The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	1119536	1186360	4679064	tail,plate,capsid,terminase,head,transposase,lysis,integrase,tRNA,portal	Salmonella_phage(91.3%)	63	1119820:1119834	1155783:1155797
WP_089113803.1|1119536_1120647_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1119820:1119834	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1121443_1122247_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_000360326.1|1123499_1124162_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1124714_1125731_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1125733_1126366_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1126487_1126730_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1126763_1127273_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1127280_1127481_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1127444_1127786_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1127853_1128087_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1128086_1128314_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1128310_1129168_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1129164_1131579_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1131731_1131920_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|1131930_1132164_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1132277_1132955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1133268_1134933_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1135036_1136077_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1136076_1137843_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1137985_1138819_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730760.1|1138835_1139897_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000059173.1|1139900_1140551_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1140644_1141109_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1141108_1141312_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1141315_1141531_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1141511_1142027_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1142023_1142452_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1142547_1142979_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1142971_1143418_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1143419_1144271_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1144348_1144927_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1144923_1145283_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1145269_1146178_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1146170_1146776_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1146772_1148626_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1148625_1149201_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1150070_1150295_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046107.1|1150397_1151570_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	5.7e-223
WP_001207651.1|1151579_1152095_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1152149_1152452_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1152466_1152586_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1152578_1155386_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1155382_1155868_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1155783:1155797	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1155864_1156965_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1157033_1157252_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1157803_1158967_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1158974_1161155_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1161151_1162561_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1162625_1174100_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1174714_1175197_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1175346_1175823_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1175812_1176103_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1176268_1176607_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1176755_1178417_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1178502_1179381_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1179504_1180095_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1180129_1180735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1180855_1182142_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1182161_1182953_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1183118_1184480_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1184732_1184981_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1184999_1185548_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1185592_1186360_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	1691349	1700520	4679064	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1691349_1692297_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1692280_1693012_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1692992_1693100_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1693159_1693891_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1694113_1695799_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1695795_1696515_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1696561_1697029_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1697085_1697616_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1697787_1698246_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1698486_1700520_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	1767717	1778221	4679064		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1767717_1769121_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1769298_1770192_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|1770565_1771651_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1771650_1772550_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1772597_1773476_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1773476_1774028_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1774033_1775008_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1775023_1775797_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1775801_1776881_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1776907_1778221_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	2430128	2446072	4679064	tRNA,holin	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2430128_2430563_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2430612_2430951_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2431590_2431764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2431796_2432342_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2432338_2432620_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2432609_2432798_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2432719_2433115_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2435285_2435822_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2435818_2436109_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436108_2436708_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2436770_2436941_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2437231_2437444_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2437813_2438746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2438742_2439297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2439458_2439788_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2440060_2440528_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2440912_2441068_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441175_2441697_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2442134_2442356_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2442440_2442758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2442785_2443403_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2443719_2444655_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2444698_2446072_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	2636910	2686160	4679064	tail,holin,lysis,integrase,protease	Salmonella_phage(27.27%)	48	2666675:2666704	2686296:2686325
WP_000984498.1|2636910_2637792_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2637985_2640034_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2640053_2640740_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2640837_2641335_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2641463_2642747_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2642715_2645349_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2645426_2646866_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2646983_2647220_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2647330_2647522_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2647540_2648191_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2648414_2648579_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2648863_2649586_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2650269_2650665_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2650994_2651471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2651843_2652263_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2652635_2652905_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2653070_2653211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2656349_2657264_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2657396_2657555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2657564_2658179_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2658666_2658813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2659313_2659439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2660008_2660209_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2660305_2660806_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348542.1|2662910_2663402_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.6e-41
WP_001576014.1|2663456_2663645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2663709_2663877_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2664133_2664667_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2664720_2664951_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2665140_2665635_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2666278_2666548_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2666675:2666704	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2667492_2668293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2668772_2669495_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2673549_2674245_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2674334_2674868_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2675762_2676242_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2676259_2676712_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2676695_2677025_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2677300_2677987_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2678347_2678797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2679170_2679695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2679791_2680481_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2680610_2680838_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2680834_2681434_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2681497_2681746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2682434_2684414_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2684827_2685106_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2685080_2686160_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2686296:2686325	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	2858551	2898818	4679064	protease,tail	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2858551_2859232_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2859850_2860510_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2860596_2860926_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2860922_2861204_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2861252_2862032_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862057_2862606_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2862820_2864032_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864089_2864407_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2864451_2864865_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2865038_2865701_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2865795_2866254_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866289_2868344_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868467_2868914_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2868932_2871086_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2871072_2871678_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2871894_2872404_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2872760_2873813_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2873884_2874337_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2874522_2876283_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876351_2876870_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2876969_2877137_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877392_2877956_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2877952_2879593_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2879597_2880851_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2880865_2882773_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2882785_2884894_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2884992_2886102_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2886098_2886641_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2886806_2887817_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2888024_2890637_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2891063_2891255_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891525_2892212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892571_2893198_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2893845_2894814_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2895039_2895288_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2895291_2895873_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2895872_2897582_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2897578_2898205_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2898188_2898818_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 7
NZ_CP020823	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 chromosome, complete genome	4679064	2970528	2977841	4679064	integrase,protease	Ralstonia_phage(16.67%)	7	2965325:2965339	2976577:2976591
2965325:2965339	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2970528_2970906_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971067_2971265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934059.1|2971477_2973754_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_000520789.1|2973784_2974105_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974428_2974650_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2974779_2976726_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2976577:2976591	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2976722_2977841_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP020824	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 plasmid pCFSAN033541, complete sequence	59372	30141	37049	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|30141_30558_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|30741_31077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|31133_31739_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|31735_32677_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|33091_34297_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064277.1|34296_35271_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000457542.1|35352_36627_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|36626_37049_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
