The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	427868	488007	5013813	tRNA,transposase,tail,lysis,terminase	Escherichia_phage(39.62%)	68	NA	NA
WP_170386723.1|427868_428840_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000611911.1|429043_429796_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|429990_430506_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000156573.1|431048_431864_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000587198.1|431960_432989_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000987381.1|432985_434500_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_001046838.1|434694_435258_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_001296045.1|435278_436511_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|436765_437749_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123789.1|438226_439600_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_001157412.1|439727_440663_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|440714_441950_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|441951_442167_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|442245_442455_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|442447_442642_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|442698_443508_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_086353125.1|443500_446101_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.4e-248
WP_000632297.1|446202_446478_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|446552_446723_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|446722_446944_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|447385_447874_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_077766793.1|447870_448026_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.8e-07
WP_000948459.1|448345_448822_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|448945_449242_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|449264_449687_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000788970.1|450562_451309_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_123009612.1|451331_452093_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	6.8e-116
WP_001141108.1|452109_452532_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|452693_453197_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|453317_454091_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000813254.1|454613_454769_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001410105.1|454935_455214_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_086353127.1|455215_456265_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001761874.1|456277_456652_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	7.6e-36
WP_032342160.1|456648_457470_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	2.6e-81
WP_021562591.1|457750_458791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233158.1|458791_459301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839599.1|459614_459830_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000193293.1|459834_460179_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370551.1|460144_460417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|460522_461056_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001228696.1|461272_461458_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_024165216.1|461654_463112_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291093.1|463249_464041_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204035.1|464033_464966_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000613571.1|464901_465153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089450.1|465156_466251_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
WP_000625348.1|466231_467533_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|467535_468942_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_001363932.1|468925_470038_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|470142_470907_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|471005_472145_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|472187_472364_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|472367_472763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|472762_473146_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029819.1|473146_473527_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000673077.1|473523_473916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|473942_474905_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|475055_475415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353128.1|475886_479120_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	2.3e-104
WP_000024051.1|479112_479451_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_024238971.1|479450_480149_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.6e-127
WP_024177847.1|480153_480897_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|480833_481436_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_086353129.1|481496_484976_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001518415.1|485043_485643_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
WP_086353130.1|485707_487732_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.7	8.5e-182
WP_000654172.1|487728_488007_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 2
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	905455	993703	5013813	tRNA,capsid,transposase,tail,plate,integrase,holin,portal,terminase	Escherichia_phage(22.22%)	104	951154:951213	993765:993889
WP_099156422.1|905455_906804_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|906913_907924_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|907932_908544_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|908682_908748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|908818_909421_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|909422_909944_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|909978_910719_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|910747_911200_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|911192_912965_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|913274_913841_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|913837_914656_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|914708_915104_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|915144_915888_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|915884_916856_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|916891_919321_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|919345_920446_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|920833_921580_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|921593_922160_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|922375_924109_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|924161_924554_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|924553_926632_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|926624_927773_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|927961_928606_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|928616_929006_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|929020_930070_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|930072_930933_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|931223_932885_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|933029_933533_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|933553_935518_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|935522_936449_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|936445_937333_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|937459_938038_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|938040_938391_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|939170_939599_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|939605_941030_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|941004_941805_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|941971_942958_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|942972_944487_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|944556_945546_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|946342_946846_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|946923_947175_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|947289_947376_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|947639_947963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|948134_948632_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|948669_948909_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|949099_950311_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_061089167.1|950361_951027_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
