The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	1201713	1213367	5594550	integrase	Enterobacteria_phage(70.0%)	13	1189847:1189861	1212904:1212918
1189847:1189861	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1201713_1204047_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1204058_1204379_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1204375_1204603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1204599_1205157_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1205153_1205420_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1205961_1206699_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1206695_1206941_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1206958_1207525_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|1208093_1208519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1208518_1209469_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1209456_1210647_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1210999_1212253_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1212263_1213367_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1212904:1212918	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	1422922	1468197	5594550	integrase,head,lysis,tRNA	Escherichia_phage(26.42%)	63	1425805:1425851	1474939:1474985
WP_004143010.1|1422922_1424308_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1424353_1424566_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1424567_1425434_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1425805:1425851	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1425864_1427028_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1426904_1427240_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1427241_1427457_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1427458_1427677_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1427673_1428441_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1428437_1429094_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1429090_1429249_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1429245_1429926_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1429922_1430768_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1430783_1431068_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1431156_1431351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1431450_1431666_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1432016_1432706_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1432833_1433067_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1433107_1433329_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|1433553_1434453_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|1434442_1435873_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|1435872_1436166_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1436162_1436669_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1436775_1437618_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|1437790_1438438_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1438938_1439394_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1439393_1439564_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1439556_1440192_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1440188_1440326_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1440318_1440849_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1440845_1441535_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1442444_1442693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|1442695_1443226_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1443222_1443687_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1443792_1444122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1444492_1445095_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1445094_1446567_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1446579_1448001_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1447975_1448980_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1449021_1449498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1449570_1450956_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1450959_1451388_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1451399_1452494_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1452504_1452744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1452746_1453127_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1453126_1453300_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1453299_1453662_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1453664_1454090_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1454086_1454479_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1454547_1455300_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1455352_1456030_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1456205_1456961_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1456963_1457218_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1457511_1457982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1457998_1458358_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1458457_1458628_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1458617_1459331_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1459396_1460182_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1460309_1460813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1460905_1464352_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|1464451_1464871_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|1464870_1465341_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1465337_1465733_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1465719_1468197_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
1474939:1474985	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	1913305	1950641	5594550	tail,plate,lysis,capsid,head,integrase,portal,terminase	Salmonella_phage(84.62%)	46	1913213:1913231	1950713:1950731
1913213:1913231	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1913305_1914358_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|1914776_1916261_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1916359_1917304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1917315_1918194_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1918339_1918561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1918593_1919103_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1919110_1919311_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1919274_1919616_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1919683_1919917_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1919916_1920144_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1920140_1920998_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1920994_1923409_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1923562_1923751_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1923761_1923995_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1924109_1924787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1925062_1926805_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1926866_1927892_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1927891_1929658_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1929800_1930634_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1930650_1931709_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1931712_1932363_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1932458_1932923_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1932922_1933126_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1933129_1933345_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1933325_1933835_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1933839_1934223_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1934219_1934648_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|1934743_1935175_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1935167_1935614_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1935610_1936303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1936397_1936970_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1936966_1937329_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1937315_1938224_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1938216_1938816_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1938817_1941769_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1941772_1942504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1942500_1942704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1942733_1943810_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1943948_1945121_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1945130_1945646_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1945698_1945998_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1946012_1946132_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1946124_1948752_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1948748_1949234_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1949230_1950331_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1950422_1950641_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1950713:1950731	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	2382547	2433439	5594550	tail,holin,transposase,integrase,terminase	Klebsiella_phage(23.4%)	61	2374525:2374540	2397364:2397379
2374525:2374540	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004140269.1|2382547_2383357_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2383358_2384351_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2384350_2385241_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|2385417_2386605_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|2386812_2387475_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2387471_2387900_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2387896_2388577_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2388578_2388866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2388862_2389708_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2389723_2390008_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2390096_2390291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2390719_2390923_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2391004_2392081_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|2392226_2392346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|2392368_2393067_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2393178_2393406_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2393446_2393668_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2393753_2394614_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2394610_2395459_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2395455_2395758_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2395813_2396059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2396266_2397295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|2397815_2398283_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
