The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021361	Acidovorax carolinensis strain NA3 chromosome 1, complete sequence	4122625	1049482	1075971	4122625	transposase,integrase	uncultured_Caudovirales_phage(25.0%)	21	1044358:1044374	1077628:1077644
1044358:1044374	attL	GGCGTGCCCGGCACCGC	NA	NA	NA	NA
WP_094097479.1|1049482_1050448_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094097480.1|1051756_1052245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097481.1|1052645_1054208_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.7	2.8e-07
WP_094097482.1|1054538_1055804_-	CoA transferase	NA	NA	NA	NA	NA
WP_086911657.1|1056010_1057204_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_094097483.1|1058508_1058727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097484.1|1058912_1059791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097485.1|1060285_1061644_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	29.2	4.6e-30
WP_086911660.1|1061742_1062102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094099071.1|1062104_1062425_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094097486.1|1062741_1063983_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	28.0	6.3e-10
WP_094097487.1|1064854_1066120_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_094097488.1|1066183_1066432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087745763.1|1067125_1067947_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.4	2.1e-30
WP_087748263.1|1067936_1069481_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_086911691.1|1070032_1070296_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_157896429.1|1070292_1070814_+	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_086911692.1|1070810_1071323_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_086911693.1|1071650_1073606_+	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_086913974.1|1074368_1074626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086911694.1|1074591_1075971_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
1077628:1077644	attR	GGCGTGCCCGGCACCGC	NA	NA	NA	NA
>prophage 2
NZ_CP021361	Acidovorax carolinensis strain NA3 chromosome 1, complete sequence	4122625	2026174	2072248	4122625	transposase,integrase	uncultured_Caudovirales_phage(25.0%)	42	2017108:2017124	2063250:2063266
2017108:2017124	attL	GGTGGCGGTGGCCGTGG	NA	NA	NA	NA
WP_094097864.1|2026174_2027344_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_094097865.1|2027471_2027747_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_094097866.1|2027743_2028232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097867.1|2028311_2029394_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_094097868.1|2032553_2032856_+	DUF3240 family protein	NA	NA	NA	NA	NA
WP_094097869.1|2032852_2034091_+	TolC family protein	NA	NA	NA	NA	NA
WP_094097870.1|2034165_2034966_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_094097871.1|2034991_2035342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097873.1|2035759_2036968_+	MFS transporter	NA	NA	NA	NA	NA
WP_087745763.1|2037124_2037946_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.4	2.1e-30
WP_087748263.1|2037935_2039480_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_094097874.1|2039679_2040003_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094097875.1|2040013_2040493_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_094097876.1|2040503_2041007_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094097877.1|2040999_2041509_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	41.3	2.0e-26
WP_094097878.1|2041505_2041994_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_094099122.1|2042039_2043056_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_094097879.1|2043045_2043759_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.8e-94
WP_094097880.1|2043774_2044953_+	MFS transporter	NA	NA	NA	NA	NA
WP_094097881.1|2045044_2048071_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	2.0e-70
WP_094097882.1|2048067_2048418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094097883.1|2049039_2050068_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	1.4e-44
WP_094097884.1|2050141_2051548_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_094097885.1|2051616_2052117_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094097886.1|2052190_2052742_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_086927243.1|2052738_2053152_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_094097887.1|2053264_2053801_-	OmpA family protein	NA	NA	NA	NA	NA
WP_094097888.1|2053860_2054454_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_094099123.1|2054522_2055506_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_094097889.1|2055597_2056482_+	universal stress protein	NA	NA	NA	NA	NA
WP_094097890.1|2056651_2057173_+	superoxide dismutase family protein	NA	F2Y0Q6	Organic_Lake_phycodnavirus	40.7	3.4e-18
WP_094097891.1|2057185_2057758_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_094097892.1|2057757_2060043_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_086912403.1|2060054_2060513_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	33.8	1.1e-07
WP_094097893.1|2060689_2061328_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_094097894.1|2061334_2062282_-	AEC family transporter	NA	NA	NA	NA	NA
WP_094097895.1|2063657_2064605_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
2063250:2063266	attR	CCACGGCCACCGCCACC	NA	NA	NA	NA
WP_094099124.1|2064686_2065568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157896455.1|2066180_2067411_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	82.1	1.4e-131
WP_094097896.1|2068305_2068986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094097897.1|2068976_2070980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094097898.1|2070982_2072248_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021361	Acidovorax carolinensis strain NA3 chromosome 1, complete sequence	4122625	2274391	2329028	4122625	tail,integrase,portal,terminase,transposase,head,protease,capsid	Vibrio_phage(18.18%)	43	2318074:2318121	2329133:2329180
WP_094099064.1|2274391_2275477_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162290901.1|2275574_2276618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094098006.1|2276629_2278024_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	29.6	1.1e-26
WP_094098008.1|2278652_2279720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086912555.1|2279691_2280534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094099139.1|2280559_2282050_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_094098009.1|2282104_2286157_-	ATP-dependent RNA helicase HrpA	NA	A0A2H4UU36	Bodo_saltans_virus	31.5	1.0e-48
