The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	15956	77395	2275603	tRNA,transposase	unidentified_phage(23.08%)	57	NA	NA
WP_012655924.1|15956_17228_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	3.1e-89
WP_012655925.1|17455_17971_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_086037787.1|18102_19014_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_086037788.1|19043_21005_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_012655928.1|21006_21453_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_012655929.1|21470_22877_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	7.9e-110
WP_012655930.1|23199_24489_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.3	1.9e-70
WP_012655931.1|24572_25460_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	30.7	2.6e-34
WP_012655932.1|25878_26580_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	1.2e-42
WP_012655933.1|26584_28423_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	29.9	6.8e-29
WP_157821110.1|28415_29729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037790.1|29728_30520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037791.1|30537_31329_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.6	5.7e-41
WP_086037792.1|31589_32069_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_157820114.1|32209_32374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037793.1|32463_33564_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.8e-45
WP_086037794.1|33741_34224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037795.1|34210_35170_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_162485192.1|35365_36283_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_086037797.1|36330_36912_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_086037798.1|36949_37507_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_157821122.1|37517_37829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101033591.1|37844_38048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086037801.1|38025_38592_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_086037802.1|39205_40600_-	MFS transporter	NA	NA	NA	NA	NA
WP_086037803.1|40601_41780_-	amidohydrolase	NA	NA	NA	NA	NA
WP_157819846.1|41917_44143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086037805.1|45081_46053_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.1	1.2e-21
WP_086037806.1|46049_47036_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_086037807.1|47104_48043_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086037795.1|48235_49195_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_076688030.1|49965_51069_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
WP_086039347.1|51230_51449_-|transposase	transposase	transposase	A0A2H4PQV6	Staphylococcus_phage	65.5	1.5e-12
WP_086037808.1|52815_53571_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_086039348.1|53756_54185_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_086037809.1|54203_54719_+	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_086037810.1|54731_55664_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_086037811.1|55667_56648_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_086037812.1|56668_56983_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086037813.1|56988_58716_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_086037814.1|58731_60138_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_086039349.1|62026_62575_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_086037815.1|62561_63197_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_012655949.1|63299_63659_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086037816.1|63931_64411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037817.1|64431_65451_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_086039350.1|65462_66959_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_086037818.1|66967_67831_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_086037819.1|67839_69321_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_086037820.1|69317_70364_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_086037821.1|70521_70914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037822.1|70954_73216_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.6	1.0e-127
WP_012655952.1|73380_74709_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086037823.1|74859_75312_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_012655954.1|75565_75919_+	membrane protein	NA	NA	NA	NA	NA
WP_157819689.1|75965_76109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086037824.1|76291_77395_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.2	1.2e-52
>prophage 2
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	528481	542210	2275603	transposase	Acinetobacter_phage(22.22%)	12	NA	NA
