The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	8850	61011	2239921	transposase,protease	Staphylococcus_phage(21.05%)	41	NA	NA
WP_042513824.1|8850_10101_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|10179_10632_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003682303.1|10888_11182_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_035435868.1|11222_11948_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.4	5.6e-35
WP_003682305.1|11986_12223_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_035435870.1|12347_14381_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003685631.1|14380_14833_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_035435873.1|14877_16281_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.3	3.5e-110
WP_021349470.1|16364_17540_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	1.7e-44
WP_003682310.1|17551_17884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513823.1|18123_19410_-|transposase	ISL3 family transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	20.6	2.5e-09
WP_014562466.1|19687_20686_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_003685635.1|21204_21912_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_014562047.1|21923_23783_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	2.2e-35
WP_003682313.1|23766_25065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562049.1|25066_25867_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_003682315.1|25881_26697_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	4.1e-34
WP_003682316.1|26771_28043_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
WP_021350198.1|28550_29030_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003685648.1|29244_29670_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562051.1|29675_30611_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035436613.1|30990_32334_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_035436615.1|32346_34593_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003682323.1|34739_35408_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_003682325.1|35794_35983_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_035436617.1|36136_37114_-	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	2.5e-14
WP_003682327.1|37168_38104_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003682328.1|38406_39399_-	D-2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	31.8	4.8e-37
WP_035436619.1|39414_40599_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682330.1|40947_41178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562056.1|41282_43376_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	5.1e-121
WP_012390672.1|43676_45137_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_024500595.1|45619_49357_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_035436629.1|49363_53377_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.4	3.3e-12
WP_003685671.1|53376_54240_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	5.6e-58
WP_035436630.1|54477_56103_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003682345.1|56396_56753_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_035436631.1|56790_57906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003682349.1|57898_58630_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	1.4e-25
WP_086031729.1|59211_60462_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	9.0e-57
WP_086031730.1|60540_61011_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.9e-32
>prophage 2
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	90226	147621	2239921	transposase,holin,tRNA	unidentified_phage(18.18%)	49	NA	NA
WP_003682400.1|90226_91525_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
WP_035436589.1|91887_92901_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436592.1|93158_94412_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
WP_014562075.1|94879_96334_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_035436595.1|96337_97081_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-33
WP_014562076.1|97400_98774_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562466.1|99278_100277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_107504371.1|101712_101802_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035437017.1|102268_103618_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.6	1.2e-123
WP_021349242.1|105287_106487_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_003685735.1|106720_107641_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021350222.1|107829_108567_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003685743.1|108585_109521_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_014562081.1|109534_110368_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	1.0e-16
WP_003682416.1|110380_110581_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003682418.1|110596_111694_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_015638460.1|111727_112501_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003685751.1|112771_113914_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.4	5.7e-58
WP_035437022.1|115268_116039_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035437024.1|116055_116796_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_035437027.1|116822_117593_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035437030.1|117623_118565_+	GDP-mannose 4,6-dehydratase	NA	A0A1V0SAI6	Catovirus	36.3	5.0e-44
WP_035437032.1|118542_119208_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_035437035.1|119244_120078_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_035437038.1|120213_121152_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_051132372.1|121195_121681_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	26.5	4.0e-05
WP_035437042.1|121720_122245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437044.1|122249_123350_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_035437047.1|123460_124999_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_035437052.1|125010_126153_+	EpsG family protein	NA	NA	NA	NA	NA
WP_014562705.1|126326_127514_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_014562705.1|127991_129179_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_086031733.1|129625_129982_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_086031734.1|130145_131078_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	8.5e-28
WP_080650604.1|131073_131739_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_086031735.1|131928_133068_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	3.3e-42
WP_051132360.1|134020_135106_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_086031736.1|136684_136972_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031737.1|136995_137901_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.3	1.2e-39
WP_035436068.1|138284_139166_-	glycosyl transferase family 14	NA	NA	NA	NA	NA
WP_154244354.1|139588_140350_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	96.4	4.1e-137
WP_002816285.1|140403_140655_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_086031739.1|140900_141896_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.7	3.1e-36
WP_086031740.1|142080_143100_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.0e-42