951154:951213	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|951498_951918_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531766.1|952084_953128_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
WP_001531767.1|953131_953356_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|953517_953907_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_086353138.1|953942_955583_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.6	4.0e-20
WP_000444667.1|955691_955973_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|955985_956498_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|956515_958018_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|958014_958404_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_001531771.1|958403_959588_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|959580_960207_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|960209_961130_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|961126_961468_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|961470_962373_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|962353_962890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|962886_963567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|963598_963979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|963975_964395_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_063268576.1|964429_965464_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.2	1.2e-104
WP_000206292.1|965522_965852_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|965851_967159_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|967158_968733_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|968729_968963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|968962_970825_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|970811_971378_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|971746_971992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|972051_972246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|972253_972733_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|972732_973005_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|973004_973388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|973500_974172_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|974171_974465_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|974461_975058_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|975135_975315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|975466_976108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|976351_976585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|976983_977472_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|977481_978087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|978549_979248_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|980436_981360_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|981534_982323_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|983004_983229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|983225_983537_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|983533_983770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|983771_984182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|984220_985636_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|985625_986381_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|986377_986602_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|986641_987118_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|987176_987407_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|987505_987919_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|988929_989250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|989280_991497_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|991493_992063_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|992062_992245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|992454_992718_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|992686_993703_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
993765:993889	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	1170750	1177053	5013813		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|1170750_1171293_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1171297_1172176_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1172233_1173133_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1173132_1174218_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1174590_1175484_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|1175658_1177053_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 4
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	1271230	1280675	5013813		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1271230_1272367_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1272363_1274367_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1274491_1274953_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1274993_1275464_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1275510_1276230_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1276226_1277912_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1278133_1278865_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1278924_1279032_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1279012_1279744_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1279748_1280675_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 5
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	1858834	1865974	5013813		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1858834_1861396_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|1861501_1862158_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|1862208_1862976_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|1863171_1864080_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|1864076_1865339_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|1865335_1865974_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 6
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	3204701	3303900	5013813	tRNA,lysis,capsid,transposase,protease,head,tail,plate,holin,portal,integrase,terminase	Escherichia_phage(34.04%)	102	3199194:3199211	3274425:3274442
3199194:3199211	attL	GAGGATGCAGCGGCGGCA	NA	NA	NA	NA
WP_000560981.1|3204701_3205139_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3205183_3206125_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|3206188_3207097_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|3207325_3207637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|3207637_3207928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|3208286_3208565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|3208961_3209180_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|3209364_3209814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|3210129_3210978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|3211267_3211510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|3211691_3212621_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3212617_3213253_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|3213249_3214152_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|3214164_3217215_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|3217408_3218242_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|3219237_3220632_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|3220672_3220987_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|3220996_3221821_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|3222087_3223347_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|3223343_3224813_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|3225100_3225937_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|3225920_3226859_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|3226855_3227890_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|3228174_3228795_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|3229054_3230038_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|3230186_3230861_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3231031_3232405_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3232401_3233100_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_086353220.1|3233249_3233750_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|3233935_3234916_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|3234985_3235279_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|3235415_3235688_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3235857_3236358_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3236421_3236646_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|3236645_3236948_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_001113274.1|3236947_3237172_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	4.2e-34
