The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	327622	338499	5347911	transposase,integrase	Enterobacteria_phage(25.0%)	10	321214:321227	335121:335134
321214:321227	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000749863.1|327622_328678_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|328965_330069_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|330080_331334_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|331689_332904_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|333046_333928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|334125_334323_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|334322_334754_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_085948178.1|335031_336244_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
335121:335134	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_001444700.1|336790_337450_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000942525.1|337428_338499_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	552101	631998	5347911	capsid,protease,head,tail,tRNA,transposase	Escherichia_phage(33.33%)	69	NA	NA
WP_000186631.1|552101_552581_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|552784_553579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|553716_554058_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|554171_556676_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|556937_557870_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|557872_559165_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|559289_559697_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000970323.1|559697_560156_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|560152_561070_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|561215_561893_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001297299.1|561879_562659_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|562721_563576_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|563636_564446_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|564435_565059_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110572.1|565029_565716_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561851.1|565712_568127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021351705.1|572756_573017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|574248_575343_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|575411_576338_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|576567_577050_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|577127_577943_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|578032_579814_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|579826_580603_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|580702_581581_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401096.1|581749_583204_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|583263_584625_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|584681_585983_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001369791.1|586004_587150_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	3.1e-48
WP_000540946.1|587278_588064_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|588074_589310_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|589331_590381_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|590697_592365_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495382.1|592374_593634_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|593644_594460_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|594456_595350_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|595486_596554_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|596550_597060_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|597177_597900_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|597902_598397_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|598570_599956_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|599991_600513_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|600620_600833_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|600834_601701_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|602181_602724_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|602943_603636_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|603666_606276_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|607327_607843_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|607845_608478_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|609688_610021_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|610076_611102_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|611143_611539_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|611550_611850_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085948269.1|611870_613083_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_000683103.1|613751_614147_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|614154_614895_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|614910_615333_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|615314_615749_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|615741_617922_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|617927_619140_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244794.1|619106_619253_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_000239881.1|619210_619879_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|619935_620241_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|620424_621909_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|622095_623049_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|623561_624323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001224569.1|624505_625396_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|625396_628369_-	phage receptor	NA	NA	NA	NA	NA
WP_000383942.1|628355_630593_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|630861_631998_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	851545	882991	5347911	capsid,holin,head,tail,integrase,transposase	Enterobacteria_phage(58.82%)	39	846138:846154	875307:875323
846138:846154	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|851545_852622_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000075132.1|852635_853133_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411800.1|853132_853339_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_086893270.1|853786_855637_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000499454.1|855935_856094_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|856179_856923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|857107_857797_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|857811_857934_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|858273_859233_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|859444_859633_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|859629_859992_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|859988_860279_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|860271_860484_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|860476_860653_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|860652_861012_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|861014_861191_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_085948178.1|861297_862510_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254039.1|863135_864641_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|864677_865025_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|865082_866111_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|866162_866537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|866529_866883_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|866897_867473_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|867469_867865_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|867872_868625_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|868638_869070_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|869096_869510_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082361.1|869490_872070_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847298.1|872066_872396_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001426561.1|872395_873094_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_001444516.1|873104_873848_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_072147834.1|873793_874423_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514984.1|874663_878140_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
875307:875323	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|878207_878807_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|878871_880185_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|880186_880456_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|880561_881443_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369640.1|881659_882496_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	1.9e-151
WP_021351651.1|882619_882991_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
>prophage 4
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	1095286	1135404	5347911	protease,transposase,holin,lysis	Escherichia_phage(30.77%)	52	NA	NA
WP_000156528.1|1095286_1097047_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1097232_1097685_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1097760_1098801_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1099157_1099667_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1099939_1100515_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1100477_1102640_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1102649_1103096_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1103218_1105273_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1105304_1105763_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1105858_1106521_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1106693_1107107_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1107151_1107469_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1107526_1108717_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1108811_1109090_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1109086_1109416_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1109506_1110166_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1111566_1111809_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_086893271.1|1111876_1114348_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
WP_001090200.1|1114440_1114632_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1114628_1114817_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1115348_1115723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1115734_1115887_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1116159_1116876_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1116925_1117141_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1117137_1117563_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1117634_1118705_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1118745_1119168_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1119164_1119461_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1119457_1119919_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1119896_1120253_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1120303_1120516_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1120601_1120766_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1120767_1121031_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1121041_1121911_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1122026_1122131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1122319_1122532_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1122699_1122960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1122979_1124029_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1124041_1124413_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1124402_1124774_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1124925_1125744_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1126030_1126228_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1126365_1127079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1127846_1129697_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1130144_1130351_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1130606_1130879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003123.1|1131038_1131572_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|1131792_1131906_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_021351510.1|1131907_1132201_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	92.8	2.3e-40