WP_023487886.1|143318_144506_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_111522973.1|144679_144775_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_035437548.1|144888_145395_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035437552.1|145591_146281_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_035437547.1|146478_147621_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	3.2e-29
>prophage 3
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	152875	208818	2239921	transposase	Lactobacillus_phage(19.05%)	44	NA	NA
WP_086031742.1|152875_154126_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.4	2.4e-57
WP_086031743.1|154199_154682_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.1e-31
WP_021349514.1|154715_155903_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
WP_086031744.1|156081_156795_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.2	6.5e-28
WP_175402317.1|156731_157667_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436931.1|158013_159054_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_048340284.1|159141_160803_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_035436933.1|161089_161575_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.2	1.4e-21
WP_035436936.1|161558_162698_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003686529.1|162716_164012_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	8.2e-21
WP_035436938.1|164351_165392_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_035436940.1|165403_166954_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003682490.1|167612_168335_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.8	3.3e-35
WP_012390750.1|168337_168580_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003682494.1|168580_169261_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015638502.1|169264_171490_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	6.3e-146
WP_003682498.1|171465_172929_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	4.1e-61
WP_012390753.1|172928_173966_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.8	9.4e-60
WP_035436943.1|173974_174556_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_035436945.1|174557_176093_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	7.6e-74
WP_086031745.1|176366_177620_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003682507.1|177859_178555_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_021349275.1|178679_179858_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_035436953.1|179971_180976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349273.1|181466_181838_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003686555.1|181851_182160_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003682512.1|182159_184091_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.7e-92
WP_024271753.1|184202_184637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682515.1|184684_185161_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_048340466.1|191008_192148_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_048340467.1|192194_192809_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.5	8.1e-19
WP_080964966.1|192745_193654_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_080965009.1|194096_195971_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003684235.1|196117_197104_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042513971.1|197428_198454_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_080650597.1|199725_200361_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_021350357.1|200486_200876_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_035435880.1|200978_201524_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015638518.1|201608_202265_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.5	9.3e-13
WP_003684232.1|202962_203943_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015638522.1|204911_205106_+	CsbD family protein	NA	NA	NA	NA	NA
WP_086031746.1|205672_206128_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.6e-32
WP_014562705.1|207331_208519_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_086031747.1|208590_208818_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	57.6	5.8e-15
>prophage 4
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	258184	310847	2239921	transposase,protease,tRNA	Tupanvirus(12.5%)	44	NA	NA
WP_003686432.1|258184_260185_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	5.4e-88
WP_003683977.1|260188_260977_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012390795.1|260963_261533_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_021349691.1|261525_262413_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003683980.1|262692_263544_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_024271880.1|263721_264627_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_031274189.1|264629_265295_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.6	2.6e-15
WP_035437682.1|265294_266089_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_021349689.1|266313_267150_+	pur operon repressor	NA	NA	NA	NA	NA
WP_012390797.1|267165_268533_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.4	3.4e-33
WP_003683994.1|268608_269595_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.6	8.4e-42
WP_003683996.1|269704_270433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437683.1|270609_271431_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021349686.1|271442_272798_-	HD domain-containing protein	NA	A0A291ATA1	Pandoravirus	32.1	1.4e-26
WP_003686451.1|272912_273338_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003684002.1|273383_273971_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003684004.1|274137_275739_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	1.0e-145
WP_003684007.1|275949_277218_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003684008.1|277312_277558_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021349684.1|278289_278994_+	class A sortase	NA	NA	NA	NA	NA
WP_003684311.1|279113_279566_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	4.7e-32
WP_003684310.1|279644_280895_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_021349723.1|281080_281545_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003684020.1|281681_282239_+	LemA family protein	NA	NA	NA	NA	NA
WP_003686466.1|282249_283149_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_021349724.1|283323_284703_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012390801.1|284873_286352_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	37.8	9.6e-66
WP_003684028.1|286355_286715_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_021349725.1|286717_287839_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	3.2e-29
WP_015638559.1|287850_288204_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	2.3e-10
WP_003686479.1|288336_288972_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003684038.1|289159_289720_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_021349726.1|289737_293280_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|293276_293549_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|293637_293994_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003684046.1|294122_294629_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_024500679.1|294628_295978_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	4.0e-10
WP_003684053.1|295994_296543_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	8.0e-10
