The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	32828	109634	3873214	holin,protease,tRNA,transposase,tail	Microbacterium_phage(14.29%)	60	NA	NA
WP_011000025.1|32828_33128_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011000026.1|33605_34649_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_011000027.1|34826_35867_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011000028.1|35878_36391_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_021155367.1|36413_38819_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011000030.1|38842_39985_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016726767.1|40015_41710_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.6	4.0e-15
WP_011000032.1|42165_43104_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016726768.1|43204_45838_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	24.8	2.8e-15
WP_011000034.1|46068_46458_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016722608.1|46498_47704_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.5	4.2e-27
WP_011000036.1|47721_48894_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	50.0	2.9e-09
WP_011000037.1|49147_49657_+	peptide deformylase	NA	NA	NA	NA	NA
WP_043885530.1|49704_51678_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016726770.1|51723_52707_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	33.6	7.2e-09
WP_020830855.1|52741_53389_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011000041.1|53507_54368_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016726772.1|54458_55784_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_020830856.1|55797_56598_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_019717341.1|56594_59030_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011000045.1|59066_59786_+	response regulator	NA	NA	NA	NA	NA
WP_023469999.1|60162_62550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000047.1|62787_63093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722598.1|63296_64199_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830859.1|64229_65582_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.0	2.6e-17
WP_021155371.1|65578_66424_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_011000051.1|66499_67405_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020830861.1|67408_68698_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.0	1.6e-80
WP_011000053.1|68694_69384_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_016722594.1|69575_70580_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_038938142.1|70741_72694_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	32.9	6.2e-12
WP_011000056.1|72732_73338_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016722592.1|73429_73888_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011000058.1|73896_74727_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_011000059.1|74740_75082_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011000060.1|75148_76573_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.0	3.2e-42
WP_011000061.1|76821_77373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938143.1|77369_77801_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_069079282.1|78167_79619_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_016722588.1|79638_81042_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_016722587.1|81123_81822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885532.1|81892_82798_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_011000068.1|82832_83195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698864.1|83396_84572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|89918_90905_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_157698846.1|91028_91322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726786.1|91327_92146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043897616.1|92469_93294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885665.1|93616_94441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726789.1|94893_95373_-	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	46.7	2.0e-28
WP_021154765.1|95501_96653_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016726790.1|96649_97477_-	thiazole synthase	NA	NA	NA	NA	NA
WP_013213874.1|97486_97714_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_043885666.1|97710_98850_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016726792.1|98863_100759_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_086706197.1|101176_102445_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_086706352.1|102484_107503_-	autotransporter domain-containing protein	NA	G9FH37	Rhodococcus_phage	49.4	4.3e-09
WP_016722569.1|108006_108555_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016722568.1|108564_109098_+|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_011000085.1|109112_109634_+|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
>prophage 2
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	242788	292560	3873214	transposase	Burkholderia_phage(30.0%)	45	NA	NA
WP_016721870.1|242788_243775_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016721735.1|243979_244945_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|244941_245091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|245225_246212_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_043885583.1|246532_248002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023470008.1|248123_248753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885582.1|248809_249073_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_021156078.1|249524_250874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722382.1|251020_251404_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_016722383.1|251423_252503_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011000247.1|252663_253161_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011000246.1|253329_254511_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011000245.1|254618_256445_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_016722384.1|256471_257152_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011000243.1|257784_258966_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011000242.1|258976_259687_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016726280.1|259697_260828_+	butyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011000240.1|260872_261478_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_016726279.1|261502_261928_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_021156076.1|261924_262614_+	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	28.9	2.7e-10
WP_021156075.1|262610_263045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016726276.1|263064_264672_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	66.7	1.5e-19
WP_011000235.1|264692_265619_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011000234.1|265615_266410_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016726274.1|266445_267528_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_021156073.1|268153_270178_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011000231.1|270231_270531_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016722411.1|270538_270934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000229.1|271007_271949_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_011000228.1|271950_272880_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	6.3e-39