WP_085948178.1|1132240_1133454_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_086893272.1|1133540_1134575_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1135020_1135404_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	1349956	1419575	5347911	capsid,holin,transposase,head,tail,integrase,tRNA,terminase	Stx2-converting_phage(39.62%)	78	1364830:1364846	1406314:1406330
WP_021351694.1|1349956_1350127_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.9	4.5e-12
WP_012817871.1|1350294_1350567_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1350568_1351624_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1351624_1351990_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1351998_1352529_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1352770_1352968_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1353118_1354177_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_086893273.1|1354973_1355879_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.6	2.3e-171
WP_085948269.1|1355885_1357098_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_000411802.1|1358532_1358739_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1358743_1359088_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1359138_1359672_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_085948178.1|1359915_1361129_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_086893274.1|1361255_1361819_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-97
WP_085948178.1|1361821_1363035_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000539792.1|1363137_1363284_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1363511_1363697_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1364121_1364349_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1364390_1364756_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
1364830:1364846	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958415.1|1365045_1365609_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1365605_1367267_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_086893275.1|1367330_1369268_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1369312_1369534_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1372222_1372549_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1372558_1372909_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1372905_1373352_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1373348_1373693_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1373759_1374476_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1374481_1374856_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1374951_1375161_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1375212_1378455_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1378447_1378789_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1378788_1379487_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1379503_1379824_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1379931_1380105_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1381152_1381890_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_157420851.1|1381835_1382468_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	7.6e-105
WP_086893277.1|1382706_1386186_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.5	0.0e+00
WP_001230462.1|1386252_1386852_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	5.2e-111
WP_086893301.1|1386916_1388239_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	1.8e-76
WP_001023356.1|1388240_1388510_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1388616_1388706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1388725_1391074_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1391664_1395066_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_000145590.1|1395234_1395813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1395835_1395961_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1396040_1396316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1396376_1397738_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1398101_1398965_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1398948_1400085_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1400334_1401564_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1401709_1402831_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|1403079_1404309_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1404673_1404862_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1404911_1405238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1405362_1405536_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1405666_1405864_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1405856_1406069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551672.1|1406058_1406298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1406290_1406524_+	hypothetical protein	NA	NA	NA	NA	NA
1406314:1406330	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204985.1|1406516_1406750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1406755_1407055_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1407051_1408452_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|1408652_1408904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1408900_1409311_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233303.1|1409321_1409594_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1409720_1409945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796963.1|1410196_1410403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1410402_1411458_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1411470_1411806_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224606.1|1411818_1412232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1412437_1412980_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1413235_1413517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1414118_1415579_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1415578_1416250_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1416417_1417788_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1417791_1418433_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1418468_1419575_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	1520741	1544892	5347911	holin,tail	Escherichia_phage(35.48%)	32	NA	NA
WP_000268365.1|1520741_1521290_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_000075578.1|1523095_1523632_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1523664_1523946_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1523942_1524239_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1524235_1524697_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403787.1|1524674_1525022_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.4	2.1e-56
WP_000137950.1|1525126_1525498_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1525494_1525848_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1526053_1526353_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1526358_1526616_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1526751_1527030_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1527031_1528081_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1528093_1528468_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1528464_1529286_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917750.1|1529512_1529710_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935545.1|1529860_1530919_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	96.9	2.7e-203
WP_086893278.1|1531513_1533460_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.2	0.0e+00
WP_000143458.1|1533597_1533777_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1533817_1534063_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1534140_1534356_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087730.1|1534360_1534894_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_086201924.1|1535165_1535735_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	1.2e-104
WP_100223600.1|1535759_1536842_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	96.1	2.4e-183
WP_001230469.1|1536909_1537509_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	5.7e-110
WP_000268904.1|1537573_1538689_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	93.3	3.9e-80
WP_001023452.1|1538690_1538960_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1539100_1539976_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|1540200_1540851_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1541446_1541761_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1541820_1543104_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1543192_1544653_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1544688_1544892_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	1830418	1927642	5347911	protease,integrase,transposase,tail	Escherichia_phage(27.08%)	103	1862904:1862919	1931506:1931521
WP_000422045.1|1830418_1831468_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1831687_1832446_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1832442_1833033_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1833072_1833945_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1834045_1834666_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1834662_1835544_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1835681_1835726_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1835817_1837380_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1837379_1838975_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|1838978_1840337_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|1840348_1841542_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1841541_1842348_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1842728_1842908_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1842993_1843494_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1843539_1844046_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|1845082_1845673_-	protein kinase	NA	NA	NA	NA	NA
WP_001023407.1|1846808_1847078_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_086893279.1|1847079_1848393_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	3.3e-78
WP_001230428.1|1848457_1849057_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_157420845.1|1849124_1850078_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	93.1	2.1e-154
WP_085948178.1|1850133_1851346_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001059384.1|1854945_1855635_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1855631_1855997_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1855997_1857053_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|1857054_1857333_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1857402_1857660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1857880_1858093_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1858371_1859130_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1859828_1859993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1859989_1860724_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001302276.1|1860757_1861180_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000705622.1|1862223_1862775_-	hypothetical protein	NA	NA	NA	NA	NA
1862904:1862919	attL	GCAACGCTTGCCAGCC	NA	NA	NA	NA
