The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	240310	280036	3047840	capsid,tail,head,holin,integrase,portal,terminase	Lactobacillus_phage(85.42%)	61	226881:226895	287838:287852
226881:226895	attL	GAAGCCGATCCGGAA	NA	NA	NA	NA
WP_014569502.1|240310_241609_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
WP_014569501.1|241619_242033_-|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
WP_014569500.1|242022_242316_-	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_014569499.1|242345_242477_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
WP_005686996.1|242469_242793_-	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
WP_014569498.1|242802_245310_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
WP_015764922.1|245309_247298_-|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
WP_014569496.1|247300_250390_-	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
WP_015764921.1|250382_250736_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
WP_014569494.1|250840_251173_-|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
WP_014569493.1|251259_251862_-|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
WP_014569492.1|251873_252278_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_015764920.1|252278_252644_-	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
WP_014569490.1|252640_252943_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
WP_014569489.1|252947_253322_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
WP_014569488.1|253549_254563_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
WP_014569487.1|254578_255235_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
WP_014569486.1|255359_256352_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
WP_014569485.1|256317_257745_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
WP_029943635.1|257749_259105_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
WP_014569483.1|259082_259616_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
WP_015764918.1|259652_259973_-	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
WP_014569481.1|259965_260508_-	HNH endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
WP_014569480.1|260520_261669_-	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
WP_005711378.1|262696_263125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029943634.1|263419_263602_-	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
WP_014569479.1|263651_263891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495024.1|263887_264253_-	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
WP_014569478.1|264246_264678_-	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
WP_029943632.1|264667_264871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764915.1|264857_265037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569477.1|265026_265533_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
WP_014569476.1|265529_265715_-	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
WP_014569475.1|265726_266191_-	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_014569474.1|266203_266605_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
WP_014569473.1|266601_266856_-	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
WP_014569472.1|266902_267352_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
WP_015764330.1|267721_267913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569471.1|267909_268125_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
WP_014569470.1|268142_268628_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
WP_014569469.1|268640_269597_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
WP_014569468.1|269612_270377_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
WP_014569467.1|270396_271272_-	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
WP_014569466.1|271478_271706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764912.1|271849_272080_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
WP_014569463.1|272058_272607_-	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
WP_014569462.1|272672_272831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569461.1|272918_273146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943629.1|273142_273391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569460.1|273387_273630_-	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
WP_003574523.1|273764_274103_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_014569459.1|274092_274515_+	toxin	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
WP_014569458.1|274574_275276_+	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
WP_003606998.1|275382_276138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606997.1|276138_276360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016364973.1|276441_276609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764910.1|276742_277168_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
WP_005716134.1|277191_277395_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
WP_014569456.1|277505_278507_+	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
WP_005716132.1|278474_278681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569455.1|278851_280036_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
287838:287852	attR	TTCCGGATCGGCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	853816	974272	3047840	transposase	Lactobacillus_phage(15.0%)	103	NA	NA
WP_014569138.1|853816_855313_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569137.1|855360_856197_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_127817602.1|856480_856723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569018.1|857567_859064_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569134.1|859463_860636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569133.1|860642_861326_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
WP_014569132.1|861784_862213_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014569131.1|862406_863426_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014569130.1|863412_863994_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_005686376.1|864269_864638_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_005691618.1|864727_865294_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005714981.1|865522_867217_+	oleate hydratase	NA	NA	NA	NA	NA
WP_014569129.1|867487_868453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569128.1|868632_869649_-	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
