000770801.1|4483976_4485257_-	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_000058464.1|4485328_4486807_-	M-antigen undecaprenyl disphosphate flippase	NA	NA	NA	NA	NA
WP_000183130.1|4486808_4488203_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_001373136.1|4488257_4489628_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.1e-31
WP_000079285.1|4489820_4491257_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699762.1|4491259_4492483_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001767438.1|4492479_4492959_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000089911.1|4492961_4493927_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_000048190.1|4493929_4495051_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_001153547.1|4495077_4495626_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000927066.1|4495641_4496388_-	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_023277575.1|4496398_4497616_-	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_001023926.1|4497590_4498808_-	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000888740.1|4498804_4499293_-	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_000654503.1|4499295_4500135_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137194.1|4500312_4502475_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|4502477_4502921_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|4502926_4504066_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|4504724_4506308_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252335.1|4506581_4508435_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|4508456_4509038_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|4509129_4509771_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_087530412.1|4510088_4513406_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000288389.1|4513444_4514302_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000469759.1|4514435_4515788_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
WP_023277577.1|4515799_4517740_-	protein kinase YegI	NA	NA	NA	NA	NA
WP_000119067.1|4517736_4518498_-	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_023277578.1|4518494_4519154_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010723109.1|4519374_4519434_-	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_001386899.1|4519706_4519763_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001386901.1|4520034_4520091_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000678962.1|4520369_4521617_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001543944.1|4521616_4524739_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000667585.1|4524739_4527817_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130898.1|4527817_4529233_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675150.1|4529229_4530633_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|4530629_4531352_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|4531542_4531875_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4532083_4532380_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4532381_4532678_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4532780_4534142_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4534287:4534314	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|4534414_4534633_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_087530413.1|4534714_4535878_-	phage late control D family protein	NA	A0A0F7LDR0	Escherichia_phage	99.2	2.7e-204
WP_000978907.1|4535877_4536357_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_087530414.1|4536371_4538819_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.1	0.0e+00
WP_000785970.1|4538811_4538931_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4538963_4539239_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_087530415.1|4539295_4539814_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	5.5e-93
WP_033811997.1|4539826_4541017_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_025210643.1|4541868_4542186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530416.1|4542329_4542779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072666686.1|4542781_4543225_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_087530417.1|4543196_4543799_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	89.9	2.3e-90
WP_087530418.1|4543798_4545136_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.2	6.9e-180
WP_001285337.1|4545132_4545744_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121476.1|4545736_4546645_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127163.1|4546649_4546997_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_087530419.1|4546993_4547629_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.0e-112
WP_001001780.1|4547695_4548148_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917190.1|4548140_4548608_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001300730.1|4548570_4548744_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_087530420.1|4548715_4549141_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	6.8e-65
WP_087530421.1|4549128_4549554_-	protein lysA	NA	Q858W1	Yersinia_virus	88.7	5.5e-59
WP_087530422.1|4549568_4550066_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	5.3e-93
WP_000123123.1|4550065_4550347_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|4550350_4550554_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4550553_4551063_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_042023909.1|4551162_4551906_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	2.8e-122
WP_087530423.1|4551909_4552983_-|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	99.2	4.3e-201
WP_001085972.1|4553041_4553896_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_087530424.1|4554069_4555842_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_087530425.1|4555841_4556876_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.0e-200
WP_059329802.1|4557223_4559095_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_087530426.1|4559215_4561480_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_000027664.1|4561469_4561745_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113258.1|4561741_4561966_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_001277958.1|4561965_4562268_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557703.1|4562267_4562492_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4562555_4563056_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|4563233_4563509_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|4563623_4563923_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|4564038_4565052_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_000716757.1|4565316_4565634_-	hypothetical protein	NA	NA	NA	NA	NA
4565132:4565159	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|4566048_4566948_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 13
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	4604917	4614359	4855460		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|4604917_4606054_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|4606050_4608051_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|4608175_4608637_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4608677_4609148_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4609194_4609914_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4609910_4611596_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4611817_4612549_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|4612608_4612716_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4612696_4613428_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|4613432_4614359_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 14
NZ_CP018323	Escherichia coli strain KSC9 chromosome, complete genome	4855460	4813883	4853549	4855460	terminase,plate,capsid,head,integrase,tRNA,tail,portal,holin	Enterobacteria_phage(81.82%)	52	4816889:4816907	4853691:4853709
WP_001283581.1|4813883_4814696_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4814695_4815709_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|4815774_4816932_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
4816889:4816907	attL	TTTTCATCAACAAGGATTT	NA	NA	NA	NA
WP_000023401.1|4817090_4818095_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_000581441.1|4818191_4818512_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	45.0	1.3e-12
WP_000004248.1|4818627_4818915_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000183754.1|4818921_4819128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064506806.1|4819247_4819598_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	89.7	3.4e-54
WP_001040240.1|4819608_4819887_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.8e-34
WP_000514277.1|4819898_4820141_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021654.1|4820137_4820251_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000991906.1|4820343_4820760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|4820783_4820987_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153709.1|4820983_4821250_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.6e-30
WP_000108348.1|4821246_4821546_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	82.7	1.6e-36
WP_157923231.1|4821557_4822175_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599382.1|4822171_4822537_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000686549.1|4825443_4826403_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	3.2e-179
WP_000211280.1|4826407_4826722_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_071529707.1|4826805_4827648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068330.1|4827687_4828185_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087812.1|4828833_4829880_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_064506808.1|4829879_4831631_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262639.1|4831785_4832622_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	2.1e-147
WP_001055107.1|4832645_4833698_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_000632345.1|4833743_4834544_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063093.1|4834645_4835140_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000864901.1|4835139_4835340_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|4835342_4835666_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|4835662_4836055_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|4836051_4836459_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|4836596_4837064_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356320.1|4837056_4837692_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.5e-113
WP_101677603.1|4837688_4838270_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.1e-101
WP_000213447.1|4838266_4838617_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111925.1|4838620_4839517_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_001443704.1|4839509_4840040_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_087530432.1|4840042_4842145_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	59.4	9.4e-200
WP_000972164.1|4842147_4842681_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	9.3e-96
WP_064506815.1|4842709_4843237_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	2.0e-90
WP_032317469.1|4843238_4844198_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	85.6	1.0e-156
WP_000905059.1|4844323_4844923_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_000979954.1|4844949_4845438_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853388.1|4845450_4848258_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000333494.1|4848244_4848400_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665314.1|4848408_4848774_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290450.1|4848828_4849341_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_087530433.1|4850680_4851421_+	late control protein D	NA	A0A0A7NQ97	Enterobacteria_phage	99.6	4.4e-136
WP_000488105.1|4851828_4852089_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_101677605.1|4852233_4852419_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.7	8.6e-17
WP_001353016.1|4852651_4852849_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_087530434.1|4852793_4853549_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.4	4.6e-64
4853691:4853709	attR	TTTTCATCAACAAGGATTT	NA	NA	NA	NA