WP_000787428.1|1863061_1863469_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1863733_1864033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1864105_1864324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1864346_1864754_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1864731_1864965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1864958_1865126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1865525_1865714_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1865710_1865899_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_086893281.1|1865994_1868466_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1868530_1868779_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1868756_1869887_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000737224.1|1869932_1870571_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028531.1|1870927_1871671_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|1871700_1872240_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|1872344_1872743_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|1872782_1873502_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_001261192.1|1873592_1873946_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001144878.1|1876451_1877042_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1877225_1877873_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1878009_1878156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1878583_1878862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1880029_1880599_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1880664_1881576_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1881682_1881805_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023476.1|1882919_1883189_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_086893282.1|1883190_1884243_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	85.3	1.8e-79
WP_001228290.1|1884394_1884994_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000514703.1|1885061_1888535_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_096860308.1|1888877_1889510_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1889455_1890199_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1890204_1890903_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1890902_1891244_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369428.1|1891236_1892679_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000091308.1|1892697_1893063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1893062_1894250_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001344632.1|1896499_1896631_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_001064906.1|1897057_1897747_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_000054483.1|1898118_1899084_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000387475.1|1899064_1899316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1899408_1900621_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000476993.1|1900882_1901110_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1901187_1901595_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1901787_1901940_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1901951_1902317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1902285_1902573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1902988_1903177_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1903173_1903365_+	YebW family protein	NA	NA	NA	NA	NA
WP_000048302.1|1903458_1905930_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|1906017_1906254_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1906288_1907569_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1907588_1907699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1907756_1908776_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1908787_1910002_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1910207_1910534_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1910668_1911010_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1911044_1911605_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1911607_1912318_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1912425_1912731_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1912929_1915356_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1915416_1917840_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1917850_1918468_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1918469_1919324_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1919366_1919981_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|1920139_1921432_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1921384_1922080_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1922204_1923425_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019545.1|1923559_1924453_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1924559_1925813_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|1926209_1926545_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1926637_1926721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|1926820_1927642_+|protease	serine protease	protease	NA	NA	NA	NA
1931506:1931521	attR	GCAACGCTTGCCAGCC	NA	NA	NA	NA
>prophage 8
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	2002758	2086661	5347911	capsid,holin,transposase,head,portal,tail,plate,integrase,tRNA,terminase	Enterobacteria_phage(67.44%)	82	2047525:2047549	2079302:2079326
WP_085948178.1|2002758_2003972_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001070230.1|2006164_2006791_-	ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000528342.1|2007246_2007456_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_001295403.1|2008012_2009425_+	pyruvate kinase I	NA	NA	NA	NA	NA
WP_000648420.1|2009735_2009972_+	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_000817104.1|2010035_2011040_-	L,D-transpeptidase LdtE	NA	NA	NA	NA	NA
WP_001196530.1|2011188_2011605_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_000144575.1|2011617_2012838_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|2012834_2014106_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|2014080_2014827_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|2014836_2016324_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2016332_2016701_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001296104.1|2017248_2017437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637982.1|2017536_2017947_-	1,4-dihydroxy-2-naphthoyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_000612968.1|2017943_2021000_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000248645.1|2021388_2022501_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_001299124.1|2022929_2023286_+	YdiL family protein	NA	NA	NA	NA	NA
WP_000795566.1|2023385_2024600_+	MFS transporter	NA	NA	NA	NA	NA
WP_001297389.1|2024826_2026092_+	MFS transporter	NA	NA	NA	NA	NA
WP_000383460.1|2026103_2026970_+	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000860176.1|2027000_2027759_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000347854.1|2029510_2030662_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284799.1|2030704_2031616_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000692133.1|2031931_2032696_+	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_000080700.1|2032715_2033654_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_001287818.1|2033709_2034999_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000081071.1|2034995_2035289_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000553696.1|2035291_2036992_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|2037048_2039427_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2039759_2040593_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|2040749_2041796_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2041927_2042119_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175600.1|2042122_2043559_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|2043621_2044335_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|2044580_2045045_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|2045122_2045872_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154176.1|2045871_2046423_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2046485_2047466_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2047525:2047549	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000550059.1|2047655_2048027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077633861.1|2048060_2048672_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	48.8	5.5e-52
WP_001382139.1|2048784_2049003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288335.1|2048999_2051840_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686506.1|2051916_2052876_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2052880_2053192_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000236489.1|2054388_2054913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2054927_2055974_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2055973_2057725_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2057880_2058717_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2058740_2059793_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2059838_2060639_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2060741_2061236_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2061235_2061436_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2061438_2061762_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2061758_2062151_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2062147_2062555_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2062692_2063160_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2063152_2063788_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2063784_2064366_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2064362_2064713_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2064716_2065613_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071741.1|2065605_2066136_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.5e-93
WP_001098696.1|2066138_2068271_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	67.1	5.0e-132
WP_000144026.1|2068270_2068849_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2068892_2069465_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2069621_2070110_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2070122_2072930_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2072916_2073072_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2073080_2073455_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2073510_2074023_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2074022_2075207_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2075364_2076474_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2076699_2078202_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2078445_2078706_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2078896_2079037_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2079343_2079643_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2079302:2079326	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672378.1|2079647_2082035_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2082049_2083033_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2083316_2083361_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2083483_2083840_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2083892_2084090_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2084186_2084729_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2084732_2086661_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 9
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	2148665	2257150	5347911	capsid,holin,terminase,protease,head,tail,integrase,tRNA,transposase	Escherichia_phage(32.81%)	119	2215172:2215188	2255132:2255148
WP_000138052.1|2148665_2149169_+|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000999630.1|2149169_2149274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460707.1|2149443_2149890_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000972250.1|2149846_2150668_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000128477.1|2150764_2151946_+	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_001297652.1|2152000_2152348_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000691903.1|2152369_2152624_-	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_001283455.1|2152806_2153832_+	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_001219350.1|2153864_2153963_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|2153965_2154040_+	protein YoaJ	NA	NA	NA	NA	NA
