The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	122030	197798	6379281	protease,transposase	Xanthomonas_phage(14.29%)	57	NA	NA
WP_087459453.1|122030_122252_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157678079.1|122362_122530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459454.1|122666_123149_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_157678080.1|123215_123377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459455.1|123397_124687_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_157678081.1|124788_125247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459457.1|125243_129203_-	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_087459458.1|129425_130679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459459.1|130779_131277_-	DUF2505 domain-containing protein	NA	NA	NA	NA	NA
WP_087459460.1|131463_131994_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_087459461.1|132157_132859_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_087459462.1|133050_133494_+	DUF3291 domain-containing protein	NA	NA	NA	NA	NA
WP_087459463.1|133490_135014_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_087459464.1|135059_135428_+	VOC family protein	NA	NA	NA	NA	NA
WP_157678082.1|135524_135674_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_087459466.1|135673_137329_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087459467.1|137399_138059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459468.1|138191_139346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459469.1|139548_140436_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_087464274.1|140483_141506_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087464275.1|141967_144943_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_087459471.1|145030_145945_-	nucleotidyltransferase	NA	A0A292GK16	Xanthomonas_phage	42.2	7.0e-59
WP_087459472.1|145953_146508_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_087459473.1|146694_147348_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087459474.1|147372_147615_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_087459475.1|147999_149040_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157678083.1|149255_150569_-	serine/threonine protein kinase	NA	L7RCX6	Acanthamoeba_polyphaga_moumouvirus	30.0	1.1e-23
WP_087459477.1|151009_152302_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087459478.1|152432_153146_+	J domain-containing protein	NA	A0A2K9L6P8	Tupanvirus	46.0	1.4e-06
WP_157678084.1|153293_154040_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087459480.1|154192_154996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087464276.1|155148_155670_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_087459481.1|155666_156380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157678085.1|156449_156614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459482.1|157448_158441_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	3.7e-21
WP_157678086.1|158437_159775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459484.1|159810_165243_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087459485.1|165313_170635_+	AAA family ATPase	NA	A0A1B1UZQ2	Malacosoma_sp._alphabaculovirus	31.9	3.5e-09
WP_087459486.1|170663_171971_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_087459487.1|171967_172366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157678087.1|172529_174239_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_087459489.1|174464_175145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459490.1|177340_178363_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.3	3.2e-76
WP_087459491.1|178487_179666_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_087459492.1|179772_180879_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_087459493.1|180892_181663_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	8.9e-31
WP_087459494.1|181707_182379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459495.1|182668_183805_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087459496.1|183868_185644_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_087459497.1|185733_186291_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_087459498.1|186287_186638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087459499.1|186740_187430_-	phage shock protein A	NA	NA	NA	NA	NA
WP_087459500.1|187456_187864_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_087459501.1|188117_188765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087464277.1|188818_190864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459502.1|190934_196217_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087459503.1|196814_197798_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	1377481	1385527	6379281	tRNA	Bacillus_phage(16.67%)	6	NA	NA
WP_087460429.1|1377481_1379224_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	4.9e-61
WP_087460430.1|1379321_1380953_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.9	2.0e-19
WP_157678182.1|1381136_1382234_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	9.8e-07
WP_087460432.1|1382240_1383791_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.5	9.0e-91
WP_087460433.1|1383917_1384610_+	uracil-DNA glycosylase	NA	Q69273	Leporid_herpesvirus	51.6	6.5e-49
WP_087460434.1|1384690_1385527_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	32.3	4.8e-30
>prophage 3
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	1958453	2013379	6379281	transposase	Microcystis_virus(20.0%)	49	NA	NA
WP_087464397.1|1958453_1959050_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	55.2	3.1e-47
WP_087460876.1|1959049_1960705_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087460877.1|1960744_1961356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087460878.1|1961617_1962781_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	58.4	2.4e-120
WP_087460879.1|1962804_1963077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157678225.1|1963051_1963786_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087460881.1|1963897_1964281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087460882.1|1964543_1965296_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157678226.1|1965723_1966059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460884.1|1966400_1967372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460885.1|1967378_1967780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087460886.1|1968202_1969555_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087460887.1|1969878_1970844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087460888.1|1971079_1971433_+	glyoxalase	NA	NA	NA	NA	NA
WP_087460889.1|1971528_1972758_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.2e-103