WP_000027664.1|3237168_3237444_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_086353165.1|3237433_3239719_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_075326499.1|3240060_3240285_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	86.9	7.5e-23
WP_050939234.1|3240552_3241581_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.6	3.9e-50
WP_075326501.1|3241585_3243598_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	32.6	5.8e-05
WP_086353166.1|3243899_3244934_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	1.6e-200
WP_000156874.1|3244933_3246706_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_086353167.1|3246879_3247734_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	98.2	1.7e-136
WP_086353168.1|3247792_3248866_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.8e-200
WP_086353169.1|3248869_3249613_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.8	2.8e-122
WP_000988633.1|3249712_3250222_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|3250221_3250425_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|3250428_3250710_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3250709_3251207_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_086353170.1|3251221_3251647_+	protein lysA	NA	U5N096	Enterobacteria_phage	95.0	5.5e-59
WP_086353171.1|3251634_3252060_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	4.7e-66
WP_086353172.1|3252167_3252635_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_021563760.1|3252627_3253086_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	7.8e-43
WP_077727440.1|3253082_3253838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353173.1|3253915_3254551_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	5.9e-113
WP_000127164.1|3254547_3254895_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121478.1|3254899_3255808_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_086353174.1|3255800_3256331_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	3.9e-102
WP_086353175.1|3256341_3259077_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	81.4	0.0e+00
WP_065275708.1|3259080_3259608_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	96.0	6.2e-92
WP_086353176.1|3260938_3262129_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.2	2.4e-224
WP_001251408.1|3262141_3262660_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3262716_3262992_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3263024_3263144_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_086353177.1|3263136_3265584_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	96.1	0.0e+00
WP_000978890.1|3265598_3266078_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_086353178.1|3266077_3267241_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
WP_000468308.1|3267322_3267541_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|3267777_3268680_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|3268860_3269823_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|3270142_3271132_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|3271238_3271994_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3272048_3272816_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|3272923_3273523_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|3273623_3274064_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|3274275_3274575_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
3274425:3274442	attR	TGCCGCCGCTGCATCCTC	NA	NA	NA	NA
WP_000323555.1|3274601_3275030_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|3275034_3275781_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3275877_3276888_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|3277058_3278567_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3278589_3279435_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3279859_3280105_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3280189_3280675_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3280767_3281694_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3281760_3283092_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3283101_3283632_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|3283724_3284684_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644908.1|3284775_3285801_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001296625.1|3285956_3288155_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|3288357_3288570_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000702314.1|3288630_3289239_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|3289298_3289616_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000197203.1|3289892_3291053_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110759.1|3291055_3293488_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000105529.1|3293451_3294582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694068.1|3294714_3296268_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
WP_000007515.1|3296649_3297540_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001296626.1|3297868_3300049_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001271242.1|3300142_3301048_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647862.1|3301074_3301692_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_170386723.1|3302928_3303900_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 7
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	3874613	3974654	5013813	tRNA,capsid,transposase,head,tail,holin,portal,integrase,terminase	Enterobacteria_phage(39.06%)	111	3867574:3867609	3947961:3947996
3867574:3867609	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_170386723.1|3874613_3875585_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_024008786.1|3876415_3878068_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091596.1|3878238_3879144_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001531305.1|3879282_3880305_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001531306.1|3880441_3882733_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001385190.1|3882986_3883481_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|3883529_3884267_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|3884269_3884809_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|3884916_3885390_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001314410.1|3885380_3886151_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936644.1|3886770_3887496_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001311355.1|3887453_3888131_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_001531310.1|3888168_3888957_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001531311.1|3889097_3889334_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272297.1|3889894_3890926_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204031.1|3891028_3891442_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092452.1|3891410_3891857_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870722.1|3891871_3892549_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218277.1|3892934_3894158_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
WP_001159681.1|3894340_3898168_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000206808.1|3898564_3899185_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	1.1e-111
WP_001242715.1|3899184_3899547_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000008242.1|3899537_3900074_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	4.5e-98