WP_014569127.1|869858_870716_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003605947.1|871240_872659_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_015764850.1|873797_873962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569126.1|873919_874276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764849.1|874259_874499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569125.1|874492_874921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569124.1|875330_876095_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_005691594.1|876243_876516_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_015764848.1|876638_877457_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014569123.1|877703_879074_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
WP_014569121.1|879362_880052_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
WP_014569120.1|880056_881118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569119.1|881125_881629_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569118.1|881879_882677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569117.1|882897_883662_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
WP_005686332.1|883673_883826_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_014569116.1|883942_884488_-	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_014569115.1|885214_885952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569114.1|886420_887107_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569113.1|887103_887772_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569112.1|887785_888664_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014569111.1|888673_889426_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
WP_014569110.1|889422_890484_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014569109.1|890569_892000_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014569108.1|892023_893223_-	MFS transporter	NA	NA	NA	NA	NA
WP_031541855.1|893456_895685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005714953.1|895833_896688_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015764844.1|896955_898413_-	amino acid permease	NA	NA	NA	NA	NA
WP_005714951.1|898560_900042_-	amino acid permease	NA	NA	NA	NA	NA
WP_014569105.1|900074_903053_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
WP_014569102.1|904412_905735_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014569018.1|905736_907233_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569101.1|907331_908585_+	MFS transporter	NA	NA	NA	NA	NA
WP_003574021.1|908619_909540_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_029944056.1|909890_911447_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_014569099.1|912289_912964_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
WP_095691959.1|913013_913800_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_005688360.1|914307_915462_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003587111.1|916566_919389_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_003582045.1|919448_919712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101495030.1|919763_920111_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014569097.1|920315_921164_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
WP_014569096.1|921497_922289_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	2.0e-147
WP_014569095.1|922342_922594_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
WP_014569018.1|922887_924384_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569094.1|924501_926592_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014569093.1|926588_928376_+	UvrD-helicase domain-containing protein	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
WP_014569090.1|929414_929972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568877.1|930650_931667_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569089.1|931807_934495_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014569088.1|934487_935213_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569087.1|935215_936220_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569086.1|936293_937373_+	class C sortase	NA	NA	NA	NA	NA
WP_016382272.1|937843_938242_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_076638850.1|938365_938581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002819966.1|939319_939604_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_003601979.1|939609_940260_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_014569083.1|940601_941513_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
WP_003660077.1|941982_943797_-	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_014569082.1|944626_945760_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_041247639.1|945791_946088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569081.1|946111_946939_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014569080.1|946935_948636_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
WP_005691490.1|948637_949198_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569079.1|949280_950117_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_014569078.1|950444_951674_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_014569077.1|951675_952848_-	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005714935.1|952838_953945_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_014569076.1|953937_954822_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005714932.1|954851_956147_-	YhfT family protein	NA	NA	NA	NA	NA
WP_005714931.1|956207_956570_-	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_014569075.1|956571_956922_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_014569074.1|956954_957869_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569073.1|958107_959139_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005714910.1|959342_960053_+	transaldolase	NA	NA	NA	NA	NA
WP_014569072.1|960092_961781_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014569071.1|961798_962227_+	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
WP_005714907.1|962198_962675_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_005714906.1|963219_964113_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014569069.1|964134_964950_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014568877.1|965030_966047_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569068.1|966210_967317_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005714903.1|967341_967671_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569067.1|967675_968149_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005714899.1|968389_969148_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_014569066.1|969197_970052_-	ROK family protein	NA	NA	NA	NA	NA