WP_087464398.1|1973061_1974459_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_087460890.1|1974552_1975239_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_087460891.1|1975247_1976585_+	AarF/ABC1/UbiB kinase family protein	NA	NA	NA	NA	NA
WP_087460892.1|1976821_1978843_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_087460893.1|1978947_1979862_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_087460894.1|1980251_1981433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087464399.1|1981955_1983686_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_087460895.1|1983746_1984199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460896.1|1984195_1985746_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.6	1.2e-31
WP_087460897.1|1985878_1986076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460898.1|1986107_1986905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087460899.1|1987008_1987869_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087460900.1|1988001_1990014_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_087460901.1|1990082_1990928_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_087460902.1|1990957_1992118_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_087460903.1|1992184_1993813_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_087460904.1|1993960_1994842_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_087460905.1|1995157_1995757_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087460906.1|1995753_1997574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460907.1|1997570_1998203_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_087460908.1|1998695_2000732_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087464400.1|2000770_2002117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460909.1|2002177_2002759_+	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_087460910.1|2002904_2003264_+	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
WP_087460911.1|2003367_2004339_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_087460912.1|2004335_2004926_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087460913.1|2005056_2005362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464401.1|2005784_2006990_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_087460914.1|2007014_2007455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087460915.1|2007826_2008252_+	GFA family protein	NA	NA	NA	NA	NA
WP_087460916.1|2008409_2009975_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087460917.1|2009959_2010997_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087460918.1|2011171_2011465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087460919.1|2011723_2013379_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.8	5.9e-48
>prophage 4
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	3257983	3279443	6379281	transposase,integrase	Bacillus_virus(25.0%)	23	3250892:3250913	3279942:3279963
3250892:3250913	attL	AAACAGGGCAACCTAGCAATAA	NA	NA	NA	NA
WP_087459477.1|3257983_3259276_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087461864.1|3259415_3260366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087461865.1|3260372_3261263_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	38.4	6.0e-23
WP_157678309.1|3261361_3262117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087461867.1|3262552_3262918_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	36.8	3.0e-13
WP_087461868.1|3262919_3263231_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_087461869.1|3263249_3265451_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_087461870.1|3265486_3266011_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_087464483.1|3266543_3267713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087461871.1|3267724_3268564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459508.1|3268734_3270093_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_087461872.1|3270266_3271310_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_157678310.1|3272051_3272519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087461874.1|3272719_3273157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464484.1|3273276_3273663_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_087461875.1|3273748_3274096_+	mercury transporter	NA	NA	NA	NA	NA
WP_087461876.1|3274111_3274402_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_087461877.1|3274394_3274610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087461878.1|3274961_3275807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087461879.1|3275969_3276674_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.9	6.0e-34
WP_087461880.1|3276675_3277506_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_087461881.1|3277580_3278225_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_087459752.1|3278275_3279443_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.9	1.6e-60
3279942:3279963	attR	TTATTGCTAGGTTGCCCTGTTT	NA	NA	NA	NA
>prophage 5
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	3580487	3621151	6379281	transposase,integrase	Leptospira_phage(25.0%)	41	3608693:3608708	3624451:3624466
WP_087462124.1|3580487_3582143_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087464271.1|3582142_3582739_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	54.6	4.0e-47
WP_087462125.1|3582830_3585554_+	response regulator	NA	A0A1V0SGX0	Hokovirus	43.8	3.1e-46
WP_087462126.1|3585560_3586661_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_087464507.1|3587002_3588382_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_087462127.1|3588462_3589194_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_087462128.1|3589214_3589898_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_087462129.1|3589959_3590712_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_087462130.1|3590865_3591114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087462131.1|3591564_3591762_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_087462132.1|3591781_3592456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087462133.1|3592462_3592849_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_087462134.1|3592855_3593446_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_087462135.1|3593584_3594463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087462136.1|3594470_3595589_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_087462137.1|3595957_3596665_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.8	2.3e-33
WP_087462138.1|3596664_3598209_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_087462139.1|3598160_3601232_-	hypothetical protein	NA	S4S2E0	Puniceispirillum_phage	32.3	4.5e-09
WP_157678335.1|3601557_3603858_+	DUF4214 domain-containing protein	NA	F8TV35	EBPR_siphovirus	29.6	1.9e-07
