The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018806	Histophilus somni strain USDA-ARS-USMARC-63370 chromosome, complete genome	2183418	364657	418689	2183418	integrase,protease,terminase,capsid,transposase	Mannheimia_phage(35.48%)	57	368806:368823	398640:398657
WP_075293630.1|364657_365902_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_075293629.1|365917_366499_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	9.0e-60
WP_075293628.1|366584_367883_-	trigger factor	NA	NA	NA	NA	NA
WP_075293701.1|368265_369657_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
368806:368823	attL	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_012341088.1|369690_370950_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_075293627.1|371019_371817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075293626.1|371966_373343_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373385_375125_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|375581_376823_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|376784_376970_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|376982_377777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|377808_378996_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|379024_379753_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_087437239.1|379758_380799_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.2	7.3e-12
WP_075293619.1|380848_381517_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_087437240.1|381509_382445_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	77.6	8.3e-132
WP_011609572.1|382456_382756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|382805_383090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437241.1|383176_383842_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	64.4	2.0e-39
WP_087437242.1|384225_384648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|384644_384929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437307.1|385015_385723_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|386844_387042_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387044_387263_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388142_388361_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388384_389407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609568.1|389547_390036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390164_390581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|390577_390757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391026_391215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666559.1|391201_391378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|391560_391827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392373_393213_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|393269_393956_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394058_394286_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_087437246.1|394441_394681_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	78.4	1.0e-25
WP_087437247.1|394670_395495_+	DNA replication protein	NA	A0A1X9SFR3	Acinetobacter_phage	41.2	1.8e-37
WP_075293605.1|395491_396184_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	34.6	1.9e-24
WP_075293604.1|396193_396724_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	67.2	4.8e-68
WP_075293603.1|396760_397387_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397399_397678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293601.1|397756_398344_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	55.1	1.7e-50
WP_075293600.1|398333_398738_+	hypothetical protein	NA	NA	NA	NA	NA
398640:398657	attR	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_075293599.1|398888_399728_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.6	1.6e-73
WP_075319826.1|399996_400413_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400459_401596_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|401884_402121_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_075294024.1|402110_402650_+	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	9.9e-45
WP_075294034.1|402622_402949_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_041604566.1|402977_403121_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403145_403841_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_011609539.1|403840_405388_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.0	6.4e-97
WP_075294026.1|405389_407567_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	25.9	3.4e-43
WP_011609534.1|416145_416448_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026574.1|416532_416727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012341716.1|416804_417668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294028.1|417693_418689_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP018806	Histophilus somni strain USDA-ARS-USMARC-63370 chromosome, complete genome	2183418	463301	520260	2183418	integrase,protease,transposase	Escherichia_phage(16.67%)	57	488745:488761	507291:507307
WP_075319814.1|463301_463718_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|463764_464901_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075293400.1|465156_466086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293401.1|466104_466551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293402.1|466768_467101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665519.1|467253_467394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293403.1|467470_468118_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_075293405.1|468702_469119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293406.1|469217_469436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293407.1|469559_470024_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_075293408.1|470786_472817_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|472818_473106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473200_473923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293409.1|474208_474460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293410.1|474456_475353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293411.1|475464_475944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293412.1|476844_478059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293413.1|478171_478564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479411_480251_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480234_481239_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|481860_482283_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482335_482836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|482838_483036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483209_483671_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484033_484444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|484445_486473_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486475_487798_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
488745:488761	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_075293420.1|489880_490075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490078_490288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376608.1|490291_491089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491236_491749_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_075293421.1|491789_492059_-	DUF1845 domain-containing protein	NA	NA	NA	NA	NA
WP_081376609.1|492255_493443_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493414_494254_+	nucleoside triphosphate hydrolase	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|494779_494983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495098_495380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495348_495570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|495873_496056_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496352_496571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666560.1|497056_497194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|497525_497825_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498035_498554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376612.1|499460_500690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|500852_501404_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_075293427.1|501414_503121_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_135026467.1|503110_504415_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.8	3.1e-84
