The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018804	Histophilus somni strain USDA-ARS-USMARC-63368 chromosome, complete genome	2183505	365445	419477	2183505	terminase,protease,capsid,integrase,transposase	Mannheimia_phage(35.48%)	57	369594:369611	399428:399445
WP_075293630.1|365445_366690_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_075293629.1|366705_367287_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	9.0e-60
WP_075293628.1|367372_368671_-	trigger factor	NA	NA	NA	NA	NA
WP_075293701.1|369053_370445_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
369594:369611	attL	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_012341088.1|370478_371738_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_075293627.1|371807_372605_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_075293626.1|372754_374131_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|374173_375913_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|376369_377611_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|377572_377758_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|377770_378565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|378596_379784_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|379812_380541_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_087437239.1|380546_381587_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.2	7.3e-12
WP_075293619.1|381636_382305_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_087437240.1|382297_383233_-	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	77.6	8.3e-132
WP_011609572.1|383244_383544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|383593_383878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437241.1|383964_384630_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	64.4	2.0e-39
WP_087437242.1|385013_385436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|385432_385717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437307.1|385803_386511_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|387632_387830_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387832_388051_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388930_389149_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|389172_390195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609568.1|390335_390824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390952_391369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|391365_391545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391814_392003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666559.1|391989_392166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|392348_392615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|393161_394001_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|394057_394744_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394846_395074_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_087437246.1|395229_395469_+	helix-turn-helix domain-containing protein	NA	A0A0M3LR73	Mannheimia_phage	78.4	1.0e-25
WP_087437247.1|395458_396283_+	DNA replication protein	NA	A0A1X9SFR3	Acinetobacter_phage	41.2	1.8e-37
WP_075293605.1|396279_396972_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	34.6	1.9e-24
WP_075293604.1|396981_397512_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	67.2	4.8e-68
WP_075293603.1|397548_398175_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|398187_398466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293601.1|398544_399132_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	55.1	1.7e-50
WP_075293600.1|399121_399526_+	hypothetical protein	NA	NA	NA	NA	NA
399428:399445	attR	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_075293599.1|399676_400516_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.6	1.6e-73
WP_075319826.1|400784_401201_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|401247_402384_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|402672_402909_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_075294024.1|402898_403438_+	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	9.9e-45
WP_075294034.1|403410_403737_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_041604566.1|403765_403909_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403933_404629_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_011609539.1|404628_406176_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.0	6.4e-97
WP_075294026.1|406177_408355_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	25.9	3.4e-43
WP_011609534.1|416933_417236_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026574.1|417320_417515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012341716.1|417592_418456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294028.1|418481_419477_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP018804	Histophilus somni strain USDA-ARS-USMARC-63368 chromosome, complete genome	2183505	464089	521047	2183505	protease,integrase,transposase	Escherichia_phage(16.67%)	57	489532:489548	508078:508094
WP_075319814.1|464089_464506_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|464552_465689_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075293400.1|465944_466874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293401.1|466892_467339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293402.1|467556_467889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293403.1|468258_468906_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_087437250.1|469106_469415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293405.1|469489_469906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293406.1|470004_470223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293407.1|470346_470811_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_075293408.1|471573_473604_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|473605_473893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473987_474710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293409.1|474995_475247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293410.1|475243_476140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293411.1|476251_476731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293412.1|477631_478846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293413.1|478958_479351_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_075293458.1|480198_481038_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|481021_482026_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|482647_483070_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|483122_483623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|483625_483823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483996_484458_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484820_485231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|485232_487260_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|487262_488585_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
489532:489548	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_075293420.1|490667_490862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490865_491075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376608.1|491078_491876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|492023_492536_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_075293421.1|492576_492846_-	DUF1845 family protein	NA	NA	NA	NA	NA
WP_081376609.1|493042_494230_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|494201_495041_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|495566_495770_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495885_496167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|496135_496357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|496660_496843_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|497139_497358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666560.1|497843_497981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|498312_498612_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498822_499341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376612.1|500247_501477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|501639_502191_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_075293427.1|502201_503908_-	ParB family protein	NA	NA	NA	NA	NA
WP_135026467.1|503897_505202_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.8	3.1e-84
WP_075293428.1|506392_507502_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	3.6e-17
WP_011609498.1|507666_507990_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|508107_508803_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
508078:508094	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_075293429.1|508889_510131_-	NCS2 family protein	NA	NA	NA	NA	NA
WP_075293430.1|510232_510859_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011609493.1|512018_513368_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_075293431.1|513772_514180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293432.1|514989_516780_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	1.3e-136
WP_012341153.1|516801_517830_-	sugar kinase	NA	NA	NA	NA	NA
