The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018805	Histophilus somni strain USDA-ARS-USMARC-63369 chromosome, complete genome	2183439	365162	419194	2183439	capsid,protease,transposase,terminase,integrase	Mannheimia_phage(35.48%)	57	369311:369328	399145:399162
WP_075293630.1|365162_366407_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_075293629.1|366422_367004_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	9.0e-60
WP_075293628.1|367089_368388_-	trigger factor	NA	NA	NA	NA	NA
WP_075293701.1|368770_370162_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
369311:369328	attL	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_012341088.1|370195_371455_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_075293627.1|371524_372322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075293626.1|372471_373848_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373890_375630_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|376086_377328_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|377289_377475_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|377487_378282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|378313_379501_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|379529_380258_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_087437239.1|380263_381304_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.2	7.3e-12
WP_075293619.1|381353_382022_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_087437240.1|382014_382950_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	77.6	8.3e-132
WP_011609572.1|382961_383261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|383310_383595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437241.1|383681_384347_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	64.4	2.0e-39
WP_087437242.1|384730_385153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|385149_385434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437307.1|385520_386228_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|387349_387547_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387549_387768_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388647_388866_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388889_389912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609568.1|390052_390541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390669_391086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|391082_391262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391531_391720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666559.1|391706_391883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|392065_392332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392878_393718_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|393774_394461_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394563_394791_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_087437246.1|394946_395186_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	78.4	1.0e-25
WP_087437247.1|395175_396000_+	DNA replication protein	NA	A0A1X9SFR3	Acinetobacter_phage	41.2	1.8e-37
WP_075293605.1|395996_396689_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	34.6	1.9e-24
WP_075293604.1|396698_397229_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	67.2	4.8e-68
WP_075293603.1|397265_397892_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397904_398183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293601.1|398261_398849_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	55.1	1.7e-50
WP_075293600.1|398838_399243_+	hypothetical protein	NA	NA	NA	NA	NA
399145:399162	attR	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_075293599.1|399393_400233_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.6	1.6e-73
WP_075319826.1|400501_400918_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400964_402101_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|402389_402626_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_075294024.1|402615_403155_+	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	9.9e-45
WP_075294034.1|403127_403454_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_041604566.1|403482_403626_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403650_404346_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_011609539.1|404345_405893_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.0	6.4e-97
WP_075294026.1|405894_408072_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	25.9	3.4e-43
WP_011609534.1|416650_416953_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026574.1|417037_417232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012341716.1|417309_418173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294028.1|418198_419194_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP018805	Histophilus somni strain USDA-ARS-USMARC-63369 chromosome, complete genome	2183439	463806	520764	2183439	protease,transposase,integrase	Escherichia_phage(16.67%)	58	489249:489265	507795:507811
WP_075319814.1|463806_464223_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|464269_465406_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075293400.1|465661_466591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293401.1|466609_467056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293402.1|467273_467606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665519.1|467758_467899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293403.1|467975_468623_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_087437250.1|468823_469132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293405.1|469206_469623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293406.1|469721_469940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293407.1|470063_470528_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_075293408.1|471290_473321_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|473322_473610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473704_474427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293409.1|474712_474964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293410.1|474960_475857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293411.1|475968_476448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293412.1|477348_478563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293413.1|478675_479068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479915_480755_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480738_481743_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|482364_482787_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482839_483340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|483342_483540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483713_484175_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484537_484948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|484949_486977_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486979_488302_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
489249:489265	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_075293420.1|490384_490579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490582_490792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376608.1|490795_491593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491740_492253_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_075293421.1|492293_492563_-	DUF1845 domain-containing protein	NA	NA	NA	NA	NA
WP_081376609.1|492759_493947_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493918_494758_+	nucleoside triphosphate hydrolase	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|495283_495487_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495602_495884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495852_496074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|496377_496560_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496856_497075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666560.1|497560_497698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|498029_498329_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498539_499058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376612.1|499964_501194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|501356_501908_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_075293427.1|501918_503625_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_135026467.1|503614_504919_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.8	3.1e-84