2397364:2397379	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004243010.1|2398263_2398431_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2398427_2399096_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2399088_2399727_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2399723_2399864_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2399863_2400553_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|2401202_2401502_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2401498_2402038_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|2402034_2402379_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2402375_2402651_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2403609_2403855_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2404717_2405722_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|2405699_2407007_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|2407006_2408407_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|2408390_2409503_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004217351.1|2410033_2410819_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2410829_2411783_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217348.1|2412104_2412500_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|2412501_2412756_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|2412765_2412999_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2412985_2413369_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|2413370_2413922_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|2413918_2414311_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2414334_2415507_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2415560_2416043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|2416180_2416387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2416463_2416820_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|2417044_2417236_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|2417497_2420395_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|2420478_2420814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2421128_2421593_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2421773_2422256_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2422265_2422646_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2422642_2425711_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|2425787_2428742_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|2428745_2429477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2429701_2430301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2430542_2432486_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2432734_2433439_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	2437704	2446274	5594550	transposase	Escherichia_phage(25.0%)	8	NA	NA
WP_001389365.1|2437704_2438469_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|2438645_2439350_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|2439942_2440365_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|2441262_2442747_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2442826_2443246_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2443247_2444513_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2444588_2445416_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2445602_2446274_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 6
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	2479207	2518979	5594550	terminase,transposase,integrase	uncultured_Caudovirales_phage(35.42%)	57	2477288:2477302	2486228:2486242
2477288:2477302	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2479207_2479969_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2480185_2481718_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2481916_2482465_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2482661_2483843_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2483823_2484066_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2484244_2484724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2484720_2484933_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2484929_2485154_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2485143_2485854_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2485859_2486378_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2486228:2486242	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2486482_2487310_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2487306_2487501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2487497_2487923_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2487919_2488138_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2488109_2488364_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2488356_2488722_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2488891_2489080_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2489072_2489387_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2489557_2490226_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2490323_2490545_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2491121_2492780_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2492781_2493744_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2493740_2494217_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2494213_2494996_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2495401_2495650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2495652_2496183_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2496179_2496569_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2496803_2497124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2497225_2497978_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2497928_2499329_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2499566_2501018_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2501073_2501622_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2501673_2502876_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2502879_2503374_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2503385_2504327_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2504366_2504648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2504616_2505036_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2505032_2505539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2505538_2505925_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2506019_2506460_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2506463_2507609_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2507619_2507910_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2507850_2509043_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2509369_2509795_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2509830_2509983_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2509972_2511976_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2511975_2512575_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2512575_2512878_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2512880_2513903_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2513902_2514244_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2514293_2514476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2514518_2515085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2515138_2515792_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2515793_2516147_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2516146_2517343_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2517339_2518113_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2518112_2518979_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	2747675	2758562	5594550		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2747675_2748296_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2748288_2749554_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2749565_2750468_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2750728_2751490_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2751510_2752371_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2752668_2752929_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2753015_2754104_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2754134_2755400_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2755454_2758562_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	3415412	3458511	5594550	plate,transposase,tRNA	Microcystis_virus(25.0%)	40	NA	NA
WP_002910404.1|3415412_3416669_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3416939_3417551_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|3417547_3418399_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3418582_3419530_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3419654_3421334_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3421334_3422381_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3422603_3422879_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3423151_3423736_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3423853_3424945_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3425027_3425237_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3425438_3426353_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3426484_3427900_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3427919_3428363_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3428365_3428902_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|3428882_3429929_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3429928_3431692_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3431825_3435236_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3435219_3436377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3436380_3436647_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|3436944_3437202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|3437390_3437627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3437750_3438731_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3439067_3439958_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3440133_3441027_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|3441202_3442096_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|3442279_3443173_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3443194_3443500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|3443523_3444633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|3444738_3444969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3445014_3445521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3445517_3445847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3445843_3446026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|3446167_3447091_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|3448741_3449251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3449487_3449994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3449990_3450500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3450500_3451856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|3454819_3456517_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3456520_3457174_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3457170_3458511_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	3863800	3871425	5594550		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3863800_3864802_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3864995_3866162_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3866342_3866897_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3866911_3867802_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3867833_3868703_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3868729_3869794_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3870018_3871425_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 10