WP_035437099.1|296626_298795_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.9	7.4e-107
WP_012390806.1|298871_299753_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_021349728.1|299841_300843_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_021349729.1|300858_302352_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	2.8e-89
WP_042513854.1|308475_309762_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_107504382.1|310466_310847_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	60.3	2.1e-41
>prophage 5
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	415656	528187	2239921	transposase,holin,tRNA,protease,integrase	Streptococcus_phage(32.35%)	97	465558:465573	494531:494544
WP_042513837.1|415656_416589_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	5.5e-27
WP_035437299.1|416910_417549_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.5	7.8e-41
WP_021349636.1|417612_418929_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	42.9	7.2e-81
WP_031284433.1|418925_419600_+	ComF family protein	NA	NA	NA	NA	NA
WP_003682582.1|419735_420281_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003682585.1|420451_422821_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_178958862.1|422880_423996_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_051132381.1|424052_424382_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003682589.1|424381_424735_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003682590.1|424749_425712_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_021349634.1|425704_426550_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003682592.1|426546_427560_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_021349633.1|427622_428534_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.1	3.9e-70
WP_012390859.1|429057_429837_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_021349632.1|429852_431031_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003682596.1|431055_432030_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_086031752.1|432654_433905_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	1.2e-56
WP_004563287.1|434129_434546_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_042514036.1|434606_435143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042514037.1|435139_436027_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	2.6e-34
WP_003682598.1|436195_437137_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.4	5.3e-78
WP_003682600.1|437149_437968_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_035436478.1|437988_438915_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.7	1.4e-99
WP_004563284.1|439104_440133_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_014562182.1|440158_441100_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035436481.1|441202_442003_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_154244359.1|442065_442227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562183.1|442289_444014_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.1	1.5e-195
WP_024500722.1|444228_444864_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_021350021.1|444869_445100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563280.1|445199_447215_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_023465865.1|447224_450086_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	6.8e-302
WP_004563278.1|450175_451261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682618.1|451479_452349_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.7e-09
WP_003682620.1|452370_453348_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.0	2.7e-93
WP_015638637.1|453365_454304_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	2.3e-49
WP_003682627.1|455103_455694_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
WP_021350007.1|457902_458502_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_015638639.1|458501_459083_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_021350006.1|459094_462787_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
460476:460489	attL	TCGTGATTGCCCAC	NA	NA	NA	NA
WP_086031753.1|462839_466484_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
465558:465573	attL	CACATCGCTGAGCATA	NA	NA	NA	NA
WP_021350004.1|466540_467620_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	40.6	6.3e-67
WP_157660919.1|467621_469907_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
467768:467783	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_021350321.1|469927_472462_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
467768:467783	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_180959856.1|472508_474581_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021350323.1|474609_476397_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_048340475.1|476420_476714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645712.1|476787_477324_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042513842.1|477320_478208_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.7e-33
WP_080965012.1|478225_478789_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.1	1.4e-09
WP_012390875.1|479614_480628_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682636.1|480709_481915_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|482020_482788_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|482904_484227_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_003682642.1|484420_485815_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562187.1|485903_487454_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_004563267.1|487516_487756_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014562188.1|487808_490202_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	6.5e-88
WP_003682651.1|490222_490696_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_024272014.1|490723_491305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350151.1|491445_492135_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	8.7e-46
WP_003682658.1|492168_493143_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|493151_493604_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_021350149.1|493603_494119_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004563262.1|494248_494788_-	exonuclease	NA	M1PFD8	Streptococcus_phage	35.6	2.0e-21
WP_003682662.1|494915_495812_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014562189.1|495823_496669_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014562190.1|496658_497537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562191.1|497576_498935_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_003682666.1|499148_500969_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	2.0e-89
WP_003682667.1|501248_501560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436517.1|501569_503420_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.7	2.7e-25
WP_031273992.1|503450_504269_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021350141.1|504589_505204_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	48.5	1.2e-22
WP_003682672.1|505600_506629_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012390889.1|506749_507655_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_024500730.1|507751_508714_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003682677.1|508800_509640_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.5	2.7e-49
