The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	1767113	1838105	6878829	portal,transposase,tail,head,integrase,capsid,plate,terminase	Acidithiobacillus_phage(21.88%)	80	1765149:1765169	1844334:1844354
1765149:1765169	attL	CCGTATAGGCAGCTTAGAAAA	NA	NA	NA	NA
WP_086934547.1|1767113_1767329_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_086930566.1|1767243_1767471_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	51.6	1.0e-11
WP_086930567.1|1767572_1769021_-	serine hydrolase	NA	NA	NA	NA	NA
WP_086930568.1|1770372_1770666_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	37.2	1.4e-08
WP_158657831.1|1770696_1770858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930569.1|1772026_1772728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086934548.1|1772732_1773173_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_086930570.1|1773172_1773778_+	DUF4326 domain-containing protein	NA	A0A2H5BQ94	Vibrio_phage	47.9	2.8e-11
WP_086930571.1|1774315_1774789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930572.1|1774788_1775070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930573.1|1775726_1776176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930574.1|1776261_1776495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930575.1|1776768_1777650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930576.1|1777781_1778282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930577.1|1778500_1779049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657832.1|1779060_1779747_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_086930579.1|1780155_1780668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930580.1|1780679_1781231_+	YfbU family protein	NA	NA	NA	NA	NA
WP_086930582.1|1781609_1783274_+	AIPR family protein	NA	NA	NA	NA	NA
WP_158657833.1|1783343_1783667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930584.1|1783996_1784230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930585.1|1784288_1784879_+	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_086930586.1|1785105_1785534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930587.1|1785526_1786885_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	53.5	1.1e-127
WP_158657834.1|1786900_1787383_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	33.1	1.0e-16
WP_158657835.1|1787463_1787628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930588.1|1787962_1789096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930589.1|1789325_1789538_+	DNA-binding protein	NA	V5YSU5	Pseudomonas_phage	48.2	3.2e-07
WP_086930590.1|1789537_1790431_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	61.9	2.5e-93
WP_086930591.1|1790455_1791175_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	55.6	1.0e-49
WP_086930592.1|1791202_1793686_+	DEAD/DEAH box helicase family protein	NA	L0ASJ4	Klebsiella_phage	29.6	1.9e-74
WP_086930593.1|1793686_1794031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930594.1|1794059_1796246_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	33.9	7.0e-105
WP_086934550.1|1796819_1797290_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	59.9	1.3e-45
WP_086930596.1|1797289_1797700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103654321.1|1797983_1798220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930597.1|1799062_1800313_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	61.6	1.1e-147
WP_086930598.1|1800316_1800595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930599.1|1800827_1801328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930600.1|1801445_1801700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930601.1|1801782_1802124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930602.1|1802289_1802661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930603.1|1802874_1803225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657836.1|1803329_1803683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657837.1|1803807_1804233_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_086930606.1|1804332_1804572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930607.1|1804721_1805285_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	49.2	2.6e-40
WP_086930608.1|1805274_1807260_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	50.2	6.6e-179
WP_086930609.1|1807299_1807527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930610.1|1807575_1809183_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	7.2e-83
WP_086930611.1|1809166_1810465_+	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	42.2	2.9e-50
WP_086930612.1|1810461_1810848_+|head	head decoration protein	head	Q6VT74	Vibrio_phage	45.3	1.1e-05
WP_158657838.1|1811143_1811479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930614.1|1811896_1812928_+|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	36.7	1.8e-58
WP_086930615.1|1812944_1813391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930616.1|1813433_1813748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930617.1|1813806_1814340_+|tail	phage tail protein	tail	A0A1B2LRS9	Wolbachia_phage	27.5	6.8e-14
WP_086930618.1|1814348_1814834_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	32.8	1.2e-12
WP_086930619.1|1814830_1815412_+|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	39.1	1.1e-12
WP_086930620.1|1815706_1816411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930621.1|1816413_1816788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930622.1|1816826_1817111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930623.1|1817116_1817452_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	54.1	4.0e-28
WP_086930624.1|1817455_1818352_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	53.9	7.5e-82