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	3907992	3914899	5594550	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3907992_3909471_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3909467_3910190_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3910508_3911870_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|3912115_3913009_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3913251_3914025_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3914035_3914899_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	4243623	4288466	5594550	tail,holin,integrase,terminase	Salmonella_phage(40.43%)	54	4236415:4236429	4285886:4285900
4236415:4236429	attL	GCCGCTTCCGCCACC	NA	NA	NA	NA
WP_004152009.1|4243623_4245492_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|4245711_4246194_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|4246190_4246820_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|4246809_4247115_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|4247101_4247506_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004152705.1|4247790_4248732_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
WP_004152432.1|4250313_4250610_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|4250924_4251614_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|4251699_4252083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|4252225_4254991_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|4254990_4256901_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|4256900_4259732_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|4259742_4260282_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|4260281_4260746_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|4260745_4263244_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|4263243_4263849_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|4263848_4264172_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|4264222_4264564_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|4264574_4265012_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152444.1|4265065_4266052_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152445.1|4266066_4266747_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|4266749_4267046_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|4267042_4268725_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|4268739_4268946_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|4269747_4270059_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|4270125_4271601_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|4271597_4272182_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|4272259_4272517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|4272591_4272930_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|4272929_4273169_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|4273161_4273830_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|4273826_4274039_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|4274209_4274953_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|4274949_4275375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|4275371_4275563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|4275546_4275957_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|4276149_4276497_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|4276616_4277402_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|4277398_4278166_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4278165_4278375_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4278521_4278755_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|4278908_4279490_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164029.1|4279856_4280156_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|4280152_4281052_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|4281061_4282084_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|4282135_4282384_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|4282493_4282787_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|4282779_4282938_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|4282934_4283528_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|4283524_4283707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|4283703_4283895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|4283911_4285162_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|4285354_4286932_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4285886:4285900	attR	GGTGGCGGAAGCGGC	NA	NA	NA	NA
WP_004151980.1|4286999_4288466_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
>prophage 12
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	4359815	4439425	5594550	tail,plate,lysis,coat,capsid,head,integrase,portal,tRNA,terminase	Salmonella_phage(71.43%)	86	4404519:4404565	4441086:4441132
WP_002914079.1|4359815_4360553_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4360684_4362016_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4362061_4362445_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4362758_4363448_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4363505_4364591_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4364794_4365220_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4365289_4365988_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|4366022_4368683_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4368803_4370159_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4370200_4370524_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4370527_4371826_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4377791_4380365_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4380494_4381226_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4381222_4382203_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4382334_4383072_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4383342_4383678_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4383784_4383832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4383932_4385093_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4385089_4385962_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4386024_4387146_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4387155_4388226_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4388568_4389078_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4389070_4390294_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4390307_4390790_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4390798_4392169_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4392225_4392684_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4392803_4393151_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4393190_4393958_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4393989_4394538_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4394556_4394805_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4395064_4396429_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4396592_4397384_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4397403_4398690_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4398809_4399400_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4399524_4400403_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4400489_4402151_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4402298_4402640_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4402706_4402997_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4402986_4403463_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4403573_4404056_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4404519:4404565	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4404659_4405037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4405064_4405283_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4405349_4406444_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4406440_4406926_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4406922_4409553_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4409545_4409665_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4409679_4409979_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4410031_4410547_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4410556_4411729_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4411877_4412951_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4413002_4414121_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4414130_4416080_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4416081_4416753_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4416745_4417654_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4417640_4418003_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4417999_4418572_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4418666_4419533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4419555_4420002_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4419994_4420417_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|4420512_4420941_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4420937_4421321_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4421325_4421835_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4421815_4422031_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4422034_4422238_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4422237_4422702_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4422797_4423451_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4423454_4424507_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4424523_4425357_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4425497_4427261_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4427260_4428304_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4428360_4428630_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4429151_4430153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4430152_4431232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4431218_4431902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4431997_4432231_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4432242_4432431_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4432593_4434978_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4434974_4435826_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4435822_4436050_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4436049_4436283_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4436350_4436689_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4436652_4436853_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4436860_4437370_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4437402_4437645_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4437767_4438397_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4438399_4439425_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4441086:4441132	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP020837	Klebsiella pneumoniae strain BK13043 chromosome, complete genome	5594550	5159953	5208796	5594550	tail,tRNA,capsid,head,portal,protease,terminase	uncultured_Caudovirales_phage(66.67%)	54	NA	NA