WP_003682679.1|509802_510318_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003682680.1|510551_511493_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_014562195.1|511967_512951_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_014562196.1|512970_513774_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|513802_514723_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_035436511.1|514723_515074_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_014562199.1|515690_516413_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	2.3e-36
WP_003682693.1|516412_517915_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	5.2e-35
WP_003682694.1|518117_518978_+	sugar transporter	NA	NA	NA	NA	NA
WP_048340476.1|519052_519589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042513980.1|519585_520473_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	9.9e-34
WP_042514038.1|520584_521040_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	2.4e-31
WP_048340477.1|521113_522364_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_003685822.1|522887_523451_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_014562202.1|523466_525131_+	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	37.8	8.6e-47
WP_042513939.1|525268_526621_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003682700.1|526627_526825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682701.1|526985_527468_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003682702.1|527485_528187_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	572336	595630	2239921	tRNA,transposase,head	Streptococcus_phage(33.33%)	17	NA	NA
WP_021350213.1|572336_572657_+|head	head protein	head	Q6SED4	Lactobacillus_prophage	54.2	1.2e-26
WP_021350214.1|572769_572937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437514.1|572924_573530_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012390958.1|573859_575569_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003685978.1|575749_576898_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.3	2.0e-31
WP_003682780.1|576910_578131_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_035437512.1|578526_579816_+	GntP family permease	NA	NA	NA	NA	NA
WP_003682784.1|579828_580971_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	2.2e-38
WP_086031754.1|581800_583087_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_042513950.1|583677_585036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031756.1|586570_587026_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	1.2e-32
WP_012391038.1|587099_588350_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_035437599.1|588998_589610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437598.1|589761_590256_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_012390965.1|590561_593216_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	1.3e-158
WP_048340479.1|593324_594683_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021353998.1|594652_595630_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	717984	775984	2239921	transposase,protease,integrase	Lactobacillus_phage(16.67%)	59	757837:757853	764142:764158
WP_003684331.1|717984_719148_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_015638746.1|719749_721549_+	ribonuclease J	NA	NA	NA	NA	NA
WP_021349941.1|721639_722536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349940.1|722716_723907_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.0	1.1e-32
WP_003682058.1|724077_725385_+	trigger factor	NA	NA	NA	NA	NA
WP_003682055.1|725535_726786_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_003682053.1|726799_727393_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|727392_727692_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_003682050.1|727958_728105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171029992.1|728307_729039_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-28
WP_003682047.1|729316_731128_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_035436721.1|731192_732500_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|732526_733459_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_171029993.1|733485_734319_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021349938.1|734391_736689_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	1.2e-70
WP_021349937.1|736702_737230_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_003682041.1|737561_737939_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|738018_739017_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_021349936.1|739518_740328_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_003682034.1|741032_741569_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003682030.1|741860_742190_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003682029.1|742537_742846_-	membrane protein	NA	NA	NA	NA	NA
WP_035433292.1|743546_743894_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.9	1.0e-10
WP_021349932.1|744045_745137_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_015638760.1|745395_745575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349931.1|745936_746797_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003682017.1|746796_747357_+	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.0	5.9e-08
WP_015638766.1|747716_748082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349929.1|748352_748721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436724.1|748847_749957_-	MFS transporter	NA	NA	NA	NA	NA
WP_014562705.1|751461_752649_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_021349926.1|753521_755111_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	5.2e-102
WP_003682005.1|756099_756540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035437289.1|756550_757540_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|757561_758008_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
757837:757853	attL	TCTGCGCCCATTCCGGC	NA	NA	NA	NA
WP_035437285.1|758108_758729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349922.1|759756_760887_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	47.3	1.7e-91
WP_157660920.1|760896_761280_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_021349920.1|761376_761772_-	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	55.1	1.6e-12
WP_021349919.1|761919_762162_+	DUF739 family protein	NA	NA	NA	NA	NA
WP_021349918.1|762219_762543_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_021349917.1|762667_762817_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_053069258.1|763170_764265_+	helix-turn-helix domain-containing protein	NA	X2CYF1	Lactobacillus_phage	29.2	2.6e-15
764142:764158	attR	GCCGGAATGGGCGCAGA	NA	NA	NA	NA
WP_035437281.1|764269_764488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349883.1|764594_764975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349882.1|764987_765245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349880.1|765522_766797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349879.1|766797_767235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349877.1|767382_767604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349876.1|767630_768050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349875.1|768062_768560_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_042513910.1|768667_769888_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_021349874.1|770158_770929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349873.1|771037_771301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435892.1|772210_772501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349870.1|772516_772825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349869.1|773715_774222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349868.1|774244_774667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031759.1|774763_775984_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.7	5.6e-96