WP_000512153.1|2154098_2154347_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000826412.1|2154574_2155783_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_001349736.1|2155790_2156753_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_000457202.1|2156961_2157600_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|2157726_2158650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|2158752_2159838_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|2160088_2161699_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067822.1|2161730_2162855_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001286997.1|2162910_2163876_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001323996.1|2163929_2165045_-	ribonuclease D	NA	NA	NA	NA	NA
WP_001344701.1|2165126_2166812_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.4e-35
WP_000290576.1|2167016_2167598_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220987.1|2167637_2168333_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2168390_2170301_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2170432_2170777_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2171139_2171499_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2171618_2171798_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2171871_2173233_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456712.1|2173236_2173815_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|2173998_2175363_+	L-serine dehydratase 1	NA	NA	NA	NA	NA
WP_001344702.1|2175493_2177092_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|2177095_2178652_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|2179114_2180086_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2180148_2180949_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2180961_2181813_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156265.1|2181867_2182326_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2182754_2183321_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|2183317_2184127_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2184292_2184502_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2184514_2184658_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|2185326_2185614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714552.1|2185688_2185832_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|2185990_2186230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|2186372_2187164_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001344704.1|2187340_2188714_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2188759_2189641_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2189832_2191881_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2191900_2192599_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2192695_2193193_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|2193322_2194606_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|2194574_2197208_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001369706.1|2197287_2198727_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2198844_2199081_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2199185_2199377_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2199377_2200034_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_085948178.1|2200949_2202163_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_122988840.1|2203307_2203385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|2203495_2203765_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_021824160.1|2203766_2205080_-|tail	tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.7	1.1e-78
WP_001230553.1|2205144_2205744_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	3.3e-110
WP_086893283.1|2205814_2209312_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.6	0.0e+00
WP_123006618.1|2209547_2210180_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	2.5e-103
WP_086893284.1|2210125_2210869_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	1.0e-145
WP_062863825.1|2210879_2211578_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	3.6e-132
WP_000807964.1|2211577_2211919_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_086893285.1|2211911_2215154_-|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	98.4	0.0e+00
2215172:2215188	attL	TAAAAAAACCGCCTCAG	NA	NA	NA	NA
WP_001513217.1|2215201_2215411_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710962.1|2215506_2215881_-|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_021351560.1|2215895_2216612_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	1.8e-126
WP_000133388.1|2216678_2217023_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2217019_2217466_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007911.1|2217462_2217813_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000126000.1|2217822_2218149_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	2.7e-53
WP_001063025.1|2220675_2220897_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_021351655.1|2220941_2222879_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_021351656.1|2222942_2224604_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.3	0.0e+00
WP_000958366.1|2224600_2225164_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000279796.1|2225452_2225818_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001369651.1|2225859_2226084_+	YlcI/YnfO family protein	NA	A0A0P0ZCG8	Stx2-converting_phage	76.1	2.3e-19
WP_001302717.1|2226165_2226480_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|2226679_2227892_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001208680.1|2228318_2228504_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992108.1|2229021_2229555_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	6.2e-100
WP_000731236.1|2229605_2229950_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|2229954_2230161_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_060552899.1|2230608_2232459_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000301785.1|2233250_2233964_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369585.1|2234098_2234296_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_000211416.1|2234538_2235120_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|2235393_2235948_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228038.1|2235944_2236235_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940300.1|2236234_2236834_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	89.9	4.4e-102
WP_085960004.1|2236905_2237157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369586.1|2237392_2237530_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000200358.1|2238069_2238843_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000426669.1|2238963_2239359_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	98.5	4.4e-66
WP_001369587.1|2239735_2240245_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	81.3	3.7e-49
WP_001289349.1|2240758_2241706_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.1	1.2e-178
WP_000004203.1|2242198_2242672_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.1e-66
WP_001151127.1|2242668_2243091_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	8.8e-65
WP_000450877.1|2243106_2243877_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	6.3e-85
WP_000788938.1|2243902_2244643_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|2244649_2245612_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2245634_2246060_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2246043_2246367_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2246491_2246968_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379547.1|2247285_2247438_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560219.1|2247858_2248080_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_000358365.1|2248079_2248250_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_000102202.1|2248701_2251851_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	74.2	0.0e+00
WP_001004413.1|2251862_2252915_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_010989194.1|2252978_2253173_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_024177035.1|2253165_2253354_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.7	3.9e-17
WP_005127484.1|2253460_2253742_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_001189085.1|2253707_2254784_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_000976491.1|2255176_2255518_-	YebY family protein	NA	NA	NA	NA	NA
2255132:2255148	attR	CTGAGGCGGTTTTTTTA	NA	NA	NA	NA
WP_000879274.1|2255530_2256403_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2256406_2256781_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2256919_2257150_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 10
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	2359548	2448981	5347911	capsid,holin,terminase,head,portal,tail,integrase,transposase	Escherichia_phage(32.81%)	105	2390302:2390319	2449651:2449668
WP_000826461.1|2359548_2360757_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000879833.1|2362148_2362946_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2362955_2363507_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2363675_2364008_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2364341_2364656_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994453.1|2364870_2366529_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2366521_2367517_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2367509_2368196_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2368195_2369569_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2369587_2370031_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620091.1|2370027_2371155_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2371259_2371724_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2371728_2372733_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2372729_2373143_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2373145_2373511_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2373510_2374248_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2374257_2374527_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2374534_2375320_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2375609_2376233_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2376276_2376519_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2376627_2376855_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2377152_2377968_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2377964_2379659_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2379829_2380012_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2380090_2381008_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2381180_2382101_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2382089_2382560_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2382540_2383959_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2384025_2384721_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2384760_2385126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2385691_2386855_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|2387445_2388297_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2388404_2389763_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001339045.1|2389762_2390434_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
2390302:2390319	attL	AATCATCCTTCAGCGCAA	NA	NA	NA	NA
WP_000920136.1|2390566_2390980_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2391088_2392093_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2392093_2392729_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_122993428.1|2392964_2393636_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079060.1|2393978_2394509_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2395743_2396757_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2397162_2397432_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_086893287.1|2397433_2398747_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	8.2e-77