WP_046960595.1|3900201_3901026_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|3901091_3901454_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000848749.1|3902122_3902797_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000649477.1|3902887_3903088_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|3903131_3903683_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087323.1|3903679_3904516_+	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	5.9e-137
WP_000933943.1|3904508_3904745_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.7	2.7e-39
WP_000061519.1|3904741_3905560_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|3905556_3906051_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_001315197.1|3906050_3906713_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.1e-127
WP_000224252.1|3906700_3907027_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.7e-53
WP_000767123.1|3907023_3907419_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	98.4	5.7e-66
WP_001072670.1|3907581_3908397_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	5.5e-148
WP_001519432.1|3908404_3909394_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001047103.1|3909407_3910160_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_122632654.1|3910438_3910528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087755.1|3910582_3910795_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066486.1|3911095_3911311_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000839581.1|3912063_3912279_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189906.1|3912283_3912628_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	85.7	1.5e-33
WP_001315200.1|3912593_3912866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992048.1|3912971_3913505_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	1.5e-98
WP_001071779.1|3913501_3913993_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066496.1|3914361_3914574_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|3914584_3914773_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|3914920_3915076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|3915248_3915422_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548584.1|3915717_3915924_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	9.9e-22
WP_032143631.1|3916177_3916369_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	8.0e-26
WP_001519435.1|3916796_3917303_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	3.3e-34
WP_086353190.1|3917274_3919203_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
WP_000259002.1|3919186_3919393_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001306178.1|3919389_3920982_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.9e-184
WP_001253998.1|3920971_3922477_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256840.1|3922513_3922861_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|3922918_3923947_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|3923998_3924373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204545.1|3924365_3924719_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
WP_001007371.1|3924730_3925309_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683147.1|3925305_3925701_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001306179.1|3925708_3926449_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000479209.1|3926464_3926887_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	1.9e-59
WP_000459457.1|3926868_3927303_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840201.1|3927295_3929857_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847347.1|3929853_3930183_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152645.1|3930182_3930881_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	3.6e-132
WP_000140691.1|3930885_3931629_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	9.8e-144
WP_000090890.1|3931565_3932198_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_086353191.1|3932258_3935738_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.3	0.0e+00
WP_001228249.1|3935805_3936405_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_086353192.1|3936469_3938845_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654166.1|3938844_3939126_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	3.1e-18
WP_061089098.1|3939135_3940176_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	2.4e-124
WP_001306187.1|3940218_3940512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|3940739_3941330_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|3941710_3941944_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_120795384.1|3942012_3942126_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001217539.1|3942552_3942801_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|3943020_3944607_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001531357.1|3944999_3945605_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3945731_3945893_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001298490.1|3946014_3947088_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563043.1|3947084_3947864_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088370.1|3947998_3948862_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
3947961:3947996	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001143221.1|3948833_3950384_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3950641_3951421_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477800.1|3951498_3952821_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
WP_000816460.1|3952872_3954096_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|3954152_3954872_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001293116.1|3955038_3956370_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000105853.1|3956370_3957387_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124608.1|3957414_3958059_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132966.1|3958164_3959133_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_086353193.1|3959181_3960564_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093834.1|3960584_3961817_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046754.1|3961937_3963605_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409419.1|3963811_3965749_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068677.1|3965838_3966165_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001531361.1|3966243_3966771_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942350.1|3966822_3967470_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|3967466_3968336_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3968546_3969020_+	protein CreA	NA	NA	NA	NA	NA
WP_061089099.1|3969032_3969722_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	9.7e-29
WP_001219582.1|3969721_3971146_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_000920358.1|3971203_3972556_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3972615_3973332_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001295754.1|3973427_3973568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223200.1|3973967_3974654_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	4238370	4350391	5013813	transposase,tail,integrase,holin,portal,lysis,terminase	Enterobacteria_phage(35.19%)	104	4238976:4238992	4360510:4360526
WP_000006240.1|4238370_4238868_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
4238976:4238992	attL	CCGGTGCCAGATGCGCC	NA	NA	NA	NA
WP_001545817.1|4239087_4240827_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207551.1|4240771_4241557_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226176.1|4241627_4242683_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059897.1|4242679_4243132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001311432.1|4243309_4244461_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
WP_000602123.1|4244457_4245072_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293022.1|4245127_4246585_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|4246845_4247304_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189575.1|4247395_4248640_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|4248697_4249099_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749899.1|4249137_4250193_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_001285288.1|4250481_4251585_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893315.1|4251596_4252850_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
WP_061089092.1|4253076_4254219_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	1.2e-220