WP_028852512.1|272901_273405_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_011000226.1|273421_273688_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_021156072.1|273684_274644_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021156071.1|274761_275199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021156070.1|275458_276385_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016722406.1|276606_277590_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_086706354.1|277795_279337_+	DUF1254 domain-containing protein	NA	M1HNU9	Paramecium_bursaria_Chlorella_virus	23.7	3.1e-19
WP_011000220.1|279367_280225_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_016721735.1|281349_282315_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|282311_282461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706356.1|282982_289711_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_016722402.1|289892_290072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|290327_291314_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_155738951.1|291448_291598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|291594_292560_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
>prophage 3
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	896825	959998	3873214	capsid,terminase,head,portal,transposase	Acidithiobacillus_phage(48.0%)	62	NA	NA
WP_020831479.1|896825_897650_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003086.1|897707_898244_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_063612226.1|898577_898979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|899233_900199_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|900195_900345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003084.1|900537_900762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047856.1|900828_901119_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	7.0e-13
WP_011003082.1|901115_901598_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
WP_038938203.1|901584_902067_+	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	2.8e-22
WP_011003080.1|902063_902525_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
WP_064048075.1|902592_902892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079307.1|902954_903293_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_016725636.1|903747_904698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118872359.1|915767_916586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069078908.1|916664_918431_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_069078909.1|918454_919903_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_038938302.1|920487_920985_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_086706212.1|920981_922364_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	60.1	4.1e-135
WP_081263769.1|922396_922837_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_080624828.1|923302_923617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102318.1|925471_926101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143102317.1|926097_926418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143102316.1|928341_928662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155772881.1|928781_928997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722467.1|929020_929599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143102314.1|929653_930133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722469.1|930739_930991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722470.1|931000_931342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722471.1|931353_931647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071654078.1|932392_933616_+	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_071653944.1|933612_934587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139274347.1|934755_935571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615617.1|935588_937253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653945.1|938000_938291_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071653946.1|938287_938785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727901.1|938781_939654_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	2.9e-102
WP_016727900.1|939672_940305_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.0	3.8e-64
WP_016727899.1|940377_940782_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	50.4	8.2e-28
WP_021156153.1|940787_941177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047862.1|941160_943458_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_016727896.1|943692_943902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908894.1|943891_944299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071508043.1|944696_946100_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_071653948.1|946096_947371_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_016725010.1|947353_947734_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_016725011.1|947730_948027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938808.1|948370_948721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727890.1|948848_949355_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_071624100.1|949484_949991_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_038938655.1|950097_950436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962858.1|950455_950992_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_071654079.1|950994_952974_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.2	0.0e+00
WP_071653949.1|953017_953527_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_016727772.1|953537_953930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725356.1|953930_954152_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016725355.1|954151_955678_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_071653951.1|955687_956947_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_071653952.1|956956_957334_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653953.1|957340_958345_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_020833003.1|958347_958650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071508048.1|958655_959102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653954.1|959224_959998_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
>prophage 4
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	967815	981921	3873214	tail	Ralstonia_phage(55.56%)	12	NA	NA
WP_071653956.1|967815_971919_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
WP_016727789.1|971924_972320_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_016727790.1|972306_972879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895561.1|972908_976499_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_071653957.1|976510_977677_+	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_016727799.1|977680_978163_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071508022.1|978159_978558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|978562_980398_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_058907695.1|980407_980632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724633.1|980699_980990_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_028860336.1|980986_981463_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_058907694.1|981459_981921_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