WP_075293428.1|506109_507219_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	3.6e-17
WP_011609498.1|507383_507707_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507824_508520_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507795:507811	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_075293429.1|508606_509848_-	uracil permease	NA	NA	NA	NA	NA
WP_075293430.1|509949_510576_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011609493.1|511735_513085_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_075293431.1|513489_513897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293432.1|514706_516497_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	1.3e-136
WP_012341153.1|516518_517547_-	sugar kinase	NA	NA	NA	NA	NA
WP_075293433.1|518047_519346_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	1.3e-66
WP_075293434.1|519411_520764_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018805	Histophilus somni strain USDA-ARS-USMARC-63369 chromosome, complete genome	2183439	741813	770752	2183439	transposase,terminase,integrase	Burkholderia_phage(18.18%)	31	760523:760552	771231:771260
WP_014325826.1|741813_742578_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743641_745135_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|745246_745552_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745579_746794_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|747070_747955_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_014325823.1|748582_749875_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|750037_750883_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|751051_751855_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751854_752691_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|753026_753842_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754758_755769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087437310.1|756813_757038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|757116_758016_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|758165_758603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|759334_759913_-	hypothetical protein	NA	NA	NA	NA	NA
760523:760552	attL	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
WP_075294468.1|760662_761910_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	6.0e-53
WP_075294469.1|762202_762460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|762469_762979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|763146_763368_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|763377_763623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294472.1|763623_763863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|763876_764404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294473.1|764555_765038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|765030_765249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|765235_765604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|766129_768040_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|768583_768850_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768885_769281_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_075294477.1|769419_769713_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	6.8e-08
WP_075294478.1|769725_770313_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|770305_770752_+|terminase	terminase	terminase	NA	NA	NA	NA
771231:771260	attR	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP018805	Histophilus somni strain USDA-ARS-USMARC-63369 chromosome, complete genome	2183439	1652918	1660189	2183439	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075294159.1|1652918_1654871_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-11
WP_012341601.1|1654874_1655681_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_075294158.1|1655761_1657348_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.7	5.7e-08
WP_075319813.1|1657503_1658640_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658686_1659103_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075294045.1|1659217_1660189_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	1.2e-05
>prophage 5
NZ_CP018805	Histophilus somni strain USDA-ARS-USMARC-63369 chromosome, complete genome	2183439	1858033	1906457	2183439	plate,head,holin,transposase,tail	Haemophilus_phage(39.47%)	54	NA	NA
WP_075294184.1|1858033_1858834_-|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	31.0	1.7e-08
WP_075294185.1|1858835_1859534_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_075294186.1|1859530_1860463_-	DMT family transporter	NA	NA	NA	NA	NA
WP_081376854.1|1860449_1861253_-	phosphotransferase	NA	NA	NA	NA	NA
WP_075294187.1|1861761_1862766_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011609618.1|1862941_1863409_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.1	8.0e-51
WP_075294188.1|1863424_1865551_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.6	2.6e-258
WP_075294190.1|1867832_1869491_+	putative transporter	NA	NA	NA	NA	NA
WP_012341368.1|1869684_1869897_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_081376598.1|1869948_1870122_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1870810_1871608_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1871730_1871994_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1873964_1874846_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874853_1875042_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1875038_1875344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294197.1|1876140_1876356_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1876340_1876583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1876720_1877179_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1877272_1877461_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1878189_1878858_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878868_1879075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1879199_1879625_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1879714_1880257_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294205.1|1880263_1880494_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294206.1|1880490_1880748_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294207.1|1880671_1880881_+	lipoprotein	NA	F6MIK2	Haemophilus_phage	46.4	1.6e-06
WP_075294208.1|1880864_1881119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1881115_1881370_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1881372_1881882_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_075294211.1|1883677_1885297_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1885283_1886555_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886796_1887342_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1887341_1888322_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_075294214.1|1888400_1888823_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1888819_1889458_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1889454_1889721_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1889707_1889881_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889880_1891302_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1891313_1891688_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891756_1892044_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1892314_1894447_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1894488_1895844_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294228.1|1895854_1896961_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1896957_1897617_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897719_1898070_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1898082_1899144_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1899143_1899707_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_075294227.1|1899709_1900249_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	38.2	2.1e-15
WP_157665525.1|1900226_1901261_+	hypothetical protein	NA	Q94MY0	Haemophilus_virus	49.2	2.5e-60
WP_012341722.1|1901267_1901615_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1901598_1901850_-	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_075294466.1|1901912_1902539_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	57.2	1.8e-58
WP_011609624.1|1903851_1904541_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_075294465.1|1904735_1906457_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	4.1e-68