>prophage 8
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	779703	895232	2239921	transposase,terminase,holin,tRNA,protease,integrase	Lactobacillus_phage(21.28%)	114	794197:794256	844293:844364
WP_086031761.1|779703_780924_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_035435959.1|784038_784947_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	2.3e-22
WP_080650600.1|785008_786175_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012391429.1|787193_788414_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_035436083.1|788537_789104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031764.1|789544_790159_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	1.6e-27
WP_154244364.1|790095_791001_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041812692.1|791656_792535_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_086031766.1|792558_792846_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031761.1|792932_794153_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
794197:794256	attL	CCAATTTACTTCCTTAATTATACTAAATCAGAGTCTCTATTTAACTTGTACACTTTTTAT	NA	NA	NA	NA
WP_035437662.1|795281_795632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437660.1|795631_795931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437658.1|796103_796460_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003586674.1|796459_796738_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012391086.1|796872_797562_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	52.2	2.5e-61
WP_051132389.1|797658_797994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031759.1|799181_800402_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.7	5.6e-96
WP_086031768.1|800505_801429_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	6.2e-31
WP_086031769.1|801522_802662_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.0e-43
WP_003577309.1|802932_804771_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	27.3	1.2e-41
WP_016511950.1|804814_805027_+	tyrosine recombinase	NA	A0A1S5SEW4	Streptococcus_phage	45.6	5.4e-07
WP_085776374.1|805044_805974_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.6	1.0e-20
WP_050755181.1|806169_806790_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|806777_807662_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016511784.1|807957_809331_-	MFS transporter	NA	NA	NA	NA	NA
WP_016511783.1|809370_810900_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003576326.1|811026_811218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085776373.1|811296_812226_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.6	5.0e-20
WP_016511790.1|812354_813719_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033609856.1|813850_814225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487858.1|814218_815006_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016511417.1|815195_815300_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_050755181.1|816168_816789_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|816776_817661_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_154244365.1|817692_818124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031770.1|818231_818816_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.3	9.1e-20
WP_035437723.1|818864_819728_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.7	2.5e-26
WP_035437721.1|819729_820590_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086031771.1|820965_821889_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	1.6e-31
WP_014562285.1|822281_823367_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.8	2.4e-106
WP_035435907.1|823473_824001_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	71.4	2.0e-58
WP_035435905.1|824243_825005_-	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	94.1	8.3e-130
WP_051132355.1|825201_825756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435902.1|825805_826231_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.4	2.4e-17
WP_187343257.1|826416_826662_-	hypothetical protein	NA	A0A0N9RUA4	Staphylococcus_phage	47.7	1.4e-09
WP_042513835.1|826662_828021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080650595.1|828149_828956_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	59.1	1.0e-85
WP_035435767.1|828973_829294_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	56.0	5.1e-25
WP_021815904.1|829474_829705_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014562286.1|829701_830487_+	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	66.5	8.0e-96
WP_138464386.1|830590_830797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154244367.1|830864_831026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435765.1|831136_831457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132354.1|831521_831842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171029991.1|831985_832150_+	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	89.8	4.6e-14
WP_035435762.1|832325_832892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435757.1|834144_834996_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	81.3	5.2e-141
WP_035435754.1|834995_835517_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	54.3	2.3e-30
WP_049775679.1|835530_836223_+	helix-turn-helix domain-containing protein	NA	Q8SDH3	Lactococcus_phage	41.9	4.3e-16
WP_035435751.1|836293_836746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435748.1|836860_837325_+	hypothetical protein	NA	A0A0A1EL23	Lactobacillus_phage	59.7	7.2e-44
WP_086031772.1|837670_838603_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_023465590.1|838654_838858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436107.1|838841_839348_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_021349255.1|840501_840708_-	CsbD family protein	NA	NA	NA	NA	NA
WP_021349253.1|841294_841684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435989.1|841738_842221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035426089.1|842250_842682_+|terminase	terminase small subunit	terminase	A0A0A1ENP4	Lactobacillus_phage	57.2	8.7e-36
WP_021349740.1|842668_842830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340500.1|843091_843970_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_003688751.1|843993_844281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145998185.1|844501_844885_+	hypothetical protein	NA	NA	NA	NA	NA
844293:844364	attR	CCAATTTACTTCCTTAATTATACTAAATCAGAGTCTCTATTTAACTTGTACACTTTTTATTCTAGGCCCAAG	NA	NA	NA	NA
WP_042513837.1|844990_845923_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	5.5e-27
WP_021349246.1|845987_846662_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	31.1	6.6e-22
WP_035435948.1|847093_848473_+	MFS transporter	NA	NA	NA	NA	NA
WP_021349248.1|848469_849393_+	ferrochelatase	NA	NA	NA	NA	NA
WP_021353718.1|849619_850618_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	3.8e-50