WP_001230459.1|2398811_2399411_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_086893288.1|2399478_2402955_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.1	0.0e+00
WP_063075060.1|2403195_2403825_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_001444516.1|2403770_2404514_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|2404524_2405223_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|2405222_2405552_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2408140_2408554_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2408580_2409003_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2409016_2409769_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2409776_2410172_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2410168_2410702_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2410717_2411071_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2411063_2411447_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2411498_2412527_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2412584_2412932_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253978.1|2412968_2414474_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2414463_2416056_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2416052_2416259_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2416242_2418171_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2418142_2418649_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2419075_2419300_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2419381_2419696_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2420221_2420407_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2420924_2421458_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|2422020_2422236_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2422312_2422585_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2422625_2422805_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000023158.1|2422942_2424880_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_153244796.1|2424865_2425009_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|2425358_2425790_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2425877_2426303_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2426299_2426650_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2426680_2428294_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2428779_2429493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2429627_2429825_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2430048_2430603_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2430611_2430971_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2430983_2432033_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2432034_2432307_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2432428_2432773_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2432892_2433105_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2433338_2433896_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2433897_2434116_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2434243_2434555_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2434547_2434775_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2434771_2435053_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2435085_2435802_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2435823_2436570_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_021351762.1|2436576_2437647_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
WP_000693883.1|2437718_2438144_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2438127_2438409_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2438508_2438928_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2439193_2439346_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2439357_2439996_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2439996_2440206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2440776_2440965_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2440961_2441153_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_086893289.1|2441245_2443717_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_000096346.1|2443775_2443979_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|2444194_2445408_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000142672.1|2445472_2446318_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	64.6	5.1e-96
WP_001300307.1|2446553_2447351_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2447706_2448981_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2449651:2449668	attR	TTGCGCTGAAGGATGATT	NA	NA	NA	NA
>prophage 11
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	2698156	2757801	5347911	holin,protease,integrase,lysis,transposase	Escherichia_phage(17.86%)	46	2710556:2710591	2740517:2740552
WP_000849214.1|2698156_2698645_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2698793_2700440_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2700657_2702301_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2702376_2703027_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2703026_2704091_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2704164_2705220_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2705331_2706423_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2707161_2709834_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2709850_2710501_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2710556:2710591	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2710700_2713550_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2713824_2714601_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2714605_2716255_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_134793277.1|2716255_2720650_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2721451_2722774_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_157420846.1|2723569_2724001_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	41.1	2.5e-22
WP_000881319.1|2723961_2724606_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	88.6	4.0e-85
WP_000092247.1|2724755_2725193_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2725189_2725687_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2725686_2725902_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2726044_2726443_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2726523_2726682_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_032336818.1|2726767_2727175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2727229_2728442_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_021351585.1|2728482_2729067_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.9	3.2e-89
WP_001108084.1|2729041_2729608_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2730137_2731070_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2731108_2731936_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2732439_2732622_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2732778_2733123_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2733228_2733447_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2733424_2734495_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2734489_2735116_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2735112_2736801_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2736949_2739577_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|2739723_2740446_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001345213.1|2740573_2744308_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.6e-19
2740517:2740552	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001075177.1|2745003_2747289_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|2747377_2748508_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000179250.1|2748507_2748762_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2748815_2749466_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|2749928_2751005_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000948732.1|2751009_2752368_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000857257.1|2752640_2754269_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_001209922.1|2754258_2755518_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_001000358.1|2755514_2756705_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_000140560.1|2756898_2757801_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.3e-68
>prophage 12
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	2816074	2957878	5347911	capsid,holin,terminase,head,portal,tail,plate,integrase,tRNA,transposase	Escherichia_phage(48.21%)	154	2834403:2834462	2954198:2955510
WP_000156114.1|2816074_2816965_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_085960005.1|2817048_2818262_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001293612.1|2818474_2819248_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|2819255_2819972_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|2819968_2820655_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|2820744_2821527_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|2821747_2822530_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825710.1|2822795_2823365_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|2823459_2824977_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|2825013_2825502_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000157015.1|2825760_2826423_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584575.1|2826412_2827681_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|2827750_2828665_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364331.1|2828820_2829480_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283576.1|2829562_2830375_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2830374_2831388_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|2831453_2832611_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023402.1|2832769_2833774_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|2833870_2834191_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_157420847.1|2834329_2834482_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.5e-06
2834403:2834462	attL	ATCTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATC	NA	NA	NA	NA
WP_085948178.1|2834447_2835661_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071533448.1|2835659_2835905_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	51.4	4.1e-14
WP_000200503.1|2835911_2836118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|2836370_2836712_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158971.1|2836722_2837010_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|2837021_2837264_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2837260_2837374_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2837459_2837663_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2837659_2837905_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274220.1|2837901_2838201_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_000013441.1|2838523_2838754_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
WP_000599382.1|2838826_2839192_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_157420848.1|2839198_2841964_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.1	0.0e+00
WP_000502620.1|2842144_2843266_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001140704.1|2843289_2845515_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_086893291.1|2846007_2847054_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	9.7e-206
WP_086893292.1|2847053_2848805_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262673.1|2848960_2849797_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055105.1|2849820_2850873_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.3e-194
WP_000632344.1|2850918_2851719_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2851821_2852316_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864903.1|2852315_2852516_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.0e-31
WP_001369625.1|2852518_2852842_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
WP_000072327.1|2852838_2853231_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780553.1|2853227_2853635_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	5.9e-66