WP_014569065.1|970243_971260_-	transketolase	NA	NA	NA	NA	NA
WP_014569064.1|971252_972110_-	transketolase	NA	NA	NA	NA	NA
WP_014568877.1|973255_974272_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
>prophage 3
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	1353564	1381450	3047840	transposase,protease	Faecalibacterium_phage(16.67%)	24	NA	NA
WP_003605947.1|1353564_1354983_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_076638938.1|1355862_1356141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568882.1|1356456_1357149_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014568881.1|1357264_1358761_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014568879.1|1359304_1359982_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014568877.1|1361017_1362034_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_005707490.1|1362525_1362720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014568875.1|1362759_1363779_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014568874.1|1363771_1365250_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005685670.1|1365560_1366067_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003568467.1|1366460_1366697_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005709832.1|1366788_1367379_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	59.7	3.1e-52
WP_005685677.1|1367408_1367705_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005690380.1|1367831_1368263_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	44.8	3.7e-26
WP_005685679.1|1368372_1368465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568872.1|1368586_1368790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005690384.1|1369193_1369424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014568871.1|1370116_1372729_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.2	3.2e-112
WP_005690389.1|1372791_1374753_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.8	8.1e-145
WP_014568870.1|1374784_1375903_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_014568869.1|1375899_1376112_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_014568868.1|1376605_1377745_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	34.4	7.7e-15
WP_005685692.1|1377918_1379268_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_014570251.1|1379992_1381450_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	1384760	1440309	3047840	capsid,tail,head,tRNA,integrase,portal,terminase	uncultured_Caudovirales_phage(15.38%)	53	1426278:1426298	1440407:1440427
WP_005716635.1|1384760_1386149_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014570248.1|1386189_1388091_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_014570247.1|1388217_1389837_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	6.0e-13
WP_005685704.1|1390136_1390355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685706.1|1390494_1390701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685707.1|1390906_1391671_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005685708.1|1391672_1392161_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014570246.1|1392157_1393357_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005685710.1|1393556_1393754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685711.1|1393746_1393923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685712.1|1394299_1395385_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005685714.1|1396106_1396946_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014570245.1|1396975_1397758_+	carbon-nitrogen family hydrolase	NA	M1I0M9	Paramecium_bursaria_Chlorella_virus	26.4	1.1e-07
WP_005685716.1|1397824_1398994_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014570244.1|1399271_1407083_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_005685719.1|1407182_1408418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685720.1|1408579_1409773_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005685721.1|1409759_1410449_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	6.1e-39
WP_005685722.1|1410441_1411509_-	transporter	NA	NA	NA	NA	NA
WP_014570242.1|1411889_1413071_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	31.0	1.2e-31
WP_014570241.1|1413082_1413856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570240.1|1414182_1414359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685727.1|1414369_1414630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570239.1|1414961_1415747_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014570238.1|1416025_1416736_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_014570237.1|1417204_1419022_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_014570236.1|1419057_1421115_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_005685732.1|1421119_1421563_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005685733.1|1421566_1422721_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005685734.1|1422842_1423796_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005685735.1|1423963_1424893_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005685736.1|1425093_1426014_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.3	3.0e-41
1426278:1426298	attL	TCCCCTGACCACCCAGAATAG	NA	NA	NA	NA
WP_003568375.1|1426541_1426790_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003568371.1|1426805_1426946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586099.1|1427464_1427806_-|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	38.4	9.4e-09
WP_003586097.1|1427789_1428080_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_014570234.1|1428141_1429701_-|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
WP_014570233.1|1429687_1430872_-|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
WP_015765114.1|1430876_1431056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570232.1|1431021_1432725_-|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
WP_014570231.1|1432721_1433192_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_172619743.1|1433316_1433691_-	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
WP_014570229.1|1433772_1434195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570228.1|1434474_1435899_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