WP_157678336.1|3603885_3604671_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087462141.1|3604892_3605384_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_087462142.1|3605410_3606724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157678337.1|3606791_3607895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087462144.1|3607939_3608395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087462145.1|3608641_3609163_-	exonuclease	NA	NA	NA	NA	NA
3608693:3608708	attL	TTCAGCGTTACCCATA	NA	NA	NA	NA
WP_087462146.1|3609528_3609942_-	glyoxalase	NA	NA	NA	NA	NA
WP_087462147.1|3610013_3610433_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087464508.1|3610546_3610696_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_087462148.1|3610808_3611003_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_087462149.1|3610999_3611395_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_087462150.1|3612164_3612404_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_087462151.1|3612403_3612700_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_087462153.1|3613277_3613925_-	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_087462154.1|3614444_3614741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464509.1|3614730_3616224_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.8	5.5e-45
WP_087462155.1|3616334_3616682_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.0	5.8e-14
WP_087462156.1|3616681_3616963_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_087462158.1|3617439_3617958_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	M1PM27	Moumouvirus	38.6	1.8e-11
WP_087459477.1|3618113_3619406_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087462159.1|3619485_3619830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087462161.1|3620167_3621151_+|transposase	transposase	transposase	NA	NA	NA	NA
3624451:3624466	attR	TATGGGTAACGCTGAA	NA	NA	NA	NA
>prophage 7
NZ_CP021425	Oleiphilus messinensis strain ME102 chromosome, complete genome	6379281	5263615	5332491	6379281	protease,transposase	Microcystis_virus(20.0%)	60	NA	NA
WP_087463377.1|5263615_5265274_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087464628.1|5265273_5265570_-	recombinase family protein	NA	A0A7Q0	Microcystis_virus	50.6	9.6e-10
WP_087463378.1|5265755_5266697_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_087463379.1|5266706_5267339_-	OmpA family protein	NA	NA	NA	NA	NA
WP_157678476.1|5267350_5269654_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_087463381.1|5269756_5270506_-	DUF3348 family protein	NA	NA	NA	NA	NA
WP_087463382.1|5270703_5271339_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_087463383.1|5271428_5271875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463384.1|5271994_5273224_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_087463385.1|5273234_5274254_-	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_087463386.1|5274428_5274773_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	56.6	8.2e-29
WP_087463387.1|5274886_5277049_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_087463388.1|5277401_5277623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087463389.1|5277704_5279930_-	AsmA family protein	NA	NA	NA	NA	NA
WP_087463390.1|5280167_5280884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087463391.1|5281084_5282740_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087463392.1|5282901_5283372_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_087463393.1|5283527_5285060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087463394.1|5285112_5285514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087463395.1|5285589_5285982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463396.1|5286435_5287023_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_087463397.1|5287176_5288832_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_087464629.1|5288831_5289428_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	54.1	1.5e-46
WP_087464630.1|5289510_5290659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463398.1|5290714_5291050_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_087463399.1|5291073_5292843_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_087463400.1|5292845_5293868_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087463401.1|5294132_5294987_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_087463402.1|5295191_5295488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087464631.1|5295636_5296767_-	ribonucleotide-diphosphate reductase subunit beta	NA	C9DFZ8	Deftia_phage	22.5	2.1e-12
WP_087463403.1|5296790_5299595_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.1	1.4e-182
WP_087463404.1|5300105_5301032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463405.1|5301266_5302241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087464632.1|5302214_5302430_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_087463406.1|5302585_5303491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087463407.1|5303505_5304384_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_087463408.1|5304424_5305420_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_087463409.1|5305539_5306331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463411.1|5306660_5307524_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_087463412.1|5307533_5307905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463413.1|5307925_5309677_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.1	6.3e-32
WP_087463414.1|5310016_5311396_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_157678481.1|5311514_5312813_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_087463416.1|5313385_5314942_+	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	32.7	1.0e-09
WP_087463417.1|5315026_5316235_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_087464633.1|5316548_5319026_-	RND family transporter	NA	NA	NA	NA	NA
WP_087463418.1|5319287_5320142_+	ion transporter	NA	NA	NA	NA	NA
WP_087464634.1|5320279_5321131_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.9	2.1e-126
WP_087463419.1|5321193_5322036_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_087463420.1|5322155_5322953_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_157678484.1|5322990_5323902_+	hypothetical protein	NA	A0A068EGT7	Penguinpox_virus	34.0	5.2e-30
WP_087463422.1|5323920_5324508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087463423.1|5324516_5325509_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_087463424.1|5325539_5326298_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_087463425.1|5326619_5326868_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_087464635.1|5326872_5327781_+	geranyl transferase	NA	NA	NA	NA	NA
WP_087463263.1|5327831_5328926_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_087463426.1|5329112_5331071_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_087463427.1|5331119_5331740_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.9	4.6e-46
WP_087463428.1|5331825_5332491_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