WP_000920600.1|2853772_2854240_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	8.4e-85
WP_000356339.1|2854232_2854868_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_157420849.1|2854864_2855446_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	1.7e-103
WP_024182996.1|2855442_2855793_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.6e-59
WP_001111924.1|2855796_2856693_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_000071722.1|2856685_2857216_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.5e-93
WP_021824225.1|2857218_2859321_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	62.3	1.1e-211
WP_000972162.1|2859323_2859857_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	7.1e-96
WP_000972108.1|2859885_2860413_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	93.1	6.4e-89
WP_001426703.1|2860414_2861548_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	62.7	4.8e-65
WP_000905062.1|2861733_2862333_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.3	1.8e-95
WP_000979945.1|2862359_2862848_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853413.1|2862860_2865668_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|2865654_2865810_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2865818_2866193_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2866248_2866761_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005389.1|2866760_2867945_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	2.1e-225
WP_000132830.1|2868102_2869212_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|2869254_2869515_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078910.1|2869705_2869846_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	1.0e-17
WP_001173929.1|2870107_2870440_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000794123.1|2870444_2871338_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615813.1|2871605_2872601_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2872597_2873776_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2874059_2875280_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|2875438_2877445_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2877565_2877844_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2877877_2878426_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2878425_2879235_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2879234_2880059_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918465.1|2880062_2881148_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2881182_2882115_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2882280_2882832_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2882904_2883756_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2883757_2884297_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2884293_2884782_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2884778_2885288_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|2885303_2886056_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001369536.1|2886075_2888721_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2888802_2889366_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2890049_2890535_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2890737_2892882_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2892881_2894192_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2894371_2894656_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2895027_2896368_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2896734_2897793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2897974_2898730_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2899023_2899956_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331687.1|2900177_2908559_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	99.8	0.0e+00
WP_085948178.1|2908674_2909887_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001367376.1|2910352_2910814_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140442.1|2910863_2911253_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|2911308_2912523_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|2912546_2913554_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787520.1|2913711_2915856_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143991.1|2915855_2917562_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_001086077.1|2917542_2918349_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.6	3.8e-133
WP_001301714.1|2918404_2918608_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|2918757_2919051_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_122995391.1|2919141_2919327_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	100.0	4.9e-28
WP_000455406.1|2919554_2919704_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001369534.1|2919703_2920246_-	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_001080433.1|2920560_2921094_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_000284510.1|2921098_2921314_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290231.1|2921390_2921663_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2921703_2921883_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_086893293.1|2922019_2923957_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.5	0.0e+00
WP_000738068.1|2924442_2924712_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2924723_2925683_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2926065_2926218_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|2926466_2926901_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2926893_2927088_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2927084_2927648_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2927655_2928105_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|2928104_2929076_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|2929065_2930586_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|2930579_2930957_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|2931123_2931318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|2931488_2931692_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|2931787_2932501_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939559.1|2932595_2934065_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.8	1.0e-285
WP_001064714.1|2934061_2935015_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_001426810.1|2935769_2936414_+	Rha family transcriptional regulator	NA	A0A0H4IQ68	Shigella_phage	81.4	2.3e-93
WP_001369605.1|2936670_2937345_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000917252.1|2937415_2937628_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_024177061.1|2937699_2937921_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000995345.1|2937941_2938223_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_085948178.1|2938388_2939601_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000638209.1|2939585_2940503_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.3e-161
WP_000187063.1|2940499_2941189_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|2941188_2941776_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|2941850_2942198_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2942261_2943083_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|2943159_2943555_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_085948178.1|2944158_2945372_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000034212.1|2945740_2946148_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|2946149_2946341_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206800.1|2946343_2947240_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	99.7	2.1e-172
WP_000203834.1|2947595_2948234_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_000809302.1|2948289_2948721_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163447.1|2948717_2949344_+	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	99.5	2.3e-122
WP_001291843.1|2949303_2949516_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994798.1|2949551_2949959_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
WP_021351637.1|2950102_2950336_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|2950323_2950575_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000405131.1|2950635_2950818_+	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_001218303.1|2950801_2951971_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	99.7	2.2e-230
WP_085948178.1|2952998_2954211_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000194515.1|2956444_2957878_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2954198:2955510	attR	GATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGATATGACACAAAGTGGAACCTCAATAGCATGTAACAGCTTCACTAATGAAATAATCCAGGGGTTAACGAACAGCGCGCAGGAAAGGATACGCAACGCCATAATCACAACACCGATAAGTAATGCATTTTTTGGCCCTACCCGATTCACAAAGAAAGGAATAATCGCCATGCATAGCGCTTCGAGTACCACCTGGAATGAGTTGAGATAACCATACAGGCGCGTTCCTACATCGTGTGATTCGAATAAACCTGCATAAAAGACAGGAAAAAGTTGTTGATCAAAAATGTTATAGAAAGACCACGTCCCCACAATAAATATGACGAAAACCCAGAAGTTTCGATCCTTGAAAACTGCGATAAAATCCTCTTTTTTTACCCCTCCCGCATCCGCCGCTACGCACTGGTGATCCTTATCTTTAAAACACATGTTGATCATCATAAATACAGCGCCAAATAGCGAGACCAACCAGAAGTTGATATGGGGACTGATACTAAAAAATATGCCGGCAAAGAACGCGCCAATAGCATAGCCAAAAGATCCCCAGGCGCGCGCTGTTCCATATTCGAAATGAAAATTTCGCGCCATTTTTTCGGTGAAGCTGTCAAGCAAACCGCATCCCGCCAGATACCCCAGGCCAAAAAAGAGCGCCCCCAGAATTAGACCTACAGAAAAATTGCTTTGCAGTAACGGTTCATAAACGTAAATCATAAACGGTCCGGTCAAGACCAGGATGAAACTCATACACCAGATGAGCGGTTTCTTCAGACCGAGTTTATCCTGAACGATGCCGTAGAACATCATAAATAGAATGCTGGTAAACTGGTTGACCGAATAAAGTGTACCTAATTCCGTCCCTGTCAACCCTAGATGTCCTTTCAGCCAAATAGCGTATAACGACCACCACAGCGACCAGGAAATAAAAAAGAGAAATGAGTAACTGGATGCAAAACGATAGTACGCATTTCTGAATGGAATATTCAGTGCCATAATTACCTACCTGTCGTTAAAAAATTCACGTCCTATTTAGAGATAAGAGCGACTTCGCCGTTTACTTCTCACTATTCCAGTTCTTGTCGACATGGCAGCGCTGTCATTGCCCCTTTCGCCGTTACTGCAAGCGCTCCGCAACGTTGAGCGAGATCGATAATTCGTCGCATTTCTCTCTCATCTGTAGATAATCCCGTAGAGGACAGACCTGTGAGTAACCCGGCAACGAACGCATCTCCCGCCCCCGTGCTATCGACACAATTCACA	NA	NA	NA	NA
>prophage 13
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	3182968	3261335	5347911	holin,protease,portal,tail,tRNA,terminase	Enterobacteria_phage(60.0%)	78	NA	NA
WP_001298974.1|3182968_3183706_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3183837_3185172_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3185381_3186263_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3186365_3186953_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627806.1|3187008_3187392_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	71.0	4.0e-32
WP_001262716.1|3187695_3188385_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3188432_3189470_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3189676_3190096_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3190164_3190863_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3190894_3193555_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3193668_3195024_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3195069_3195393_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3195389_3196688_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3202540_3205114_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3205243_3205975_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3205971_3206952_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3207086_3207824_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3208094_3208436_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3208539_3208587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3208685_3209846_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3209888_3211010_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3211020_3212091_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3212300_3212666_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3212815_3213334_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969032.1|3213323_3214550_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3214565_3215048_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3215124_3215472_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3215513_3216281_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3216311_3216860_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3216878_3217127_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3217375_3218737_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3218903_3219695_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3219715_3221002_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3221056_3221650_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3221772_3222651_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3222736_3224398_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3224546_3224888_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3224949_3225240_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3225229_3225706_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3225837_3226320_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3227168_3227417_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3227784_3228054_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_086893294.1|3228055_3229369_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001230472.1|3229433_3230033_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	3.7e-109