WP_086038231.1|528481_530248_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	8.2e-72
WP_086038233.1|530312_531233_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.4e-27
WP_086038235.1|531232_532747_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_086038236.1|532831_533884_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.7	7.6e-17
WP_086039362.1|533949_534483_+	5'(3')-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	38.9	1.6e-26
WP_086038238.1|534563_535472_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.0	1.4e-11
WP_086038240.1|535557_537069_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.4	7.0e-72
WP_086038241.1|537353_538868_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.9	5.7e-74
WP_086037795.1|538983_539943_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086038242.1|540096_540597_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	65.1	1.2e-49
WP_086038243.1|540603_541461_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012656390.1|541820_542210_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	54.5	2.5e-34
>prophage 3
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	553214	560589	2275603	transposase	Streptococcus_phage(50.0%)	7	NA	NA
WP_086038260.1|553214_554279_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.2	5.0e-16
WP_086038262.1|554293_555151_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.0	5.2e-32
WP_086038264.1|555341_556388_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_086038266.1|556401_557040_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	50.3	8.7e-32
WP_076688030.1|557218_558322_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
WP_086038267.1|558454_559306_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	4.3e-10
WP_162485201.1|559371_560589_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	32.2	2.0e-40
>prophage 4
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	604742	643319	2275603	capsid,portal,integrase,tail,terminase,head	Staphylococcus_phage(51.61%)	55	607825:607849	645589:645613
WP_012656452.1|604742_605978_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	49.6	2.5e-120
WP_012656453.1|605967_606432_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012656454.1|606452_607850_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
607825:607849	attL	TCGAAATGGAAGGCTCGATTGGATA	NA	NA	NA	NA
WP_086038304.1|607917_608964_-|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	67.0	1.8e-135
WP_086038305.1|609037_609643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038306.1|609660_609960_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_086038307.1|610017_610503_-	hypothetical protein	NA	A0A2H4JD66	uncultured_Caudovirales_phage	55.3	1.6e-46
WP_086038308.1|610515_610860_-	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	36.3	4.5e-11
WP_086038309.1|611028_611238_+	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	50.7	3.0e-10
WP_086038310.1|611281_611551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038311.1|611547_611736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485202.1|611828_612581_+	phage repressor protein	NA	A0A223LGF6	Staphylococcus_phage	42.1	2.3e-39
WP_086038313.1|612570_612843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038314.1|612823_613156_+	helix-turn-helix domain-containing protein	NA	A0A2H4IYS0	uncultured_Caudovirales_phage	72.4	2.4e-33
WP_162485203.1|613346_613847_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_162485204.1|613827_614142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038317.1|614143_614359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038318.1|614355_614619_-	CRISPR-associated protein Cas2	NA	A0A0N9STP5	Staphylococcus_phage	64.4	8.5e-26
WP_086038319.1|614678_614864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820110.1|614860_615037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038320.1|615095_615287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485205.1|615317_615479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038321.1|615528_615822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038322.1|615833_617777_+	hypothetical protein	NA	A0A0N9SKM4	Staphylococcus_phage	43.2	4.2e-138
WP_086038323.1|617766_617982_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086038324.1|617985_618888_+	recombinase RecT	NA	A0A2I6PDH5	Staphylococcus_phage	81.1	1.4e-115
WP_086038325.1|618953_619592_+	MBL fold metallo-hydrolase	NA	A0A1Q1PVV0	Staphylococcus_phage	61.8	1.7e-72
WP_086038326.1|619588_620056_+	single-stranded DNA-binding protein	NA	A0A1Q1PW11	Staphylococcus_phage	55.4	1.8e-42
WP_086038327.1|620071_620974_+	hypothetical protein	NA	A0A0B5D175	Listeria_phage	45.5	1.1e-43
WP_041635924.1|620974_621220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038328.1|621231_621585_+	hypothetical protein	NA	B5SP14	Lactococcus_phage	32.3	2.8e-08