WP_086930625.1|1818376_1819009_+|tail	phage tail protein I	tail	K7R2P6	Vibrio_phage	39.8	2.8e-30
WP_086930626.1|1819118_1820285_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_086930627.1|1820291_1820648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930628.1|1820777_1821932_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1B2LRR3	Wolbachia_phage	58.4	8.4e-126
WP_086930629.1|1821987_1822491_+|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	54.5	1.3e-46
WP_086930630.1|1822607_1822907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930631.1|1822909_1823173_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086930632.1|1823369_1825700_+|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	40.7	1.1e-84
WP_086930633.1|1825702_1826098_+|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	49.2	9.2e-32
WP_086930634.1|1826084_1826294_+|tail	tail protein X	tail	A0A088FVH7	Escherichia_phage	42.9	3.1e-07
WP_086930635.1|1826312_1827284_+	hypothetical protein	NA	D4HTW7	Vibrio_phage	40.9	2.3e-60
WP_086930636.1|1827350_1827623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173780750.1|1827779_1828091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930637.1|1828102_1828537_+	lysozyme	NA	A0A141GEY9	Brucella_phage	48.6	8.3e-26
WP_158657839.1|1828541_1829216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930640.1|1829651_1838105_-	hypothetical protein	NA	A0A0M3VI89	Ralstonia_phage	50.0	4.1e-20
1844334:1844354	attR	CCGTATAGGCAGCTTAGAAAA	NA	NA	NA	NA
>prophage 2
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	1862512	1870649	6878829		Acidithiobacillus_phage(66.67%)	8	NA	NA
WP_086930665.1|1862512_1863871_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	53.0	3.4e-126
WP_086930666.1|1863886_1864369_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	32.4	1.3e-16
WP_158657843.1|1864449_1864614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930667.1|1864949_1866092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930668.1|1866264_1866477_+	DNA-binding protein	NA	V5YSU5	Pseudomonas_phage	48.2	3.2e-07
WP_086930669.1|1866473_1867385_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	61.5	3.9e-94
WP_086930670.1|1867409_1868129_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	55.9	7.2e-51
WP_086930671.1|1868156_1870649_+	DEAD/DEAH box helicase family protein	NA	A0A2I7QJN8	Vibrio_phage	30.6	3.7e-78
>prophage 3
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	1934537	1948670	6878829		Acidithiobacillus_phage(66.67%)	14	NA	NA
WP_086930722.1|1934537_1935896_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	53.5	3.6e-128
WP_158657846.1|1935911_1936394_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	34.5	2.0e-17
WP_158657847.1|1936474_1936639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930723.1|1936973_1938110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930724.1|1938340_1938559_+	DNA-binding protein	NA	V5YSU5	Pseudomonas_phage	50.0	1.9e-07
WP_086930725.1|1938558_1939479_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	62.3	6.8e-94
WP_086930726.1|1939503_1940211_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	54.2	7.3e-48
WP_086930727.1|1940238_1941933_+	DEAD/DEAH box helicase	NA	Q6J7X8	Actinoplanes_phage	32.4	2.4e-44
WP_086930728.1|1941933_1942320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930729.1|1942348_1944544_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	33.8	3.5e-104
WP_086934553.1|1945107_1945578_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	58.5	1.5e-44
WP_086930730.1|1945577_1945988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657848.1|1946148_1946544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930731.1|1947419_1948670_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	61.6	1.9e-147
>prophage 4
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	1974012	2048365	6878829	transposase,tail,integrase,tRNA	Bacillus_phage(30.77%)	58	1972450:1972464	1975491:1975505
1972450:1972464	attL	ATTTTTTAACACGGC	NA	NA	NA	NA
WP_086930759.1|1974012_1974321_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158657849.1|1974364_1974661_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086930761.1|1974700_1974856_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	60.8	2.0e-11
WP_086930763.1|1975330_1976005_+	hypothetical protein	NA	D4HTW7	Vibrio_phage	42.3	1.9e-37
1975491:1975505	attR	ATTTTTTAACACGGC	NA	NA	NA	NA
WP_086930764.1|1976192_1976666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930765.1|1976684_1986917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930766.1|1986904_1988395_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_086930767.1|1988901_1989492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930768.1|1989528_1989927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103654250.1|1990107_1990407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930770.1|1990415_1990907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930771.1|1991436_1992264_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086930772.1|1992644_1993520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930773.1|1996120_1997497_+	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_086930774.1|1997999_1999886_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_173780752.1|2000625_2000802_-	nitrate/nitrite transporter NrtS	NA	NA	NA	NA	NA
WP_086930777.1|2000843_2001329_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.0	9.6e-23
WP_086930778.1|2001421_2002774_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086930779.1|2002839_2004261_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086930780.1|2004686_2005127_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_086930781.1|2005184_2005523_+	RnfH family protein	NA	NA	NA	NA	NA