WP_086893288.1|3230099_3233576_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.1	0.0e+00
WP_063075060.1|3233816_3234446_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_001444516.1|3234391_3235135_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|3235145_3235844_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|3235843_3236173_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021351599.1|3236169_3238815_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000532073.1|3238858_3239167_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3239193_3239616_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3239629_3240382_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|3240389_3240788_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|3240800_3241424_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281348.1|3241426_3241708_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3241700_3242027_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001369631.1|3242114_3244094_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_000974563.1|3244083_3245586_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_000102413.1|3245585_3245798_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3245794_3247918_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3247914_3248391_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3248423_3248696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126354079.1|3248907_3249093_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	2.3e-22
WP_000087709.1|3249609_3250143_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	2.5e-101
WP_001072901.1|3250147_3250363_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3250440_3250686_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3250726_3250906_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874265.1|3251043_3252990_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.4	0.0e+00
WP_000752026.1|3253500_3253770_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3253779_3254727_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3255233_3255668_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3255660_3255855_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108036.1|3255851_3256463_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	6.0e-99
WP_000950968.1|3256455_3256632_-	protein ninF	NA	A0A088CPS6	Enterobacteria_phage	98.3	1.3e-25
WP_000448925.1|3257378_3257795_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3257866_3259615_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3259616_3261335_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
>prophage 14
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	3332723	3339863	5347911		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3332723_3335285_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3335390_3336047_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3336097_3336865_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3337060_3337969_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590372.1|3337965_3339228_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	3.2e-134
WP_001278994.1|3339224_3339863_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	4863442	4904733	5347911	protease,head,tail,plate,integrase,transposase	Shigella_phage(53.66%)	61	4858183:4858199	4882588:4882604
4858183:4858199	attL	TGATTGTGAATGCTTAC	NA	NA	NA	NA
WP_001056416.1|4863442_4864027_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|4864194_4864443_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|4864444_4866535_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|4866606_4867539_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|4867541_4867763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4867775_4868030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4868031_4868313_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4868309_4868582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|4868586_4868880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4868891_4869422_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|4869519_4870062_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|4870065_4870599_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|4870598_4871114_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|4871117_4871669_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633439.1|4871665_4871917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4871968_4873181_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001310341.1|4873304_4873655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4873670_4874003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4873995_4874193_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|4874182_4874479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|4874475_4874985_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|4875054_4875480_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4875551_4876052_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4876086_4876515_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4876498_4876717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|4876726_4876954_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4876934_4877243_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4877239_4877530_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4877532_4878114_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|4878113_4879778_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|4879777_4881367_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|4881350_4882682_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
4882588:4882604	attR	TGATTGTGAATGCTTAC	NA	NA	NA	NA
WP_000094808.1|4882803_4883277_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4883453_4884578_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4884577_4885525_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002057.1|4885568_4885955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4885951_4886371_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4886367_4886928_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4886928_4887174_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4887170_4888673_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4888681_4889047_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4889061_4889538_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|4889664_4891740_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|4891726_4893076_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|4893059_4894184_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4894173_4894788_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4894780_4895218_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4895217_4896300_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4896290_4896851_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|4896850_4897762_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|4897796_4898318_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4898397_4898601_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4898822_4899383_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4899482_4901522_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4901668_4901851_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114105.1|4901886_4902132_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4902170_4902635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|4902749_4902950_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|4902903_4903641_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001369689.1|4903729_4903936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130533.1|4903941_4904733_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 16
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	4935869	4980783	5347911	capsid,holin,head,tail,integrase,tRNA,terminase	Stx2-converting_phage(34.09%)	48	4958125:4958138	4983532:4983545
WP_000956557.1|4935869_4936403_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|4936820_4937102_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4937138_4937711_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4937710_4938445_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4938447_4938639_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829412.1|4938691_4939108_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	71.0	2.1e-31
WP_000145671.1|4939252_4939726_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4939722_4940073_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4940063_4940600_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4940727_4941552_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4941617_4941980_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4942683_4943376_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4943473_4943734_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4943726_4944278_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4945790_4946543_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4946852_4947005_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_086893298.1|4947822_4949673_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_000411802.1|4950121_4950328_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4950327_4950825_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4951041_4951227_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4951754_4952069_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001377217.1|4952322_4952853_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_000958398.1|4952968_4953532_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4953528_4955190_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_086893299.1|4955253_4957191_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.6	0.0e+00
WP_001063096.1|4957235_4957457_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
4958125:4958138	attL	CAACTGGGACAGCG	NA	NA	NA	NA
WP_000125988.1|4959820_4960147_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4960156_4960507_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4960503_4960950_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4960946_4961291_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4961357_4962074_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4962079_4962454_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4962549_4962759_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807964.1|4966045_4966387_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001473433.1|4966386_4967085_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_000167715.1|4967090_4967834_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.5	1.6e-141
WP_122996286.1|4967779_4968412_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_086893300.1|4968657_4972134_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_001216290.1|4972202_4972826_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4972890_4974204_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4974205_4974475_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4974635_4975058_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4975187_4976246_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117799.1|4976324_4976975_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	36.6	4.0e-24