WP_086038329.1|621640_621835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038330.1|622227_622752_+	hypothetical protein	NA	Q4ZBS9	Staphylococcus_virus	49.1	3.3e-37
WP_162485206.1|622848_623007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038331.1|622993_623419_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1D6Z252	Staphylococcus_phage	56.5	5.4e-38
WP_086039363.1|624102_624423_+	DUF3310 domain-containing protein	NA	A0A1D6Z251	Staphylococcus_phage	53.7	3.9e-17
WP_086038332.1|624491_625052_+	hypothetical protein	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	31.2	3.7e-10
WP_086038333.1|625199_625391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635927.1|625476_625956_+	hypothetical protein	NA	A0A0N9BAX3	Staphylococcus_phage	43.3	1.5e-23
WP_086038334.1|625948_627199_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0H3U2R6	Staphylococcus_phage	80.7	7.1e-195
WP_086038335.1|627211_628648_+|portal	phage portal protein	portal	Q4ZE36	Staphylococcus_virus	58.7	7.7e-153
WP_086038336.1|628628_630413_+|capsid	minor capsid protein	capsid	Q4ZE35	Staphylococcus_virus	42.3	2.3e-61
WP_086038337.1|630480_631146_+	DUF4355 domain-containing protein	NA	H9A0N2	Staphylococcus_phage	44.8	1.2e-12
WP_086038338.1|631161_632073_+|capsid	capsid protein	capsid	Q4ZE33	Staphylococcus_virus	64.3	5.8e-98
WP_086038339.1|632118_632385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012656834.1|632368_632692_+|head,tail	phage head-tail connector protein	head,tail	A0A1W6JNR3	Staphylococcus_phage	45.9	2.3e-17
WP_162485207.1|632688_632994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038341.1|632987_633332_+	hypothetical protein	NA	I1W643	Staphylococcus_phage	37.8	2.9e-10
WP_086038342.1|633336_633720_+	DUF3168 domain-containing protein	NA	B7T0D6	Staphylococcus_virus	28.2	1.8e-08
WP_086038343.1|633731_634286_+|tail	phage major tail protein, TP901-1 family	tail	A0A2P1JTU8	Anoxybacillus_phage	38.7	6.8e-25
WP_012656838.1|634352_634730_+	hypothetical protein	NA	A0A1J0MFH0	Staphylococcus_phage	50.4	9.4e-26
WP_083754262.1|634759_635095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038344.1|635109_639654_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	42.1	1.7e-97
WP_086038345.1|639696_640509_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_086038346.1|640505_643319_+	hypothetical protein	NA	Q4ZD63	Staphylococcus_phage	78.1	7.0e-41
645589:645613	attR	TCGAAATGGAAGGCTCGATTGGATA	NA	NA	NA	NA
>prophage 5
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	806524	816401	2275603		Synechococcus_phage(42.86%)	10	NA	NA
WP_086038464.1|806524_807007_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.4	1.3e-19
WP_086038465.1|806993_808112_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_086038466.1|808108_808810_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	40.8	5.2e-46
WP_012656598.1|808811_809072_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_086038467.1|809071_809734_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_086038468.1|809736_811923_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.2	3.3e-139
WP_086038469.1|811901_813320_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	28.7	1.0e-48
WP_086038470.1|813322_814348_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	39.4	3.0e-58
WP_086038471.1|814344_814911_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.6	2.5e-30
WP_086038472.1|814922_816401_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	3.9e-75
>prophage 6
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	1039848	1098228	2275603	capsid,portal,holin,tRNA,integrase,tail,transposase,terminase,head,protease	Staphylococcus_phage(38.71%)	72	1063001:1063015	1072850:1072864
WP_012656793.1|1039848_1041378_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_012656794.1|1041380_1041806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012656795.1|1041895_1044436_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	4.2e-45
WP_086038594.1|1044445_1046347_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.6	1.0e-59
WP_012656797.1|1046346_1046889_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_012656798.1|1047022_1047841_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_012656799.1|1047859_1049353_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_086038595.1|1049373_1051047_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_086039366.1|1051195_1052494_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.2	2.5e-126
WP_012656801.1|1052739_1053636_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.4	5.2e-06
WP_012656802.1|1053628_1054567_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_086038596.1|1054792_1055266_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.8	2.0e-25
WP_012656804.1|1055324_1056602_+	GTPase HflX	NA	NA	NA	NA	NA