WP_000206732.1|4254445_4254751_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|4254750_4255113_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|4255103_4255640_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4255767_4256592_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4256657_4257020_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001312635.1|4257513_4258011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|4258333_4259026_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|4259123_4259384_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_086353198.1|4259376_4259928_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_001250269.1|4260103_4260283_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_061089069.1|4260272_4261214_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.5e-138
WP_072161726.1|4261210_4261705_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	96.3	2.8e-86
WP_001305610.1|4261704_4262358_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210173.1|4262354_4262681_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000767111.1|4262677_4263067_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061449.1|4263086_4263896_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.2e-150
WP_061089070.1|4263903_4264893_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.0e-192
WP_001504953.1|4264910_4265282_+	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	82.5	6.1e-54
WP_032083250.1|4265454_4266906_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001355891.1|4267318_4267513_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_000799656.1|4267662_4268715_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4268782_4268998_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|4268997_4269495_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|4269491_4269959_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_061089071.1|4269946_4270099_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_000349509.1|4270774_4271266_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_061089072.1|4271265_4273368_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.3	0.0e+00
WP_001072975.1|4273364_4273577_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077873861.1|4273504_4275085_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	1.6e-289
WP_061089075.1|4277143_4277467_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|4277459_4277735_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677120.1|4277746_4278337_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_152024025.1|4278333_4278735_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.3e-70
WP_000211128.1|4278745_4279489_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|4279549_4279936_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|4279944_4280274_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_061089077.1|4280245_4283302_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.6	0.0e+00
WP_000447253.1|4283301_4283631_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|4283640_4284339_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032152077.1|4284343_4285087_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_072275098.1|4284984_4285632_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	6.0e-113
WP_061089079.1|4285692_4289091_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_061089080.1|4289158_4289758_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	8.3e-101
WP_061089081.1|4289822_4292180_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	50.3	1.0e-117
WP_001204892.1|4292179_4292449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061089082.1|4292461_4293145_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.4e-58
WP_061089083.1|4293155_4293443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061089084.1|4294244_4296023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061089087.1|4297007_4297592_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000884345.1|4297612_4298056_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000671528.1|4299747_4300995_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000229741.1|4300984_4302622_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
WP_000673070.1|4302615_4305714_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_001295795.1|4305997_4306780_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_000365807.1|4306766_4307687_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000146240.1|4309604_4309790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019923.1|4310004_4310619_+	YagU family protein	NA	NA	NA	NA	NA
WP_001295797.1|4310867_4311197_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001295798.1|4311503_4312214_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265646.1|4312182_4313826_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131109.1|4313815_4316341_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716404.1|4316366_4317035_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730982.1|4317091_4317679_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|4317753_4318296_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|4319379_4319520_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4319519_4319783_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4320147_4320249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182343.1|4320721_4321864_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860035.1|4322036_4322957_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001524125.1|4323113_4324040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000910713.1|4324239_4325133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172283.1|4325163_4326153_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174452.1|4326179_4327031_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_000092553.1|4327596_4331844_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000620995.1|4331968_4332826_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295799.1|4333073_4333943_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001295800.1|4334102_4334696_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4334707_4334944_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|4335828_4337154_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_001295801.1|4337380_4338235_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102123.1|4338760_4339480_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295802.1|4339490_4340918_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001295803.1|4340910_4341606_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001005267.1|4341848_4342517_-	membrane protein	NA	NA	NA	NA	NA
WP_072017408.1|4342700_4343894_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001213045.1|4345033_4345795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295804.1|4345948_4346743_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001295805.1|4347072_4347636_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159129.1|4348720_4350391_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
4360510:4360526	attR	GGCGCATCTGGCACCGG	NA	NA	NA	NA
>prophage 9
NZ_CP021207	Escherichia coli strain strain Z247 chromosome, complete genome	5013813	4566108	4621054	5013813	tRNA,lysis,capsid,protease,head,tail,integrase,holin,portal,terminase	Enterobacteria_phage(42.31%)	64	4561096:4561112	4591203:4591219
4561096:4561112	attL	TTCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000912352.1|4566108_4567494_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143517.1|4567529_4568051_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190282.1|4568158_4568371_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4568372_4569239_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|4569601_4570765_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206813.1|4570991_4571297_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|4571296_4571659_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008237.1|4571649_4572186_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	1.8e-99
WP_086353202.1|4572313_4573138_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	3.3e-148
WP_000135682.1|4573203_4573566_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|4574036_4574552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167381.1|4574936_4576013_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	59.9	3.4e-121