WP_014570227.1|1435891_1436719_-	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
WP_015765113.1|1436702_1436891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570226.1|1436887_1437160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570225.1|1437204_1437396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570224.1|1437506_1437728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570223.1|1437795_1438071_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029944073.1|1438095_1438308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570222.1|1438422_1439034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014570221.1|1439151_1440309_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
1440407:1440427	attR	TCCCCTGACCACCCAGAATAG	NA	NA	NA	NA
>prophage 5
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	1868184	1920094	3047840	transposase,bacteriocin,protease	Organic_Lake_phycodnavirus(22.22%)	52	NA	NA
WP_107755086.1|1868184_1869078_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
WP_005687781.1|1869450_1870635_+	MFS transporter	NA	NA	NA	NA	NA
WP_014570117.1|1870859_1872650_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	8.2e-11
WP_005687784.1|1872636_1874472_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.2	3.3e-07
WP_014570116.1|1875162_1875831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005716598.1|1876071_1876890_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014570115.1|1876882_1877584_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	8.1e-31
WP_014570114.1|1877580_1878822_+	acyltransferase	NA	NA	NA	NA	NA
WP_014570113.1|1878772_1880305_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	28.8	2.0e-29
WP_014570112.1|1880294_1881269_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014570111.1|1881474_1884198_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_161756438.1|1884561_1884726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570110.1|1884835_1886350_+	MFS transporter	NA	NA	NA	NA	NA
WP_014570109.1|1886853_1887264_+	CrcB family protein	NA	NA	NA	NA	NA
WP_014570108.1|1887257_1887608_+	CrcB family protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.8	3.8e-05
WP_172619742.1|1887806_1888094_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_015765056.1|1887982_1888276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127817612.1|1888304_1888493_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014570106.1|1889478_1890381_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015765054.1|1890721_1891231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570104.1|1891358_1892000_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014570103.1|1892278_1893196_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005686796.1|1893393_1893513_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_005686799.1|1893597_1893867_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005711178.1|1894207_1894951_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	6.8e-12
WP_005686804.1|1894947_1895841_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014570102.1|1895837_1896779_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005686809.1|1896869_1897202_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014570101.1|1897321_1897963_-	cation transporter	NA	NA	NA	NA	NA
WP_005692195.1|1898078_1898273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015765053.1|1898376_1899906_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_014570099.1|1899939_1901310_+	MFS transporter	NA	NA	NA	NA	NA
WP_005686819.1|1901624_1901990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570098.1|1902278_1904996_-	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	27.4	1.6e-58
WP_099981497.1|1905425_1907003_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_005686824.1|1906986_1907124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570095.1|1907554_1908298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570094.1|1908472_1909852_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_014570093.1|1909901_1910219_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_014570092.1|1910243_1911389_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_014570091.1|1911418_1912153_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005686835.1|1912623_1913577_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005686837.1|1913751_1914093_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014570089.1|1914383_1914716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570088.1|1914889_1916317_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	6.1e-33
WP_014570087.1|1916371_1916812_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570085.1|1917132_1917939_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005711129.1|1917988_1918174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570084.1|1918560_1918746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570083.1|1918805_1918991_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005686855.1|1919459_1919618_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_014570081.1|1919794_1920094_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	2274170	2281043	3047840		Lactococcus_phage(33.33%)	9	NA	NA
WP_005692768.1|2274170_2275223_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
WP_005692769.1|2275224_2276208_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
WP_014569871.1|2276452_2277091_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005686244.1|2277338_2277650_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005712952.1|2277930_2278155_+	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
WP_014569870.1|2278151_2278865_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005715269.1|2278981_2279482_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
WP_101495023.1|2279775_2280102_+	type II toxin-antitoxin system MqsR family toxin	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
WP_014569868.1|2280113_2281043_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
>prophage 7
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	2788259	2890359	3047840	capsid,tail,transposase,head,tRNA,holin,integrase,portal,terminase	Lactobacillus_phage(36.11%)	97	2822804:2822863	2857416:2857576