WP_086038597.1|1056606_1057866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635912.1|1057952_1058306_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086038598.1|1058322_1059660_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_086038599.1|1059756_1060923_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	28.4	1.2e-23
WP_157820203.1|1060992_1061619_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_086038601.1|1061678_1062164_-	hypothetical protein	NA	A0A2H4JD66	uncultured_Caudovirales_phage	55.6	7.3e-47
WP_086038308.1|1062176_1062521_-	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	36.3	4.5e-11
WP_086038309.1|1062689_1062899_+	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	50.7	3.0e-10
WP_086038310.1|1062942_1063212_+	hypothetical protein	NA	NA	NA	NA	NA
1063001:1063015	attL	AAAAGTTGAATGATT	NA	NA	NA	NA
WP_086038311.1|1063208_1063397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485202.1|1063489_1064242_+	phage repressor protein	NA	A0A223LGF6	Staphylococcus_phage	42.1	2.3e-39
WP_086038313.1|1064231_1064504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038602.1|1064484_1065492_+	DnaD domain protein	NA	A0A2H4IYS0	uncultured_Caudovirales_phage	72.4	7.3e-33
WP_162485204.1|1065472_1065787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038603.1|1065788_1065980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038604.1|1065954_1066155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038605.1|1066336_1066537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038606.1|1066628_1066958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038607.1|1066996_1067518_+	hypothetical protein	NA	A0A1B1INA7	uncultured_Mediterranean_phage	43.8	3.1e-11
WP_086038608.1|1067510_1067993_+	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	69.4	2.5e-55
WP_086038609.1|1068006_1068348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038610.1|1068358_1068607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038611.1|1068619_1068862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038612.1|1068875_1069409_+	hypothetical protein	NA	C5J992	Streptococcus_phage	35.0	3.9e-17
WP_086038613.1|1069603_1070116_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.0	1.3e-17
WP_157819807.1|1070126_1070279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038614.1|1070476_1070926_+	hypothetical protein	NA	A0A1B1P7X5	Bacillus_phage	35.4	1.0e-15
WP_086038615.1|1070925_1071474_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	55.9	1.2e-53
WP_086038616.1|1071682_1072123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039372.1|1072281_1072629_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	48.7	3.7e-21
WP_012657433.1|1072761_1073247_+|terminase	phage terminase small subunit P27 family	terminase	D7PQ38	Enterococcus_phage	35.5	5.8e-12
1072850:1072864	attR	AAAAGTTGAATGATT	NA	NA	NA	NA
WP_086038617.1|1073243_1074950_+|terminase	terminase	terminase	D2JLE4	Staphylococcus_phage	51.2	5.2e-156
WP_157827310.1|1074946_1075120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485211.1|1075201_1076365_+|portal	phage portal protein	portal	A0A0D4DC70	Staphylococcus_phage	33.6	2.1e-47
WP_041636125.1|1076348_1076918_+|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	48.8	2.3e-44
WP_086038619.1|1076927_1078061_+|capsid	phage major capsid protein	capsid	A0A2H4J7D0	uncultured_Caudovirales_phage	35.0	1.5e-34
WP_086038620.1|1078075_1078282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636122.1|1078262_1078598_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0D4DBY0	Staphylococcus_phage	33.7	2.5e-06
WP_012657427.1|1078566_1078890_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_012657426.1|1078886_1079279_+	HK97 gp10 family phage protein	NA	D2JLF2	Staphylococcus_phage	33.3	2.8e-09
WP_086038621.1|1079275_1079665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012657424.1|1079677_1080265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012657423.1|1080335_1080689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158298083.1|1080748_1080898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038622.1|1080922_1085284_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4J669	uncultured_Caudovirales_phage	36.6	1.1e-82
WP_086038623.1|1085293_1086814_+	hypothetical protein	NA	A0A1Q1PW27	Staphylococcus_phage	55.2	9.9e-167
WP_086038624.1|1086829_1090174_+	hypothetical protein	NA	A0A1Q1PVY1	Staphylococcus_phage	45.3	1.6e-249
WP_086038625.1|1090175_1090574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820106.1|1090557_1090728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038626.1|1090772_1091060_+	hypothetical protein	NA	A0A1J0MFP4	Staphylococcus_phage	69.9	5.4e-26
WP_086038627.1|1091074_1091587_+|holin	phage holin family protein	holin	H9A0W5	Staphylococcus_phage	53.0	1.3e-38