WP_075293433.1|518330_519629_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	1.3e-66
WP_075293434.1|519694_521047_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018804	Histophilus somni strain USDA-ARS-USMARC-63368 chromosome, complete genome	2183505	742099	771038	2183505	integrase,terminase,transposase	Burkholderia_phage(18.18%)	31	760809:760838	771517:771546
WP_014325826.1|742099_742864_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743927_745421_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|745532_745838_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745865_747080_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|747356_748241_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_014325823.1|748868_750161_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|750323_751169_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|751337_752141_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|752140_752977_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|753312_754128_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|755044_756055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087437310.1|757099_757324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|757402_758302_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|758451_758889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|759620_760199_-	hypothetical protein	NA	NA	NA	NA	NA
760809:760838	attL	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
WP_075294468.1|760948_762196_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	6.0e-53
WP_075294469.1|762488_762746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|762755_763265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|763432_763654_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|763663_763909_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075294472.1|763909_764149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|764162_764690_+	ash family protein	NA	NA	NA	NA	NA
WP_075294473.1|764841_765324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|765316_765535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|765521_765890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|766415_768326_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|768869_769136_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|769171_769567_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_075294477.1|769705_769999_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	6.8e-08
WP_075294478.1|770011_770599_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|770591_771038_+|terminase	terminase	terminase	NA	NA	NA	NA
771517:771546	attR	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP018804	Histophilus somni strain USDA-ARS-USMARC-63368 chromosome, complete genome	2183505	1653329	1660600	2183505	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075294159.1|1653329_1655282_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-11
WP_012341601.1|1655285_1656092_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_075294158.1|1656172_1657759_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.7	5.7e-08
WP_075319813.1|1657914_1659051_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1659097_1659514_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075294045.1|1659628_1660600_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	1.2e-05
>prophage 5
NZ_CP018804	Histophilus somni strain USDA-ARS-USMARC-63368 chromosome, complete genome	2183505	1870351	1933042	2183505	capsid,tRNA,tail,head,transposase,plate	Haemophilus_phage(36.59%)	72	NA	NA
WP_081376598.1|1870351_1870525_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1871213_1872011_-	ORF6C domain-containing protein	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1872133_1872397_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1874367_1875249_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1875256_1875445_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1875441_1875747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294197.1|1876543_1876759_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1876743_1876986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1877123_1877582_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1877675_1877864_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1878592_1879261_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1879271_1879478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1879602_1880028_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1880117_1880660_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294205.1|1880666_1880897_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294206.1|1880893_1881151_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294207.1|1881074_1881284_+	lipoprotein	NA	F6MIK2	Haemophilus_phage	46.4	1.6e-06
WP_075294208.1|1881267_1881522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1881518_1881773_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1881775_1882285_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_075294211.1|1884080_1885700_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1885686_1886958_+|capsid	minor capsid protein	capsid	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1887199_1887745_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1887744_1888725_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_075294214.1|1888803_1889226_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1889222_1889861_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1889857_1890124_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1890110_1890284_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1890283_1891705_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1891716_1892091_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1892159_1892447_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1892717_1894850_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1894891_1896247_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294228.1|1896257_1897364_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1897360_1898020_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1898122_1898473_+	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1898485_1899547_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1899546_1900110_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_075294227.1|1900112_1900652_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	38.2	2.1e-15
WP_157665525.1|1900629_1901664_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	49.2	2.5e-60
WP_012341722.1|1901670_1902018_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1902001_1902253_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_075294466.1|1902315_1902942_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	57.2	1.8e-58
WP_011609624.1|1904250_1904940_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_075294465.1|1905134_1906856_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	4.1e-68
WP_075294464.1|1906848_1907547_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_135026534.1|1907677_1908775_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	2.2e-06
WP_087437317.1|1908849_1910361_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.4	7.7e-87
WP_012341357.1|1910409_1910640_-	membrane protein	NA	NA	NA	NA	NA
WP_041604350.1|1910649_1911849_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.4e-22
WP_075294462.1|1912291_1912861_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_075294461.1|1913189_1913795_+	porin family protein	NA	NA	NA	NA	NA
WP_075294460.1|1913816_1914260_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_075266381.1|1914384_1915359_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_075266381.1|1915456_1916431_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_011609634.1|1916544_1917834_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012341351.1|1917894_1918422_-	DUF1523 family protein	NA	NA	NA	NA	NA
WP_075294459.1|1918449_1919232_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_075294458.1|1919240_1920230_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_075294457.1|1920222_1920855_-	dTMP kinase	NA	W8D0J5	Erwinia_phage	33.9	2.0e-20
WP_075294456.1|1920864_1921905_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_075294455.1|1922036_1922849_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_075294454.1|1922995_1923694_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011609642.1|1923786_1924368_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_075294453.1|1924405_1925722_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_075294452.1|1925788_1928092_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_011609645.1|1928271_1928748_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011609646.1|1928757_1929039_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_075294451.1|1929039_1929723_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_075294450.1|1929728_1931534_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_075294449.1|1931546_1932035_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_075294448.1|1932034_1933042_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