>prophage 5
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	1095750	1103986	3873214		Bacillus_phage(16.67%)	8	NA	NA
WP_016723343.1|1095750_1097124_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
WP_016723342.1|1097150_1098098_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723341.1|1098094_1099090_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_016723340.1|1099219_1099537_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_011000869.1|1099640_1100543_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_028852812.1|1100623_1101736_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016725694.1|1101853_1102777_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.6	7.9e-42
WP_011000872.1|1102933_1103986_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
>prophage 6
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	1780844	1788160	3873214	coat	Ralstonia_phage(100.0%)	12	NA	NA
WP_016727206.1|1780844_1781234_-	transcriptional regulator	NA	S6B268	Ralstonia_phage	68.5	4.0e-40
WP_043885700.1|1781347_1781554_+	hypothetical protein	NA	S6B968	Ralstonia_phage	97.1	5.6e-33
WP_038938340.1|1781651_1782785_+	replication initiation protein	NA	E5F076	Ralstonia_phage	97.4	2.8e-214
WP_016038709.1|1782788_1783106_+	hypothetical protein	NA	E5F068	Ralstonia_phage	100.0	7.5e-53
WP_016038710.1|1783105_1783378_+	hypothetical protein	NA	E5F069	Ralstonia_phage	100.0	7.7e-46
WP_016038711.1|1783377_1783617_+	hypothetical protein	NA	E5F070	Ralstonia_phage	100.0	2.0e-37
WP_016038712.1|1783613_1783823_+|coat	major coat protein	coat	E5F071	Ralstonia_phage	100.0	1.9e-20
WP_016038713.1|1783967_1785365_+	hypothetical protein	NA	E5F072	Ralstonia_phage	100.0	2.3e-210
WP_016038714.1|1785364_1785682_+	DUF2523 domain-containing protein	NA	E5F073	Ralstonia_phage	100.0	2.6e-45
WP_016723073.1|1785692_1786838_+	zonular occludens toxin	NA	E5F074	Ralstonia_phage	99.7	2.9e-219
WP_080624830.1|1786971_1787685_+	hypothetical protein	NA	A0A097ZIG8	Ralstonia_phage	61.8	1.8e-62
WP_021155768.1|1787728_1788160_+	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	100.0	1.2e-77
>prophage 7
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	2600902	2620542	3873214	tRNA	Ralstonia_phage(76.47%)	20	NA	NA
WP_016722743.1|2600902_2602330_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.0	9.4e-10
WP_020832438.1|2602494_2602992_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016727833.1|2605198_2605525_+	hypothetical protein	NA	A0JC05	Ralstonia_phage	99.1	1.1e-51
WP_100243800.1|2605596_2605797_+	hypothetical protein	NA	B5UAR3	Ralstonia_phage	100.0	7.4e-30
WP_015994393.1|2606018_2606315_+	hypothetical protein	NA	B5UAR5	Ralstonia_phage	100.0	1.4e-48
WP_015994394.1|2606314_2606524_+	hypothetical protein	NA	B5UAR6	Ralstonia_phage	100.0	4.4e-25
WP_015994395.1|2606523_2606733_+	hypothetical protein	NA	B5UAR7	Ralstonia_phage	100.0	5.5e-28
WP_015994396.1|2606735_2606984_+	hypothetical protein	NA	B5UAR8	Ralstonia_phage	100.0	7.5e-40
WP_015983977.1|2606986_2607211_+	hypothetical protein	NA	A0JC12	Ralstonia_phage	100.0	9.1e-29
WP_015994397.1|2607286_2608822_+	hypothetical protein	NA	B5UAS0	Ralstonia_phage	100.0	9.8e-223
WP_015994398.1|2608834_2609164_+	DUF2523 domain-containing protein	NA	B5UAS1	Ralstonia_phage	100.0	1.3e-52
WP_016727838.1|2609168_2610491_+	zonular occludens toxin	NA	A0A097ZIG6	Ralstonia_phage	95.7	1.1e-246
WP_028853467.1|2611709_2612645_+	hypothetical protein	NA	A0A097ZIH2	Ralstonia_phage	98.7	2.2e-172
WP_016727842.1|2612652_2613366_-	hypothetical protein	NA	A0JC17	Ralstonia_phage	94.9	1.1e-123
WP_016727843.1|2613392_2613983_-	recombinase family protein	NA	A0JC18	Ralstonia_phage	98.5	1.1e-100
WP_016722739.1|2614205_2615522_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	6.1e-96
WP_016727844.1|2615588_2616899_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.6	6.5e-74
WP_011002262.1|2617008_2617425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002263.1|2617460_2618108_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_016722737.1|2618196_2620542_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.5	2.5e-84
>prophage 8
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	2857955	2868094	3873214		unidentified_phage(14.29%)	9	NA	NA
WP_021155205.1|2857955_2859503_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
WP_016725974.1|2859502_2860012_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_016724070.1|2860045_2860690_+	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
WP_016724069.1|2860746_2861571_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_016724068.1|2861582_2862290_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011002542.1|2862297_2862984_+	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_019718314.1|2862939_2864820_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.3	6.1e-57
WP_011002544.1|2864855_2865998_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_021155204.1|2866132_2868094_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
>prophage 9
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	2883253	2931336	3873214	protease,coat	Bacillus_phage(16.67%)	44	NA	NA
WP_019718304.1|2883253_2884885_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	NA	NA	NA	NA
WP_069079115.1|2885100_2887143_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.0e-10
WP_011002565.1|2887198_2887819_-	rhombosortase	NA	NA	NA	NA	NA
WP_043886040.1|2887815_2890683_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_043886041.1|2890862_2895143_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011002568.1|2895148_2896018_+	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
WP_020832609.1|2896045_2897506_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011002570.1|2897898_2898978_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_016723669.1|2899101_2899437_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016725993.1|2899720_2900617_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_020832612.1|2900689_2901247_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011002574.1|2901367_2902786_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016723672.1|2902796_2903687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016725995.1|2903857_2905351_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_021155193.1|2905361_2906483_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_021155192.1|2906492_2907740_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_016725998.1|2907791_2908169_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_020832616.1|2908165_2908888_+	LrgB family protein	NA	NA	NA	NA	NA
WP_016725999.1|2909046_2909442_+	VOC family protein	NA	NA	NA	NA	NA
WP_016726000.1|2909492_2909972_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723680.1|2910014_2910713_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723681.1|2910729_2911227_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	3.3e-26