WP_086038628.1|1092703_1093000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038629.1|1092989_1093391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038630.1|1093353_1093605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037795.1|1094042_1095002_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086038631.1|1095035_1095461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038632.1|1095931_1096321_-	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.6	5.3e-16
WP_086038633.1|1096588_1097092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086037795.1|1097268_1098228_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	1327388	1374605	2275603	terminase,holin	Staphylococcus_phage(27.5%)	72	NA	NA
WP_086038777.1|1327388_1327820_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	37.2	1.3e-15
WP_086038778.1|1327909_1328128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038779.1|1328127_1328718_-	ParB-like nuclease domain-containing protein	NA	L0P6I1	Lactobacillus_phage	76.0	1.7e-82
WP_086038780.1|1328623_1329907_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	60.2	2.4e-153
WP_086038781.1|1329906_1331067_-	hypothetical protein	NA	A0A220GFH1	Streptococcus_phage	53.3	2.1e-108
WP_086038782.1|1331126_1331492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038783.1|1331469_1332108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038784.1|1332130_1332526_-	hypothetical protein	NA	B4XYR0	Lactobacillus_phage	61.8	1.2e-36
WP_086038785.1|1332655_1332925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038786.1|1333034_1333796_-	hypothetical protein	NA	D7RWK6	Brochothrix_phage	41.4	8.8e-39
WP_086038787.1|1333797_1334064_-|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	41.7	4.4e-06
WP_086038788.1|1334106_1334427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038789.1|1334457_1334745_-	hypothetical protein	NA	Q4ZD61	Staphylococcus_phage	60.4	3.9e-24
WP_162485214.1|1334790_1334958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038790.1|1334950_1339066_-	hypothetical protein	NA	A0A1Q1PW30	Staphylococcus_phage	29.5	7.3e-71
WP_086038791.1|1339065_1339500_-	hypothetical protein	NA	A0A286QMT6	Streptococcus_phage	30.5	4.3e-06
WP_086038792.1|1339489_1345354_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1D6Z289	Staphylococcus_phage	40.5	2.8e-92
WP_086038793.1|1345393_1345777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038794.1|1345731_1346253_-	hypothetical protein	NA	A0A218KCI2	Bacillus_phage	34.6	1.1e-08
WP_086038795.1|1346328_1346907_-	hypothetical protein	NA	M4ZS18	Bacillus_phage	40.0	7.1e-33
WP_086038796.1|1346970_1347351_-	hypothetical protein	NA	A0A2H4JAC9	uncultured_Caudovirales_phage	39.8	2.0e-15
WP_157821166.1|1347355_1347838_-	HK97 gp10 family phage protein	NA	A0A1U9WQQ7	Geobacillus_phage	48.1	1.0e-32
WP_157821669.1|1347827_1348160_-	hypothetical protein	NA	A0A218KCG8	Bacillus_phage	34.9	6.1e-05
WP_086038798.1|1348171_1348555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038799.1|1348572_1348848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038800.1|1348894_1349908_-	hypothetical protein	NA	A0A2H4J2G1	uncultured_Caudovirales_phage	37.5	1.6e-59
WP_086038801.1|1349927_1350293_-	hypothetical protein	NA	M4ZRN2	Bacillus_phage	38.9	2.2e-11
WP_086038802.1|1350307_1350904_-	hypothetical protein	NA	L0P7B0	Lactobacillus_phage	27.8	2.4e-15
WP_086038803.1|1351158_1351416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038804.1|1351430_1351646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038805.1|1351623_1352712_-	hypothetical protein	NA	A0A2H4J2F6	uncultured_Caudovirales_phage	41.8	3.6e-70
WP_086038806.1|1352716_1354336_-	hypothetical protein	NA	A0A1U9WQP5	Geobacillus_phage	46.2	6.7e-129
WP_086038807.1|1354348_1355641_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	56.8	4.8e-130
WP_086038808.1|1355637_1356351_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	36.1	4.7e-26
WP_086038809.1|1356461_1356890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038810.1|1357164_1357569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038811.1|1357585_1358071_-	Holliday junction resolvase RecU	NA	H9A0M5	Staphylococcus_phage	45.6	1.8e-29
WP_086038812.1|1358119_1358647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162485215.1|1358650_1358821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038813.1|1358817_1359186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101141824.1|1359302_1359542_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086038815.1|1359564_1359792_-	hypothetical protein	NA	A0A1J0MFK9	Staphylococcus_phage	47.9	3.0e-11
WP_086038816.1|1359813_1360032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038817.1|1360053_1360446_-	hypothetical protein	NA	U6E9D1	Streptococcus_phage	49.2	4.7e-28
WP_086038818.1|1360483_1360864_-	hypothetical protein	NA	A0A2H4JBP1	uncultured_Caudovirales_phage	40.4	1.1e-13