WP_001132154.1|4977157_4977748_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4978249_4978498_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|4978559_4979657_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543817.1|4979745_4980783_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4983532:4983545	attR	CGCTGTCCCAGTTG	NA	NA	NA	NA
>prophage 17
NZ_CP021335	Escherichia coli strain 95JB1 chromosome, complete genome	5347911	5120944	5158941	5347911	protease,tRNA,transposase	Vibrio_phage(11.11%)	42	NA	NA
WP_001294195.1|5120944_5122084_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5122082_5123630_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5123601_5124063_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5124081_5125419_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|5125428_5127276_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5127268_5128219_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5128304_5128613_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|5128689_5129970_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5130055_5131315_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5131317_5132322_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5132403_5132601_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527944.1|5132704_5134003_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	1.1e-65
WP_001177639.1|5134207_5134633_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076318.1|5134671_5137032_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001293281.1|5137211_5137943_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|5138069_5138471_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|5138489_5139188_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012546.1|5139238_5139898_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5139915_5140314_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5140323_5140962_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|5140964_5142128_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|5142211_5143837_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5143953_5144229_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5144377_5144707_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569730.1|5144888_5145638_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5145634_5146390_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5146497_5147562_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|5147916_5149314_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5149329_5149635_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|5149644_5150109_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5150122_5150773_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5150782_5151637_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5151636_5152323_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5152451_5152727_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5153053_5153449_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5153455_5153770_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5153774_5154002_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5154043_5154493_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001345309.1|5154563_5155358_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072098057.1|5155797_5156412_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
WP_085948178.1|5157343_5158557_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254202.1|5158650_5158941_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
>prophage 1
NZ_CP021336	Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence	86922	0	86572	86922	terminase,transposase,head,holin,tail,integrase	Escherichia_phage(61.7%)	102	28592:28611	75800:75819
WP_000888906.1|920_1805_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|2138_2531_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|2542_2683_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|2708_3131_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|3170_3959_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|3967_4147_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|4421_4706_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|4698_5604_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_085948178.1|5669_6883_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000896801.1|6955_7684_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|7687_8905_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|8914_9292_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|9438_9684_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|9686_10265_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000095381.1|10331_10487_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000484112.1|10988_11615_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	2.3e-122
WP_001354545.1|11611_12289_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684845.1|12285_12987_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_000107675.1|13288_14551_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	7.8e-234
WP_000021755.1|14623_15130_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000675629.1|15324_16050_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	3.8e-140
WP_024177054.1|16089_16281_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	4.7e-18
WP_000042974.1|16277_16493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071056.1|16485_17130_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.1	4.4e-132
WP_000154831.1|17126_17894_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	98.5	8.8e-31
WP_001369800.1|17890_18379_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.0	4.4e-44
WP_000797279.1|18551_18740_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000951710.1|18741_18951_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_021351680.1|18947_19490_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	74.6	7.3e-72
WP_000516537.1|19572_19806_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_000269003.1|19984_20278_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_000988658.1|20284_20659_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_000057449.1|20640_21573_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_001261544.1|21569_21932_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|22593_22845_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|22968_23358_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|23430_23652_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|23651_24032_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|24036_24216_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648825.1|24243_25287_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
WP_001369802.1|25375_25828_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219604.1|25914_27108_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
WP_000124155.1|27107_28592_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
28592:28611	attL	AATATTTGCTCTAATAAATT	NA	NA	NA	NA
WP_071528000.1|28793_29153_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_021351678.1|29149_30268_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	87.9	1.2e-177
WP_000611662.1|30300_31152_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|31262_31472_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542341.1|32076_32298_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_000481733.1|32317_32713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185180.1|32709_33741_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	98.5	2.7e-192
WP_001224234.1|33791_34103_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_000848372.1|34348_34909_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.4	7.2e-99
WP_001398228.1|35098_35740_+	hypothetical protein	NA	Q71TG2	Escherichia_phage	98.6	6.3e-115
WP_000766013.1|35773_36085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245705.1|36524_36746_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	1.3e-30
WP_021351710.1|36742_37855_+	oxidoreductase	NA	A0A077SLR9	Escherichia_phage	88.7	2.6e-180
WP_000747846.1|37897_38146_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|38142_38583_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_001038175.1|38616_45384_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_000774711.1|45459_47169_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.1	0.0e+00
WP_000132939.1|47161_48181_+|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	9.2e-185
WP_001345478.1|48472_49030_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068865.1|49199_49688_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001376650.1|49885_50563_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000432103.1|50569_51358_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.4	4.8e-141
WP_001165938.1|51387_51702_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	89.4	5.7e-45
WP_000058808.1|51691_54679_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_000175481.1|54691_55057_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	98.3	6.7e-45
WP_000434673.1|55053_56973_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.1	0.0e+00
WP_001345482.1|56974_57577_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|57563_58007_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|58003_58333_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|58223_58598_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_122995369.1|59088_59661_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|59704_60283_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_021351644.1|60282_63132_-|tail	tail protein	tail	Q71TP5	Escherichia_phage	94.6	0.0e+00
WP_001286326.1|63143_63578_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|63656_64493_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|64492_65926_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|65922_66279_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440148.1|66278_69683_-	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	92.8	0.0e+00
WP_000926354.1|69764_70646_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	3.1e-173
WP_000523980.1|70660_71272_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188915.1|71282_71849_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	9.5e-99
WP_071533444.1|71993_72065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555836.1|72124_73018_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	2.6e-26
WP_001057312.1|73069_73546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|73568_73919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|74277_74397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201261.1|74415_74637_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.1e-25
WP_001260613.1|74633_75725_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	79.4	4.6e-158
WP_001187879.1|75889_76690_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	9.2e-148
75800:75819	attR	AATATTTGCTCTAATAAATT	NA	NA	NA	NA
WP_001369580.1|76719_77565_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.9	3.6e-150
WP_001369577.1|77615_77861_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	43.8	1.7e-12
WP_000268408.1|78043_78640_-	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.0	1.2e-107
WP_000509942.1|78812_79322_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	3.9e-91
WP_000035302.1|79333_79915_-	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000041774.1|79950_80766_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085153.1|80775_82365_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.6	3.7e-305
WP_000067713.1|82425_84132_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038866.1|84357_85359_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|85375_86572_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