WP_016723682.1|2911322_2914535_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011002586.1|2914566_2915103_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_016723683.1|2915106_2916135_-	PilW family protein	NA	NA	NA	NA	NA
WP_011002588.1|2916131_2916722_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723684.1|2916718_2917207_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_016723685.1|2917210_2917651_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_011002591.1|2917845_2918985_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011002592.1|2919037_2920081_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_021155191.1|2920205_2920928_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002594.1|2920962_2921787_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_016726006.1|2921808_2922087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079120.1|2922083_2922959_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_003271865.1|2923032_2923533_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_011002597.1|2923691_2923934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726007.1|2923992_2924241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|2924459_2925404_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_016726008.1|2926009_2926552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023470464.1|2926621_2927131_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016726010.1|2927127_2929392_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016723694.1|2929441_2930161_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011002604.1|2930279_2930783_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002605.1|2930832_2931336_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 10
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	3370406	3415954	3873214	holin,capsid,terminase,integrase,head,portal,plate,transposase,tail	Ralstonia_virus(57.14%)	61	3370323:3370368	3410512:3410557
3370323:3370368	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
WP_015985128.1|3370406_3371489_-|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	100.0	2.7e-211
WP_020832872.1|3372419_3372593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015985125.1|3372579_3375384_-	DNA primase	NA	A4PE69	Ralstonia_virus	100.0	0.0e+00
WP_016727357.1|3375383_3375674_-	hypothetical protein	NA	A4PE68	Ralstonia_virus	94.8	2.1e-49
WP_016727356.1|3375670_3375943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100243795.1|3375939_3376416_-	hypothetical protein	NA	A4PE67	Ralstonia_virus	77.2	1.7e-56
WP_015985122.1|3376490_3376703_-	hypothetical protein	NA	A4PE66	Ralstonia_virus	100.0	6.4e-32
WP_015985121.1|3376695_3376932_-	hypothetical protein	NA	A4PE65	Ralstonia_virus	100.0	2.1e-39
WP_015985120.1|3376931_3377138_-	hypothetical protein	NA	A4PE64	Ralstonia_virus	100.0	6.4e-29
WP_015985118.1|3377295_3377529_-	hypothetical protein	NA	A4PE62	Ralstonia_virus	100.0	1.5e-34
WP_015985117.1|3377538_3378093_-	Bro-N domain-containing protein	NA	A4PE61	Ralstonia_virus	100.0	1.2e-98
WP_015985116.1|3378207_3378456_-	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	100.0	1.0e-41
WP_015985115.1|3378452_3378647_-	hypothetical protein	NA	A4PE59	Ralstonia_virus	100.0	1.8e-25
WP_016727352.1|3378675_3378867_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_071615658.1|3378886_3379087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727351.1|3379162_3379585_+	helix-turn-helix domain-containing protein	NA	A4PE57	Ralstonia_virus	100.0	6.7e-73
WP_038938419.1|3379743_3380490_+	hypothetical protein	NA	A4PE55	Ralstonia_virus	92.3	1.2e-120
WP_016727349.1|3380405_3381188_-	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	64.8	1.5e-89
WP_071895454.1|3381138_3381348_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_016727347.1|3381660_3382788_-	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.5	1.4e-202
WP_016727346.1|3382784_3383207_-|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.1	1.5e-72
WP_086706303.1|3383209_3385873_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	94.7	0.0e+00
WP_003267618.1|3385869_3385971_-|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_016727345.1|3385967_3386294_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	1.8e-49
WP_016727344.1|3386369_3386879_-|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	99.4	5.4e-93
WP_016727343.1|3386910_3388086_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	95.4	9.5e-218
WP_020371912.1|3388184_3388649_-	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	90.3	6.9e-79
WP_016727341.1|3388645_3389398_-|tail	tail assembly protein	tail	A0A077K9S5	Ralstonia_phage	94.0	4.2e-126
WP_016727340.1|3389410_3391075_-|tail	tail protein	tail	A0A077K818	Ralstonia_phage	96.8	1.8e-310
WP_016727339.1|3391081_3391699_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	95.7	1.6e-99
WP_016727338.1|3391691_3392600_-|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	98.0	2.0e-159
WP_016727337.1|3392602_3392950_-|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	98.3	2.9e-58
WP_016727336.1|3392946_3393564_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	93.7	1.2e-107
WP_080624834.1|3393809_3394115_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_020829521.1|3394202_3395189_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016723619.1|3395393_3396359_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_016727335.1|3396510_3396957_-	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	90.5	5.8e-67
WP_020832903.1|3396953_3397388_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	99.3	4.9e-79
WP_016727333.1|3397384_3397885_-	hypothetical protein	NA	A4PE37	Ralstonia_virus	99.4	4.2e-82
WP_016727332.1|3397881_3398688_-	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	99.6	4.2e-148
WP_016721970.1|3398684_3398999_-|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	98.1	5.0e-49
WP_015985092.1|3398995_3399400_-	phage-related protein	NA	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_011001871.1|3399415_3399622_-|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_011001872.1|3399621_3400101_-|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	100.0	2.3e-85
WP_016721968.1|3400198_3400921_-|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.3	1.3e-124
WP_016727331.1|3400917_3401934_-|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	98.2	2.4e-185
WP_016721963.1|3401987_3402827_-|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	95.0	5.9e-145
WP_016727330.1|3402970_3404752_+|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	99.2	0.0e+00
WP_086706305.1|3404748_3405855_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	98.9	1.4e-215
WP_015985086.1|3405839_3406655_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	100.0	3.4e-158
WP_139274289.1|3406564_3407497_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	96.1	1.9e-160
WP_015985084.1|3407506_3408010_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	100.0	5.3e-93
WP_020832917.1|3408011_3408422_-	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	99.2	2.0e-66
WP_080606484.1|3408951_3409260_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_016725467.1|3409240_3410104_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011002978.1|3411198_3411537_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