WP_157820873.1|1360875_1361145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038820.1|1361141_1362299_-	DUF3310 domain-containing protein	NA	A0A1W6JPA2	Staphylococcus_phage	55.1	2.8e-12
WP_086038821.1|1362301_1362529_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	44.6	4.0e-08
WP_086038822.1|1362531_1362924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038823.1|1362936_1363116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038824.1|1363112_1363334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038825.1|1363330_1363609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038826.1|1363635_1364130_-	single-stranded DNA-binding protein	NA	A0A141VTR6	Staphylococcus_phage	44.2	4.8e-30
WP_162485216.1|1364126_1364789_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	33.9	1.0e-19
WP_086038828.1|1364778_1364979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162485217.1|1364975_1365152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820871.1|1365123_1365300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157821557.1|1365296_1365473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162485218.1|1365465_1366128_-	hypothetical protein	NA	A0A2K9V4I2	Staphylococcus_phage	39.2	2.0e-10
WP_086038830.1|1366105_1366891_-	ATP-binding protein	NA	A0A2I6PDA0	Staphylococcus_phage	35.0	2.3e-34
WP_086038831.1|1366868_1367753_-	DnaD domain protein	NA	A0A141E184	Streptococcus_phage	36.2	7.3e-37
WP_086038832.1|1367766_1368483_-	MBL fold metallo-hydrolase	NA	A0A0H4TGC9	Bacillus_phage	52.7	4.3e-64
WP_086038833.1|1368482_1369235_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	59.3	1.9e-70
WP_086038834.1|1369236_1371213_-	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	34.8	4.4e-90
WP_086038835.1|1371212_1371395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038836.1|1371391_1372162_-	Rha family transcriptional regulator	NA	A0A2H4JCT2	uncultured_Caudovirales_phage	73.1	1.7e-98
WP_041635943.1|1372291_1372528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086038837.1|1372621_1372813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038838.1|1372814_1373060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086038839.1|1373198_1373702_-	hypothetical protein	NA	A0A290FZK9	Caldibacillus_phage	26.2	6.9e-08
WP_162485219.1|1373817_1374078_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086038841.1|1374230_1374605_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	40.6	3.1e-05
>prophage 8
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	1458345	1476320	2275603	tRNA	uncultured_Mediterranean_phage(27.27%)	14	NA	NA
WP_086038886.1|1458345_1460124_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	28.1	1.1e-15
WP_133453145.1|1460127_1461390_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.4	3.4e-19
WP_012657174.1|1461689_1462535_-	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	34.5	5.2e-16
WP_012657175.1|1462531_1462984_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_086038888.1|1462992_1465185_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	39.1	3.1e-12
WP_012657177.1|1465289_1465811_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	9.6e-29
WP_086038889.1|1465821_1468083_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.1	2.9e-69
WP_041636044.1|1468110_1469226_-	amidohydrolase	NA	NA	NA	NA	NA
WP_012657180.1|1469218_1470334_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.3	3.5e-12
WP_012657181.1|1470485_1472777_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.4	4.2e-28
WP_041636045.1|1472840_1473119_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	37.5	3.8e-08
WP_086038890.1|1473130_1474270_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	4.9e-86
WP_012657183.1|1474281_1475304_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_086038891.1|1475306_1476320_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.3	6.2e-08
>prophage 9
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	1655004	1732116	2275603	holin,transposase	Staphylococcus_phage(50.0%)	85	NA	NA
WP_162485234.1|1655004_1655949_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.8	1.3e-39
WP_012657353.1|1655995_1656733_-	nicotinamide mononucleotide transporter	NA	U5J9C5	Bacillus_phage	37.4	5.0e-31
WP_086038992.1|1656743_1657838_-	AAA family ATPase	NA	A0A2K9VDE3	Lactobacillus_phage	38.3	9.9e-68
WP_086038993.1|1658132_1658690_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_086038994.1|1658960_1659953_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	59.8	6.4e-106
WP_086038995.1|1659989_1660454_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	68.7	1.1e-41
WP_086038996.1|1660450_1661641_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	57.3	1.0e-126
WP_086038997.1|1661640_1662264_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.4	3.7e-43
WP_086038998.1|1662268_1663294_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	3.2e-60