WP_075293428.1|505605_506715_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	3.6e-17
WP_011609498.1|506879_507203_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507320_508016_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507291:507307	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_075293429.1|508102_509344_-	uracil permease	NA	NA	NA	NA	NA
WP_075293430.1|509445_510072_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011609493.1|511231_512581_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_075293431.1|512985_513393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293432.1|514202_515993_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	1.3e-136
WP_012341153.1|516014_517043_-	sugar kinase	NA	NA	NA	NA	NA
WP_075293433.1|517543_518842_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	1.3e-66
WP_075293434.1|518907_520260_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018806	Histophilus somni strain USDA-ARS-USMARC-63370 chromosome, complete genome	2183418	741313	770252	2183418	terminase,transposase,integrase	Burkholderia_phage(18.18%)	31	760023:760052	770731:770760
WP_014325826.1|741313_742078_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743141_744635_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|744746_745052_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745079_746294_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|746570_747455_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_014325823.1|748082_749375_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|749537_750383_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|750551_751355_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751354_752191_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|752526_753342_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754258_755269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087437310.1|756313_756538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|756616_757516_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|757665_758103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|758834_759413_-	hypothetical protein	NA	NA	NA	NA	NA
760023:760052	attL	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
WP_075294468.1|760162_761410_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	6.0e-53
WP_075294469.1|761702_761960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|761969_762479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|762646_762868_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|762877_763123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294472.1|763123_763363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|763376_763904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294473.1|764055_764538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|764530_764749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|764735_765104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|765629_767540_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|768083_768350_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768385_768781_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_075294477.1|768919_769213_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	6.8e-08
WP_075294478.1|769225_769813_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|769805_770252_+|terminase	terminase	terminase	NA	NA	NA	NA
770731:770760	attR	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP018806	Histophilus somni strain USDA-ARS-USMARC-63370 chromosome, complete genome	2183418	1652434	1659705	2183418	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075294159.1|1652434_1654387_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-11
WP_012341601.1|1654390_1655197_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_075294158.1|1655277_1656864_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.7	5.7e-08
WP_075319813.1|1657019_1658156_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658202_1658619_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075294045.1|1658733_1659705_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	1.2e-05
>prophage 5
NZ_CP018806	Histophilus somni strain USDA-ARS-USMARC-63370 chromosome, complete genome	2183418	1857528	1905959	2183418	tail,head,holin,transposase,plate	Haemophilus_phage(39.47%)	54	NA	NA
WP_075294184.1|1857528_1858329_-|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	31.0	1.7e-08
WP_075294185.1|1858330_1859029_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_075294186.1|1859025_1859958_-	DMT family transporter	NA	NA	NA	NA	NA
WP_081376854.1|1859944_1860748_-	phosphotransferase	NA	NA	NA	NA	NA
WP_075294187.1|1861264_1862269_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011609618.1|1862444_1862912_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.1	8.0e-51
WP_075294188.1|1862927_1865054_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.6	2.6e-258
WP_075294190.1|1867335_1868994_+	putative transporter	NA	NA	NA	NA	NA
WP_012341368.1|1869187_1869400_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_081376598.1|1869451_1869625_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1870313_1871111_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1871233_1871497_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1873466_1874348_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874355_1874544_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1874540_1874846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294197.1|1875642_1875858_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1875842_1876085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1876222_1876681_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1876774_1876963_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1877691_1878360_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878370_1878577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1878701_1879127_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1879216_1879759_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294205.1|1879765_1879996_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294206.1|1879992_1880250_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294207.1|1880173_1880383_+	lipoprotein	NA	F6MIK2	Haemophilus_phage	46.4	1.6e-06
WP_075294208.1|1880366_1880621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1880617_1880872_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1880874_1881384_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_075294211.1|1883179_1884799_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1884785_1886057_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886298_1886844_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1886843_1887824_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_075294214.1|1887902_1888325_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1888321_1888960_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1888956_1889223_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1889209_1889383_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889382_1890804_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1890815_1891190_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891258_1891546_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1891816_1893949_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1893990_1895346_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294228.1|1895356_1896463_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1896459_1897119_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897221_1897572_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1897584_1898646_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1898645_1899209_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_075294227.1|1899211_1899751_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	38.2	2.1e-15
WP_157665525.1|1899728_1900763_+	hypothetical protein	NA	Q94MY0	Haemophilus_virus	49.2	2.5e-60
WP_012341722.1|1900769_1901117_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1901100_1901352_-	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_075294466.1|1901414_1902041_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	57.2	1.8e-58
WP_011609624.1|1903353_1904043_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_075294465.1|1904237_1905959_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	4.1e-68