WP_094515910.1|2788259_2789047_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014569697.1|2789045_2789243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569696.1|2789345_2790350_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014569018.1|2790406_2791903_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005687689.1|2792183_2792741_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687688.1|2792743_2793334_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005687687.1|2793751_2794138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687686.1|2794137_2794317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687685.1|2794601_2794988_+	YxeA family protein	NA	NA	NA	NA	NA
WP_005687684.1|2795056_2795305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687683.1|2795410_2796016_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005687682.1|2796012_2796507_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_005687681.1|2796587_2797532_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014569694.1|2797570_2798299_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005687679.1|2798336_2798660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687678.1|2798964_2801190_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_005687677.1|2801316_2801763_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005687676.1|2801762_2802389_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005687675.1|2802490_2803813_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
WP_005687674.1|2803900_2804347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687673.1|2804546_2805422_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
WP_005687672.1|2805418_2806927_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569692.1|2807480_2808764_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687670.1|2808765_2810571_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687669.1|2810656_2811103_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005687668.1|2811407_2812328_+	YitT family protein	NA	NA	NA	NA	NA
WP_005687667.1|2812475_2813363_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
WP_005687666.1|2813359_2814190_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005687665.1|2814462_2814639_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005687664.1|2814666_2815101_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.5e-14
WP_005687663.1|2815667_2816654_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
WP_005687662.1|2816657_2817116_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005687661.1|2817099_2817498_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_005713928.1|2817501_2817891_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_005687659.1|2817887_2818790_+	GTPase Era	NA	NA	NA	NA	NA
WP_005687658.1|2818789_2819605_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005687657.1|2819755_2820067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685938.1|2820721_2821435_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
WP_005685935.1|2821431_2822061_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_005685933.1|2822157_2822685_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
2822804:2822863	attL	GAAATTGAATCGGTGATGAGAAAAAGGGTCGCATTTGTACCAAACCCAAGCGAGTCAGGG	NA	NA	NA	NA
WP_029944087.1|2825263_2825491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569690.1|2825529_2826768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653167.1|2827174_2827756_+	HNH endonuclease	NA	M1NMU3	Moumouvirus	33.8	5.7e-14
WP_015764966.1|2827816_2828023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569689.1|2828023_2828791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764965.1|2828777_2829182_+	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
WP_015764964.1|2829280_2829721_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
WP_014569688.1|2829713_2829992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569018.1|2830648_2832145_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569687.1|2832210_2832960_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_107755075.1|2832956_2833133_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_015764963.1|2833365_2833926_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
WP_014569686.1|2834407_2834872_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
WP_014569685.1|2834865_2836758_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
WP_029943780.1|2836881_2837064_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_015764961.1|2837060_2838161_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
WP_014569683.1|2838160_2840089_+|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
WP_014569682.1|2840160_2840451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943782.1|2840440_2840785_+|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
WP_014569680.1|2840787_2841207_+	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
WP_015764960.1|2841203_2841584_+	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
WP_014569678.1|2841584_2842220_+|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
WP_014569677.1|2842374_2842725_+|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
WP_021354705.1|2842702_2842933_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
WP_015764958.1|2842938_2847105_+|tail	tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
WP_014569674.1|2847105_2849163_+|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
WP_014569673.1|2849168_2852102_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
WP_014569672.1|2852111_2852435_+	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
WP_005689480.1|2852427_2852559_+	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_003579629.1|2852583_2852817_+	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
WP_014569670.1|2852829_2853162_+|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
WP_014569669.1|2853164_2854319_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
WP_014569668.1|2854509_2854896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764956.1|2855737_2856058_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569667.1|2856100_2857270_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
WP_005685932.1|2857675_2858572_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
2857416:2857576	attR	GAAATTGAATCGGTGATGAGAAAAAGGGTCGCATTTGTACCAAACCCAAGCGAGTCAGGGATAGTGTAAGCCTGATGGTGGTGAATGTGATTGGCGTTTTCGAACCAAATGACAAAGCTGCAGGTAGATTCGGTCTATCTGAAGTAGGGTGGAACCGCGCA	NA	NA	NA	NA
WP_014569666.1|2858573_2860643_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005685928.1|2860828_2862598_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