WP_086039386.1|1663922_1665155_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_086038999.1|1665173_1666823_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_086039000.1|1666954_1667842_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086039001.1|1667801_1668737_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_086039002.1|1668729_1670181_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_086039003.1|1670296_1671427_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	32.6	2.5e-13
WP_086039004.1|1671428_1672073_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086039005.1|1672073_1672973_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086039006.1|1672972_1673662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086039007.1|1673683_1674466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039008.1|1674502_1675330_-	hypothetical protein	NA	A0A0F6N4K6	Staphylococcus_phage	46.6	1.2e-49
WP_041636094.1|1675330_1675531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039009.1|1675698_1676007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039010.1|1676059_1676302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039387.1|1676626_1676794_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086039011.1|1676873_1678277_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.5	2.9e-48
WP_162485235.1|1678295_1680032_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_086039013.1|1680034_1680349_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086039014.1|1680370_1681351_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_086039015.1|1681354_1682287_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_086039016.1|1682299_1682815_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_086039017.1|1682834_1683263_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_086039018.1|1683450_1684206_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_086039019.1|1684336_1684681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039020.1|1684793_1685591_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_086039021.1|1685715_1685916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039022.1|1685912_1686161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039023.1|1686283_1686814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039024.1|1687087_1687318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076688030.1|1687487_1688591_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
WP_086039025.1|1688710_1690024_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_041636466.1|1690055_1690433_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086039026.1|1690694_1691846_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	28.2	4.0e-11
WP_086039027.1|1692024_1692246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086037795.1|1692281_1693241_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086039028.1|1693697_1694198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086037793.1|1694455_1695556_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.8e-45
WP_086039029.1|1695631_1695850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039030.1|1696255_1697578_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.2	1.8e-111
WP_086039031.1|1697719_1698178_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012657379.1|1698562_1698997_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	40.8	9.8e-11
WP_086039032.1|1699170_1699407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636101.1|1699665_1699893_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086039033.1|1700011_1700860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039034.1|1700973_1701381_-	DNA mismatch endonuclease Vsr	NA	NA	NA	NA	NA
WP_012657382.1|1701562_1702804_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E0F9	Streptococcus_phage	28.9	1.1e-30
WP_086039388.1|1703149_1704430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039035.1|1704498_1707069_-	DEAD/DEAH box helicase family protein	NA	G3MAX4	Bacillus_virus	23.1	6.7e-06
WP_086039036.1|1707068_1708340_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_157819722.1|1708352_1708739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086037793.1|1708749_1709850_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.8e-45
WP_086039038.1|1709954_1710308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039039.1|1710486_1711272_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_086039040.1|1711291_1711480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039041.1|1711784_1712054_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_086039042.1|1712053_1713241_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	58.8	6.4e-137
WP_086039043.1|1713429_1713747_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	63.5	2.8e-31