3410512:3410557	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
WP_016721986.1|3411929_3412127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002979.1|3412307_3412619_+	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_011002980.1|3412701_3413406_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_016721987.1|3413409_3414435_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_016725726.1|3414625_3415954_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	3475177	3525225	3873214	protease,transposase	Sinorhizobium_phage(14.29%)	41	NA	NA
WP_038938388.1|3475177_3476137_-|protease	serine protease	protease	A0A0F6R5W6	Sinorhizobium_phage	30.0	1.3e-07
WP_016724421.1|3476208_3476763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727287.1|3477021_3477621_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_011003033.1|3477936_3479316_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.8e-13
WP_021154951.1|3479369_3480275_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003035.1|3480605_3480998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019718977.1|3481125_3482274_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016727284.1|3482273_3482552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724425.1|3482863_3483205_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011003039.1|3484247_3484679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154949.1|3485419_3487543_+	tryptophan 2-monooxygenase oxidoreductase	NA	NA	NA	NA	NA
WP_038938383.1|3487726_3488569_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016724428.1|3488565_3490056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|3490293_3490443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|3490439_3491405_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_016724429.1|3492115_3492952_-	cytochrome c	NA	NA	NA	NA	NA
WP_016724430.1|3493388_3494567_-	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_016724432.1|3495154_3495361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003045.1|3495688_3495892_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_016725726.1|3495944_3497273_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003046.1|3497765_3498602_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016727282.1|3498887_3500165_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_016724434.1|3500205_3501336_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016724436.1|3503653_3504349_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016727280.1|3504513_3507546_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016724439.1|3507708_3509811_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_016724440.1|3509807_3510971_+	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_016727279.1|3510983_3511886_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011003055.1|3511882_3512461_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_021156161.1|3512639_3514445_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_020371902.1|3514955_3515456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019718995.1|3515824_3517189_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016727986.1|3517509_3518844_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.8	5.2e-10
WP_016725375.1|3518985_3519429_+	cyanase	NA	NA	NA	NA	NA
WP_016725374.1|3519465_3520083_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016725373.1|3520113_3520449_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_071654022.1|3520474_3521299_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_038938199.1|3521524_3521941_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016721870.1|3521985_3522972_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_086706311.1|3523111_3524254_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071893105.1|3524403_3525225_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	3543308	3600117	3873214	capsid,terminase,integrase,head,portal,tail	Acidithiobacillus_phage(48.84%)	65	3549946:3549961	3601370:3601385
WP_043897848.1|3543308_3543770_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	83.0	7.8e-67
WP_020832987.1|3543766_3544243_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_003270772.1|3544239_3544530_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_016728003.1|3544601_3544826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086706321.1|3544835_3546680_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.7	9.1e-106
WP_038938692.1|3546684_3547083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727796.1|3547079_3547562_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_016727795.1|3547565_3548732_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	32.3	5.6e-45
WP_086706323.1|3548743_3552334_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.4	0.0e+00
3549946:3549961	attL	GCTCGGTCAGCAAGGA	NA	NA	NA	NA
WP_086706325.1|3552334_3552730_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	2.0e-31
WP_086706328.1|3552735_3556839_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	27.5	1.3e-24
WP_023470090.1|3556904_3558032_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.5	1.1e-98
WP_038938660.1|3558641_3560108_+	type III secretion system YopJ family effector PopP2	NA	NA	NA	NA	NA
WP_016723655.1|3560293_3560584_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_086706330.1|3560626_3561271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938671.1|3561245_3561467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723647.1|3561463_3561859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|3561867_3562641_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_016727774.1|3562766_3563213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021154690.1|3563218_3563521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075463052.1|3563523_3564528_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.6	9.6e-110
WP_021154688.1|3564536_3564914_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	6.1e-25
WP_023470378.1|3564923_3566174_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.0	2.4e-62
WP_069079297.1|3566183_3567731_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_016727771.1|3567730_3567952_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	5.9e-12
WP_069079221.1|3567952_3568345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727881.1|3568355_3568865_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	2.8e-25
WP_086005439.1|3568908_3570888_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.3	0.0e+00
WP_020833012.1|3570890_3571427_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	5.5e-72
WP_107523986.1|3571446_3571785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833014.1|3571890_3572406_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	2.3e-22
WP_016726852.1|3572527_3572716_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_020371857.1|3572940_3573306_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	8.5e-32
WP_086706332.1|3573348_3574569_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.7	3.2e-192
WP_069078855.1|3574565_3575978_-	DNA modification methylase	NA	K4I3Y2	Acidithiobacillus_phage	59.3	1.3e-152