WP_002918465.1|5159953_5160448_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|5160451_5161090_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|5161401_5161794_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|5161809_5162238_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|5162503_5163631_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|5163821_5164220_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|5164393_5165761_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|5165848_5166907_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|5167043_5167982_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|5168396_5168867_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|5169242_5169506_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|5169604_5169871_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|5169921_5170197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|5170276_5172244_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|5172249_5173182_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|5173189_5173393_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|5173524_5174454_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|5174489_5175935_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|5176023_5179821_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|5179858_5181328_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|5181330_5181912_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|5181919_5182408_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|5182407_5183400_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|5183470_5184514_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|5184819_5186760_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|5186839_5187031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|5187259_5188261_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|5188260_5188869_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|5189092_5189545_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|5189567_5190035_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|5190045_5191395_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|5191505_5191748_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|5191737_5193189_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|5193200_5194082_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|5194439_5195405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|5195429_5195726_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|5195879_5196071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|5196073_5197735_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|5197718_5198075_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|5198350_5198794_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|5198793_5199093_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|5199089_5199425_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|5199421_5200663_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|5200664_5201225_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|5201276_5202443_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|5202706_5203219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|5203267_5203603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|5203945_5206081_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|5206080_5206446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|5206442_5206811_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|5206807_5207122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|5207114_5207303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|5207295_5207565_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|5208016_5208796_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP020838	Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence	232540	4389	54783	232540	protease,integrase,transposase	Escherichia_phage(31.58%)	45	32960:32973	56562:56575
WP_004152113.1|4389_5352_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020805429.1|5338_5773_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152115.1|6324_6522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664348.1|9428_9977_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|10031_10313_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|10556_10820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|10834_11098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|12299_13280_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|14488_15358_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|15351_16362_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|16370_17198_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|17206_18070_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|18066_18894_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|19749_20454_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|21757_22426_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|22615_23431_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|23581_24286_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|24407_25313_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|25309_26548_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|26547_27132_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|27624_28389_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|28615_28921_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|28931_30137_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|30292_30496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|30623_31463_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|31456_31804_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|31967_32759_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|32764_33055_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
32960:32973	attL	TGAAAACCTGCGCA	NA	NA	NA	NA
WP_001083725.1|33166_33664_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|33808_34822_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|35024_35375_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|35500_36061_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|36063_39030_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|39096_39474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|39674_40334_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_004114613.1|41954_42332_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004152557.1|42328_42676_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|46498_48232_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|48239_49187_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|49231_50836_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|50848_51769_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|51768_52617_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|52613_53207_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|53203_54331_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|54615_54783_-|integrase	integrase	integrase	NA	NA	NA	NA
56562:56575	attR	TGAAAACCTGCGCA	NA	NA	NA	NA
>prophage 2
NZ_CP020838	Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence	232540	152582	215372	232540	integrase,protease,transposase	uncultured_Caudovirales_phage(27.78%)	59	144325:144339	164352:164366
144325:144339	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|152582_153323_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|154466_155414_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|155440_155752_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|155816_156740_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|157412_157670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|158271_159726_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|160708_161986_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|162048_164046_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|165085_166293_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
164352:164366	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|167721_168153_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|168403_169879_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|169871_170552_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|170741_172127_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|172155_172509_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|172622_173915_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|173925_177072_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|177158_177599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|177725_180173_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|180213_180411_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|180444_181182_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|181470_181920_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|182153_183971_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|183970_184867_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|184906_185287_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|185291_186221_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|186275_186956_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|186952_188353_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|188569_189004_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|189235_189415_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|191157_191667_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|191716_192214_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|192545_192872_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|192871_193582_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|193590_194136_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|194211_194574_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|196470_197007_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|197039_197465_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|197477_198767_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|198814_200566_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|200583_200946_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|200995_201346_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|201703_201973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|201960_202536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|202566_203061_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|203104_203473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|203506_203710_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|203758_204016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|204091_204346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|204521_204788_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|204775_205258_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|205469_206816_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|208658_209621_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|209607_210357_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|210594_210792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|210791_213587_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|213701_214271_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|214305_214587_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|214830_215094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|215108_215372_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020839	Klebsiella pneumoniae strain BK13043 plasmid pBK13043-2, complete sequence	57580	12270	22568	57580	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|12270_15288_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|16496_17399_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|17660_18422_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|18442_19303_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|19439_20144_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|20536_20776_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|20862_21525_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|21905_22568_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