WP_086930782.1|2005556_2005970_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_086930783.1|2006051_2006459_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_086930784.1|2006571_2008242_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_086934555.1|2008444_2009053_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_086930785.1|2009195_2011121_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.6	4.8e-150
WP_086930786.1|2011465_2012596_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.5	4.3e-34
WP_086934556.1|2012776_2013583_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_086930787.1|2013631_2015110_-	response regulator	NA	NA	NA	NA	NA
WP_173780753.1|2015808_2016963_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	2.0e-47
WP_086930789.1|2017061_2020283_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_086930790.1|2020283_2020760_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_086930791.1|2021538_2022045_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086930792.1|2022072_2022447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930793.1|2022545_2022962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930794.1|2022964_2023669_-	response regulator	NA	NA	NA	NA	NA
WP_158657850.1|2023665_2024997_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.3	6.5e-29
WP_086930796.1|2025312_2025615_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_086930797.1|2026087_2026708_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_086934557.1|2026840_2028751_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	43.3	2.1e-121
WP_086930798.1|2028815_2029664_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	29.7	9.8e-23
WP_086930799.1|2029663_2031007_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_086930800.1|2031149_2031890_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_086930801.1|2031905_2032298_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_086930802.1|2032834_2033263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930803.1|2033491_2033698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930804.1|2033738_2034107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086930805.1|2034097_2035966_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	3.4e-44
WP_086930806.1|2035918_2036659_-	bacillithiol biosynthesis deacetylase BshB1	NA	NA	NA	NA	NA
WP_086930807.1|2036688_2038449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086930808.1|2038433_2039630_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_086930809.1|2040463_2041774_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	56.9	4.6e-112
WP_086930810.1|2041931_2042396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657851.1|2042752_2043367_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_086930812.1|2043363_2044272_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_086930813.1|2044301_2045861_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	32.6	2.0e-69
WP_086930814.1|2045937_2046375_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_086930815.1|2046403_2048365_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	26.7	5.8e-26
>prophage 5
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	2827071	2834860	6878829		Synechococcus_phage(33.33%)	7	NA	NA
WP_086931417.1|2827071_2828151_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	25.7	1.9e-15
WP_086931418.1|2828160_2829474_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	32.8	5.2e-47
WP_158657890.1|2829495_2830344_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3I8S3	Synechococcus_phage	23.6	7.5e-07
WP_086931420.1|2830345_2831365_+	GDP-mannose 4,6-dehydratase	NA	A0A2H4UUK0	Bodo_saltans_virus	30.0	7.1e-28
WP_086931421.1|2831389_2832346_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.3	1.1e-09
WP_158657891.1|2832401_2833736_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_086931423.1|2833768_2834860_+	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	26.5	1.2e-28
>prophage 6
NZ_CP020038	Agarilytica rhodophyticola strain 017 chromosome, complete genome	6878829	3887065	3905549	6878829	protease,tail,portal,terminase	Rhizobium_phage(18.18%)	18	NA	NA
WP_158657982.1|3887065_3887623_-	hypothetical protein	NA	G8DH66	Emiliania_huxleyi_virus	33.5	4.8e-18
WP_086932189.1|3887655_3888309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932190.1|3888322_3892030_-	host specificity protein J	NA	A0A2I6PHT2	Pseudomonas_phage	38.9	2.3e-140
WP_086932192.1|3892576_3893335_-	C40 family peptidase	NA	W6E9P7	Rhizobium_phage	39.1	1.1e-49
WP_158657983.1|3893334_3894048_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	42.5	1.5e-45
WP_086932194.1|3894062_3894404_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	36.6	5.7e-14
WP_086932195.1|3894406_3896599_-	hypothetical protein	NA	A0A088FB58	Idiomarinaceae_phage	29.8	9.6e-38
WP_086932196.1|3896601_3896976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932197.1|3897017_3897353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932198.1|3897370_3897820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932199.1|3897832_3898219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932200.1|3898219_3898783_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	30.2	3.2e-06
WP_086932201.1|3898779_3899097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086932202.1|3899099_3899456_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	51.8	5.4e-07
WP_086932203.1|3899512_3901798_-|protease	Clp protease ClpP	protease	A0A2I7QXP2	Vibrio_phage	33.6	1.3e-53
WP_086932204.1|3901781_3903308_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	29.3	7.1e-48
WP_086932205.1|3903304_3903508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657984.1|3903512_3905549_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	40.4	1.9e-117