WP_082317314.1|3575959_3576505_-	hypothetical protein	NA	A0A2H4P763	Pseudomonas_phage	39.6	2.0e-24
WP_071654065.1|3576869_3577085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725630.1|3577038_3577338_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016725341.1|3577337_3577604_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_016725340.1|3577658_3578042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725629.1|3578034_3578244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725339.1|3578245_3578710_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_064047872.1|3578840_3581129_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.4	7.1e-286
WP_016725627.1|3581125_3581386_-	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
WP_011003119.1|3581382_3582141_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.1	1.3e-82
WP_016725626.1|3582127_3582676_-	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	3.1e-22
WP_038937632.1|3582675_3583188_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	66.9	4.6e-52
WP_016725624.1|3583195_3583843_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.6	7.9e-81
WP_011003123.1|3583839_3584745_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.2	2.4e-104
WP_139233340.1|3584716_3585268_-	helix-turn-helix domain-containing protein	NA	A0A172JFU7	Citrobacter_phage	39.2	2.2e-23
WP_016725622.1|3585264_3585747_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.8	1.0e-45
WP_089190378.1|3585757_3586021_-	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_016725621.1|3586249_3586711_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.1	6.9e-47
WP_016725620.1|3586760_3588992_+	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.5	4.7e-290
WP_016725619.1|3589070_3589865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624758.1|3590004_3590223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725617.1|3590222_3590672_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	6.7e-55
WP_016725616.1|3590668_3592057_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.9	5.4e-220
WP_016725615.1|3592053_3592428_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	64.6	7.8e-41
WP_016725614.1|3592424_3592898_+	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	53.2	1.4e-39
WP_016725613.1|3593031_3593895_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_016725612.1|3594114_3595557_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016725611.1|3595553_3596267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698858.1|3596889_3598515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706386.1|3599100_3600117_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	32.5	1.5e-30
3601370:3601385	attR	TCCTTGCTGACCGAGC	NA	NA	NA	NA
>prophage 13
NZ_CP016612	Ralstonia solanacearum FJAT-91 chromosome, complete genome	3873214	3785076	3834483	3873214	protease,transposase	Ralstonia_phage(23.08%)	44	NA	NA
WP_086706343.1|3785076_3785901_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_043885519.1|3786000_3787341_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011003284.1|3787316_3787982_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.1e-24
WP_016726713.1|3788018_3788804_-	membrane protein	NA	NA	NA	NA	NA
WP_086706345.1|3788951_3789752_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021155684.1|3789758_3791066_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011003288.1|3791062_3791824_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	2.0e-30
WP_016722675.1|3791820_3792492_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_016722674.1|3792505_3793273_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003291.1|3793477_3794266_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003292.1|3794431_3795979_-	cellobiose phosphorylase	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.8	1.2e-10
WP_016726717.1|3796259_3797375_+	Fic family protein	NA	NA	NA	NA	NA
WP_016726718.1|3797399_3798320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003296.1|3798802_3799648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016726719.1|3799898_3800465_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016726720.1|3800478_3800727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080672954.1|3800713_3801109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726721.1|3801115_3801760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893008.1|3801930_3802170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|3802282_3803269_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_086706391.1|3804827_3806390_+	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	26.8	8.4e-12
WP_016726724.1|3806386_3807289_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_016726725.1|3807285_3808167_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_016726726.1|3808348_3808996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|3809426_3810392_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|3810388_3810538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706393.1|3810576_3812301_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	33.6	2.9e-82
WP_157698860.1|3812318_3813860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016726729.1|3813875_3814568_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_016726730.1|3814663_3814927_-	hypothetical protein	NA	A4PE23	Ralstonia_virus	42.0	2.8e-05
WP_080624806.1|3815404_3817081_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_086706348.1|3817077_3819153_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	30.4	3.8e-20
WP_086706350.1|3819166_3821914_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	7.2e-91
WP_016726734.1|3822723_3823476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698861.1|3823650_3824577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938124.1|3824981_3825500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698862.1|3825566_3826295_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721870.1|3826607_3827594_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_157698863.1|3827717_3828608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624808.1|3828643_3829639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938122.1|3829706_3830639_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155738951.1|3831820_3831970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|3831966_3832932_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_086004744.1|3833116_3834483_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	1.6e-75
>prophage 1
NZ_CP016613	Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence	2000873	22632	55125	2000873	transposase	Burkholderia_phage(33.33%)	29	NA	NA
WP_011003886.1|22632_22764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016725683.1|22968_23439_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_080624764.1|23489_23822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086004752.1|24060_24862_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_081263831.1|25451_27086_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_016721870.1|27455_28442_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_080672958.1|28807_29101_-	hypothetical protein	NA	A0A2H4JIC6	uncultured_Caudovirales_phage	89.1	1.2e-20