WP_086039044.1|1713746_1715036_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	77.4	2.1e-181
WP_086039045.1|1715053_1715449_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	83.2	8.0e-60
WP_086039046.1|1715736_1719267_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.9	3.2e-19
WP_086039047.1|1719361_1719556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039048.1|1719660_1720371_-	transaldolase	NA	E3SIL2	Synechococcus_phage	33.9	4.2e-19
WP_041636109.1|1720505_1720802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039049.1|1720840_1721176_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	42.1	1.7e-07
WP_012657401.1|1721172_1721505_+	CrcB family protein	NA	NA	NA	NA	NA
WP_076688030.1|1721574_1722678_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
WP_157820026.1|1722930_1723845_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	44.8	9.5e-56
WP_086039051.1|1724062_1724245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039052.1|1724286_1725477_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	78.6	9.8e-170
WP_101142364.1|1725783_1727457_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	69.3	2.6e-216
WP_157819703.1|1727506_1728265_-	prolyl oligopeptidase family serine peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	49.2	3.3e-54
WP_012657406.1|1728242_1728722_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_041636113.1|1728759_1729518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636114.1|1729527_1729752_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	65.8	1.8e-24
WP_133433261.1|1729787_1730750_-	hypothetical protein	NA	A0A2H4PQM0	Staphylococcus_phage	34.1	2.3e-36
WP_162485224.1|1730733_1732116_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	41.3	3.4e-89
>prophage 10
NZ_CP021058	Macrococcus caseolyticus strain IMD0819 chromosome, complete genome	2275603	1751417	1785246	2275603	integrase,transposase	unidentified_phage(28.57%)	33	1768101:1768129	1774871:1774899
WP_086039389.1|1751417_1752716_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.2	1.6e-125
WP_086039069.1|1752887_1753829_-	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_086039070.1|1753829_1756751_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_086039071.1|1756740_1757925_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_086039072.1|1758085_1759555_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_041636153.1|1759645_1760002_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_157821134.1|1760056_1761187_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_012657468.1|1761321_1761786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012657469.1|1761962_1763258_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_086039074.1|1763433_1764315_+	cation transporter	NA	NA	NA	NA	NA
WP_147278850.1|1764985_1765474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039076.1|1765907_1766231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039077.1|1766345_1766711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157821140.1|1767926_1768091_-	hypothetical protein	NA	NA	NA	NA	NA
1768101:1768129	attL	CTCCTTTTTTCAAATACACGAACTTGTGC	NA	NA	NA	NA
WP_086039078.1|1768433_1768721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039079.1|1768710_1769100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039080.1|1769682_1770039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031775848.1|1770439_1770931_-	trimethoprim-resistant dihydrofolate reductase DfrK	NA	G3MBI7	Bacillus_virus	46.6	1.8e-37
WP_020977319.1|1771050_1771428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031775849.1|1771434_1773327_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
WP_031775850.1|1773323_1774409_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	27.1	8.2e-14
WP_086039390.1|1774528_1774783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076688030.1|1775653_1776757_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
1774871:1774899	attR	CTCCTTTTTTCAAATACACGAACTTGTGC	NA	NA	NA	NA
WP_086039082.1|1776916_1777225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039083.1|1777302_1777956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086039084.1|1778117_1778624_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	41.9	3.8e-22
WP_086039085.1|1778719_1778875_+	YydF family exported signaling peptide	NA	NA	NA	NA	NA
WP_086039086.1|1778942_1779905_+	YydG family peptide radical SAM peptide maturase	NA	NA	NA	NA	NA
WP_086039087.1|1779879_1780635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086039088.1|1780650_1781274_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_076688030.1|1781681_1782785_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.1e-53
WP_086039090.1|1783512_1784079_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	43.4	1.2e-32
WP_086037795.1|1784286_1785246_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