WP_001535858.1|4576183_4576888_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.9	3.4e-69
WP_001535859.1|4576994_4577258_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
WP_086353204.1|4577286_4577838_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	7.6e-101
WP_001250269.1|4578013_4578193_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|4578182_4579124_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_001573323.1|4579120_4579615_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|4579614_4579941_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|4579937_4580327_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061427.1|4580346_4581189_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_001535863.1|4581196_4582186_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.4e-193
WP_001535864.1|4582199_4582952_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	2.9e-135
WP_000966854.1|4583106_4583637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317671.1|4583818_4584013_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000799651.1|4584162_4585224_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.7	2.7e-203
WP_000502162.1|4586103_4586295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284486.1|4586317_4586533_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000250557.1|4586537_4586882_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000370551.1|4586847_4587120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992182.1|4587225_4587759_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	2.6e-98
WP_001228695.1|4587975_4588158_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738425.1|4588248_4588542_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_000830178.1|4589022_4589349_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881608.1|4589555_4589738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453587.1|4590302_4590848_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_016245259.1|4590822_4592748_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
4591203:4591219	attR	TTCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000198149.1|4592744_4592951_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_086353205.1|4592947_4594549_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_086353206.1|4594529_4595849_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	6.2e-234
WP_001299443.1|4595858_4596191_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_022645311.1|4596246_4597272_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_086353207.1|4597313_4597709_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	4.1e-56
WP_000752994.1|4597720_4598074_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001595432.1|4598085_4598664_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683129.1|4598660_4599056_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_024257430.1|4599063_4599804_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_000479193.1|4599819_4600242_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|4600223_4600658_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_086353208.1|4600650_4603230_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	99.8	0.0e+00
WP_000847379.1|4603226_4603556_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_086353209.1|4603555_4604254_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	7.6e-130
WP_000194780.1|4604259_4605003_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4604939_4605572_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_086353210.1|4605632_4609115_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_001230364.1|4609181_4609781_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_086353223.1|4609845_4613205_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001598023.1|4613204_4613789_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_137556695.1|4613843_4614512_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|4615056_4616541_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086353211.1|4616727_4617681_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001111238.1|4618789_4619146_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	1.3e-53
WP_152024026.1|4619200_4619869_-	methyltransferase	NA	NA	NA	NA	NA
WP_001201838.1|4620100_4621054_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 1
NZ_CP021209	Escherichia coli strain strain Z247 plasmid p2474-MCR1, complete sequence	223982	48841	102426	223982	transposase	Salmonella_phage(41.67%)	56	NA	NA
WP_087522250.1|48841_50210_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|50309_50468_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|50886_51090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|51135_51486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031421.1|51545_52145_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778030.1|52244_53189_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001371930.1|53698_53875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272970.1|54290_55475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|55540_55822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|56078_56285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|56405_56702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|56746_57184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|57251_57788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|57952_58321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071447784.1|58753_59056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|59412_59697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|59762_60116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|60402_61134_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|61135_62317_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|62327_62990_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|62976_64086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|64085_66170_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|66169_69316_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_086353230.1|69325_70063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|70059_70545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|71303_72104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|72105_72618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|73211_74258_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|74247_75663_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_046788498.1|75671_79625_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284752.1|79805_81095_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_015059500.1|81202_81721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|81851_82391_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|82538_83288_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|83312_83705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|83738_84161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|84220_84832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|84938_85748_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|85793_87053_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|87036_87471_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|87664_88282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|88431_88788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|89038_89209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353231.1|89245_89950_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
WP_044728194.1|90023_90521_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.6e-49
WP_001138064.1|90523_93490_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_046788546.1|93498_93900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|93984_94689_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|95613_96498_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_063122217.1|96714_97929_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	25.4	1.5e-16
WP_001255015.1|97956_98262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|98373_99867_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|99897_100149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|100042_100345_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|100431_101247_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|101336_102426_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