WP_005685926.1|2862611_2863862_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_005685924.1|2864050_2864761_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_005685922.1|2864747_2865542_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005685921.1|2865916_2867647_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
WP_005685919.1|2867612_2869118_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005685917.1|2869575_2869764_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_005685914.1|2869797_2870148_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_005685911.1|2870263_2871007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685909.1|2871208_2872165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569664.1|2872151_2873483_+	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005685905.1|2873589_2874624_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_005685903.1|2874589_2875594_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005685900.1|2875601_2876537_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_005685898.1|2876951_2880491_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_005685897.1|2880487_2884198_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
WP_005685896.1|2884241_2887043_+	ribonuclease H-like domain-containing protein	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
WP_005685895.1|2887317_2887809_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_005685894.1|2887861_2889037_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685893.1|2889060_2890359_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
>prophage 8
NZ_CP021426	Lactobacillus rhamnosus strain 4B15 chromosome, complete genome	3047840	2966995	3030697	3047840	capsid,protease,tRNA,portal,terminase	uncultured_Caudovirales_phage(16.67%)	56	NA	NA
WP_005710545.1|2966995_2968405_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IBU3	Erwinia_phage	28.1	2.3e-37
WP_005688016.1|2968604_2969129_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_005688018.1|2969247_2970144_-	tyrosine recombinase XerC	NA	A0A2H4JAA2	uncultured_Caudovirales_phage	25.9	4.7e-15
WP_005688020.1|2970344_2971664_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_005688022.1|2971833_2973918_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.4	1.9e-104
WP_005688023.1|2974163_2974979_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_005688024.1|2975026_2975785_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	36.6	5.7e-22
WP_087307817.1|2975768_2976629_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014569641.1|2976643_2977354_-	DUF4918 family protein	NA	NA	NA	NA	NA
WP_014569640.1|2977439_2977988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569639.1|2978050_2978380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029944033.1|2978480_2979866_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_005686399.1|2979891_2980134_-	YozE family protein	NA	NA	NA	NA	NA
WP_014569637.1|2980136_2980655_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_014569636.1|2980680_2981322_-	YpmS family protein	NA	NA	NA	NA	NA
WP_005686405.1|2981326_2982172_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_005686408.1|2982434_2983277_-	DegV family protein	NA	NA	NA	NA	NA
WP_005686412.1|2983517_2984159_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_014569635.1|2984294_2984786_-	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	34.6	7.7e-20
WP_005686416.1|2984902_2985853_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	66.2	2.0e-125
WP_014569634.1|2985869_2987783_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.1	3.4e-47
WP_005686420.1|2987931_2988387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569633.1|2988511_2989708_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	32.8	8.9e-46
WP_005686424.1|2989808_2990687_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.5	2.1e-52
WP_014569632.1|2990705_2991971_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005686429.1|2992153_2992429_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	1.8e-26
WP_005686431.1|2992662_2993970_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_005686432.1|2994116_2995427_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_014569631.1|2995511_2996180_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014569630.1|2996245_2996887_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014569629.1|2996946_2998356_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.1	8.3e-59
WP_005713853.1|2998342_2999332_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005689273.1|2999411_2999669_+	ferredoxin	NA	NA	NA	NA	NA
WP_005686444.1|2999839_3000418_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_005686446.1|3000714_3001461_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014569628.1|3001444_3002062_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.8	9.3e-15
WP_005689268.1|3002061_3002787_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005686453.1|3002761_3003148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686455.1|3003339_3004221_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.9	1.4e-32
WP_014569627.1|3004222_3005107_-	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_005710606.1|3005140_3005602_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_005686460.1|3005829_3007596_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005686462.1|3007655_3008615_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_014569626.1|3008726_3012023_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	33.3	1.0e-152
WP_005686465.1|3012118_3012313_+	YjzD family protein	NA	NA	NA	NA	NA
WP_014569625.1|3012426_3013287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087307786.1|3013375_3014929_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005686471.1|3014925_3015480_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_005686472.1|3015648_3015840_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_014570229.1|3024643_3025066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172619743.1|3025147_3025522_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
WP_014570231.1|3025646_3026117_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014570232.1|3026113_3027817_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
WP_015765114.1|3027782_3027962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570233.1|3027966_3029151_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
WP_014570234.1|3029137_3030697_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