WP_016727887.1|29733_29955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698866.1|31546_32697_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_016721870.1|32806_33793_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016727894.1|35956_36529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706400.1|36876_37317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719041.1|38510_39530_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038938585.1|40249_40627_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_020371953.1|40717_41761_+	transporter	NA	NA	NA	NA	NA
WP_011003864.1|41750_42308_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155739017.1|43235_43379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725380.1|43925_44432_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_011003856.1|44485_45691_-	chromate transporter	NA	NA	NA	NA	NA
WP_011003855.1|45709_46681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003854.1|46813_47086_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_016725378.1|47187_48315_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_052328822.1|48607_49975_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_021156082.1|50647_52417_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_016724448.1|52459_52981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100243798.1|52977_53163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698867.1|53382_53553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|54013_54163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|54159_55125_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
>prophage 2
NZ_CP016613	Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence	2000873	675388	746448	2000873	integrase,transposase	Ralstonia_phage(45.45%)	47	666836:666854	721235:721253
666836:666854	attL	GATGTTGCCGCGCACGCGG	NA	NA	NA	NA
WP_038938784.1|675388_676402_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016722246.1|677512_677866_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_049832992.1|677930_678305_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096761523.1|678243_678621_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_038938784.1|678967_679981_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016722243.1|680393_681659_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_038937995.1|681907_685204_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.6	9.1e-32
WP_023470119.1|685277_685937_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016721735.1|686312_687278_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|687274_687424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706472.1|687467_691397_+	hemagglutinin	NA	NA	NA	NA	NA
WP_016722239.1|691514_692765_+	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	35.5	2.2e-55
WP_016722238.1|692740_693178_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_016722237.1|693164_693794_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.8	8.0e-54
WP_021155869.1|693860_694913_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016726465.1|695070_696630_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_020371812.1|696682_698029_+	MFS transporter	NA	NA	NA	NA	NA
WP_020830578.1|697997_698792_+	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_011004858.1|698825_699911_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_020830577.1|699942_701424_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021155868.1|701664_702951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038937993.1|703263_704697_-	membrane protein	NA	NA	NA	NA	NA
WP_011004854.1|704719_705091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830573.1|705106_706297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726460.1|706334_707234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023470115.1|707274_715248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038937992.1|715291_716161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004849.1|716174_717287_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_016726457.1|718201_718948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016726456.1|719333_720263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021155865.1|720259_721711_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
721235:721253	attR	GATGTTGCCGCGCACGCGG	NA	NA	NA	NA
WP_016722225.1|721707_722973_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016722224.1|722965_726160_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	7.9e-65
WP_011004842.1|726743_726920_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069079485.1|726967_728191_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	A0A0M3UL24	Mycobacterium_phage	29.6	3.7e-07
WP_016721956.1|728312_729437_+	porin	NA	NA	NA	NA	NA
WP_021155862.1|729927_732582_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	82.7	0.0e+00
WP_016721735.1|732712_733678_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|733674_733824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698869.1|733852_734059_+	hypothetical protein	NA	A0A077K8Q4	Ralstonia_phage	51.5	6.9e-07
WP_020830559.1|734055_734892_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	72.8	1.9e-103
WP_016725032.1|737285_738176_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830555.1|738692_739835_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016725034.1|739910_741425_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016726445.1|741443_742640_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016726444.1|742843_744079_+	cystathionine gamma-synthase family protein	NA	NA	NA	NA	NA
WP_016721870.1|745461_746448_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 3
NZ_CP016613	Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence	2000873	992858	1059341	2000873	transposase	Staphylococcus_phage(27.27%)	43	NA	NA
WP_016725411.1|992858_993143_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016725410.1|993287_993746_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086005114.1|993876_994617_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_016725408.1|994613_994916_+	AzlD family protein	NA	NA	NA	NA	NA
WP_021155549.1|995246_996938_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_139233389.1|997328_997970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152532520.1|997990_998635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895813.1|998685_999165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895811.1|999395_999695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086706430.1|999691_1009537_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.4	5.8e-26
WP_071895809.1|1009799_1017338_-	type III effector protein skwp2	NA	A0A1S5SDF1	Streptococcus_phage	28.8	3.0e-06
WP_016724594.1|1017758_1018289_-	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_016724593.1|1018285_1019110_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724592.1|1019106_1020051_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	1.3e-28
WP_016727950.1|1020034_1021306_-	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_023470146.1|1021302_1023921_-	regulatory protein NosR	NA	NA	NA	NA	NA