WP_086912557.1|2286237_2287584_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_094098010.1|2288691_2289690_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_094099140.1|2289734_2290379_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_094098011.1|2290414_2291308_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086927416.1|2291484_2292552_+	alkene reductase	NA	NA	NA	NA	NA
WP_094098012.1|2292572_2293397_+	pirin family protein	NA	NA	NA	NA	NA
WP_094098013.1|2293483_2294011_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_086912564.1|2294119_2295244_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-29
WP_094098014.1|2295233_2296160_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_086912566.1|2296299_2297178_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_086928735.1|2297181_2298180_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094098015.1|2298410_2299019_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_086912568.1|2299050_2299692_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_086912571.1|2303599_2304151_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.8	6.4e-15
WP_086927421.1|2304338_2305136_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094098016.1|2305390_2306362_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162290803.1|2306643_2307540_+	EamA family transporter	NA	NA	NA	NA	NA
WP_094098017.1|2307691_2308777_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094098018.1|2308773_2309745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086928737.1|2309887_2310976_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_086928738.1|2311026_2312331_+	glycerate kinase	NA	NA	NA	NA	NA
WP_094099141.1|2312453_2313413_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_086912577.1|2314229_2314895_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094099142.1|2314898_2315945_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	2.4e-31
WP_094098019.1|2317602_2317917_+	hypothetical protein	NA	NA	NA	NA	NA
2318074:2318121	attL	TGGTGGGACGTGCGGGGGTCGAACCCACGACAAACGGATTAAAAGTCC	NA	NA	NA	NA
WP_094099143.1|2318381_2319590_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_094098020.1|2319769_2320228_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_094098021.1|2320232_2322467_+	AAA family ATPase	NA	Q854C1	Mycobacterium_phage	45.9	1.2e-24
WP_094098022.1|2322478_2322664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094098023.1|2322799_2324026_+|capsid	phage major capsid protein	capsid	R9TPU0	Vibrio_phage	31.1	9.5e-35
WP_094098024.1|2324036_2324588_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	42.9	2.1e-26
WP_094098025.1|2324584_2325778_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	40.9	7.0e-67
WP_094098026.1|2326319_2326733_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_094098027.1|2326729_2328232_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	66.3	4.2e-186
WP_094098028.1|2328435_2328714_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_094098029.1|2328710_2329028_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	37.0	2.0e-13
2329133:2329180	attR	TGGTGGGACGTGCGGGGGTCGAACCCACGACAAACGGATTAAAAGTCC	NA	NA	NA	NA
>prophage 4
NZ_CP021361	Acidovorax carolinensis strain NA3 chromosome 1, complete sequence	4122625	2757001	2822027	4122625	transposase,protease,integrase	Pandoravirus(20.0%)	42	2771432:2771451	2828654:2828673
WP_094098271.1|2757001_2758366_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_094098272.1|2758392_2759583_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_094098273.1|2760445_2761177_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.3	5.9e-16
WP_086912836.1|2761208_2761769_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_094098274.1|2763617_2764370_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_094098275.1|2765954_2767193_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094098276.1|2767248_2768772_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_086912843.1|2768865_2769828_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2771432:2771451	attL	TATAAAGCGCTAGCAGCTAT	NA	NA	NA	NA
WP_094098277.1|2774301_2774748_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_094098278.1|2774752_2777491_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_086927730.1|2778450_2779284_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_086912850.1|2780784_2781234_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_094098279.1|2783255_2784353_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.4	3.3e-79
WP_086912853.1|2784431_2784881_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_094098280.1|2784976_2786287_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	NA	NA	NA	NA
WP_094098281.1|2786289_2787099_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094098282.1|2787160_2788546_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	29.2	6.7e-37
WP_094098283.1|2788969_2790220_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_094098284.1|2790376_2790790_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_094098285.1|2792410_2793484_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_094098286.1|2793614_2794460_+	thymidylate synthase	NA	A0A1B2IHD0	Erwinia_phage	60.1	4.4e-100
WP_094098287.1|2794549_2796598_+	elongation factor G	NA	A0A2K9L2P9	Tupanvirus	22.8	8.2e-15
WP_094098288.1|2796695_2797187_+	dihydrofolate reductase	NA	A0A0K2QQK4	Ralstonia_phage	47.6	3.7e-30
WP_094098289.1|2797487_2798813_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	34.3	1.0e-58
WP_157896471.1|2798913_2799192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094098291.1|2799380_2799632_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_094098292.1|2799628_2800900_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_094098294.1|2802679_2803291_-	peptidase	NA	NA	NA	NA	NA
WP_094098295.1|2803287_2803833_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_094098296.1|2805478_2805652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157896472.1|2806798_2807131_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_094098297.1|2807127_2807523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094099176.1|2807817_2809044_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.1	9.4e-51
WP_094098298.1|2809135_2809513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094098299.1|2809604_2811590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157896473.1|2811831_2813029_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.5	2.4e-59
WP_157896474.1|2813534_2814482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157896475.1|2814491_2816552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157896476.1|2816548_2817541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094098302.1|2817548_2819117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094098303.1|2819086_2820487_-	Fic family protein	NA	NA	NA	NA	NA
WP_094098304.1|2820806_2822027_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	79.1	6.5e-193
2828654:2828673	attR	ATAGCTGCTAGCGCTTTATA	NA	NA	NA	NA