WP_028861889.1|1023978_1025919_-	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_020371990.1|1026147_1026555_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_016725392.1|1026559_1027582_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_021155554.1|1027694_1028597_+	acyltransferase	NA	NA	NA	NA	NA
WP_016725394.1|1029302_1031900_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_038938759.1|1032147_1033779_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	3.9e-20
WP_016727946.1|1034731_1037002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895717.1|1037590_1037905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118888231.1|1037914_1039540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723835.1|1039956_1041402_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_016723834.1|1041703_1041913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1042846_1043833_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_086004752.1|1045383_1046185_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_071895718.1|1046225_1046414_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_016723839.1|1046529_1047219_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014631877.1|1047257_1047620_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_011004587.1|1047749_1048466_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_021156145.1|1048504_1050127_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_016726292.1|1050140_1051718_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_020830396.1|1051848_1052559_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	3.8e-12
WP_019719996.1|1052555_1053305_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.4e-12
WP_020830395.1|1053301_1054270_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014631870.1|1054266_1055136_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016726288.1|1055184_1056444_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016721870.1|1057155_1058142_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_155738951.1|1058229_1058379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|1058375_1059341_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
>prophage 4
NZ_CP016613	Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence	2000873	1550052	1576526	2000873	integrase,transposase	uncultured_virus(25.0%)	24	1543219:1543233	1578757:1578771
1543219:1543233	attL	CGCGGGTACGCCAGC	NA	NA	NA	NA
WP_023470149.1|1550052_1551528_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_019719026.1|1551669_1551885_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043885730.1|1551781_1552561_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	4.9e-29
WP_080624839.1|1552908_1553799_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_155773181.1|1554044_1555136_+	type III effector protein	NA	NA	NA	NA	NA
WP_016721870.1|1555212_1556199_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_023470152.1|1557613_1558270_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	48.4	4.3e-50
WP_016727464.1|1558495_1559266_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038938487.1|1559413_1560928_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	27.8	4.6e-47
WP_016727462.1|1561175_1561430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727461.1|1561536_1563159_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.8	2.3e-174
WP_016727460.1|1563241_1563559_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	1.8e-17
WP_016727459.1|1563735_1564371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830068.1|1564542_1565202_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016727456.1|1565688_1565946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127592169.1|1566074_1566386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615345.1|1566764_1567037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885802.1|1567215_1569153_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.8	7.7e-148
WP_038938484.1|1569325_1569712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371926.1|1569911_1570478_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_016727451.1|1570663_1571071_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_020830062.1|1571086_1571527_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_086706442.1|1571826_1573536_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058908723.1|1573541_1576526_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.5	2.8e-80
1578757:1578771	attR	GCTGGCGTACCCGCG	NA	NA	NA	NA
>prophage 5
NZ_CP016613	Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence	2000873	1745153	1795280	2000873	tRNA,plate,transposase	uncultured_Caudovirales_phage(22.22%)	34	NA	NA
WP_016723213.1|1745153_1747106_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	5.2e-43
WP_016723214.1|1747092_1748634_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_016723215.1|1748858_1750868_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020371709.1|1751009_1751564_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1751775_1752492_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139233336.1|1753837_1754122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723220.1|1754258_1754540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086706452.1|1754657_1755173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|1755260_1756226_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_074960892.1|1756990_1757629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719455.1|1758120_1758759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725655.1|1759130_1760795_-	membrane protein	NA	NA	NA	NA	NA
WP_086706454.1|1760810_1763831_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.2	7.8e-38
WP_021155950.1|1763968_1764715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155949.1|1765001_1765850_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1765889_1766159_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_086706457.1|1766169_1767657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086706460.1|1767694_1771636_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_016725648.1|1771632_1772619_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011004059.1|1772621_1773455_+	OmpA family protein	NA	NA	NA	NA	NA
WP_069079379.1|1773553_1774522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725645.1|1774594_1775674_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_016725644.1|1775807_1777151_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_020371705.1|1777903_1778287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1779503_1780490_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_157698872.1|1780728_1781530_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.2	5.3e-26
WP_023470017.1|1781549_1782113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1782673_1783660_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_144061949.1|1783889_1784339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830182.1|1784401_1785226_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_043885652.1|1787510_1788644_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_020830185.1|1788661_1791418_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
WP_020830186.1|1791438_1794156_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_020371627.1|1794188_1795280_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