WP_048340502.1|850708_851995_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014562466.1|852150_853149_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_086031773.1|854614_855802_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_010625596.1|856468_856957_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_086031761.1|857291_858512_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_021349110.1|859716_860451_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_015638801.1|860443_861961_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003685238.1|861961_862768_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_021349108.1|863020_864190_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685235.1|864659_865286_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_012391088.1|865441_865693_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|865769_865997_+	YneF family protein	NA	NA	NA	NA	NA
WP_003685229.1|866064_866697_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035436535.1|866792_867545_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|867537_867828_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003681957.1|867981_868761_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003681955.1|868851_869730_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681954.1|869810_870536_+	UMP kinase	NA	NA	NA	NA	NA
WP_003681953.1|870535_871096_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_024271689.1|871228_871996_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
WP_003681950.1|872012_872801_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_035436539.1|872822_874094_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015638806.1|874127_875849_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
WP_024500831.1|875988_880332_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_014562308.1|880454_881606_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.5e-21
WP_035436544.1|881618_882365_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003685208.1|882374_883577_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003685206.1|883603_884629_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_035436547.1|884873_885944_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_021349106.1|885936_889026_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003681934.1|889178_889658_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003685200.1|889677_890904_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_021349105.1|890940_891243_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003681928.1|891235_891559_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_021349104.1|891563_893891_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003685195.1|893903_894266_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_021349103.1|894335_895232_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	898464	954127	2239921	transposase	Streptococcus_phage(21.74%)	48	NA	NA
WP_080964987.1|898464_899373_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	3.2e-11
WP_042513934.1|899525_899981_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_014562705.1|900450_901638_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_048340463.1|901769_902648_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003688751.1|902671_902959_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021350231.1|904455_905793_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_021350232.1|905801_907496_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_021350233.1|907653_908640_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035437390.1|908795_910088_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.5	3.5e-80
WP_021350236.1|910068_910386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|910538_911711_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024271704.1|913375_914338_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_021349142.1|914728_915049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685171.1|916696_917050_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_021349145.1|917062_917644_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080964989.1|917744_918458_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	5.0e-28
WP_041812698.1|918936_919224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340505.1|919247_920126_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_086031844.1|920182_920302_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436004.1|920364_922632_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	1.1e-124
WP_086031774.1|922686_923619_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.9e-27
WP_021353998.1|923734_924712_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003681906.1|925564_925930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681905.1|926055_927102_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003681903.1|927112_927700_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014562323.1|927737_929594_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	9.3e-135
WP_003681899.1|929705_930866_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	4.8e-20
WP_021349426.1|932604_932922_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|932923_933244_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_021349425.1|933256_934342_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	2.9e-11
WP_003685127.1|934409_936242_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_003681865.1|936754_937258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349422.1|937293_937917_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	8.5e-08
WP_162485011.1|938008_939031_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015638841.1|939290_940364_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
WP_021349420.1|940375_941551_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	1.1e-88
WP_003681857.1|941690_943442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349418.1|943479_943935_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349417.1|944095_944566_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_021349416.1|944558_945752_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	6.5e-97
WP_003681853.1|945738_946347_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
WP_021349415.1|946346_947405_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	1.3e-40
WP_021349414.1|947814_948300_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035436973.1|948360_949395_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	26.0	7.0e-07
WP_021349411.1|949387_949939_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024500857.1|950882_952055_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_041812577.1|952345_952798_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_048340507.1|952876_954127_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.8	7.6e-56
>prophage 10
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1007752	1127675	2239921	transposase,tRNA,integrase	Streptococcus_phage(12.5%)	113	1049692:1049707	1098882:1098897
WP_003681741.1|1007752_1009048_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436372.1|1009051_1010827_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021349548.1|1011368_1012052_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003684990.1|1012165_1012354_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003684989.1|1012418_1012868_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	34.3	7.0e-12
WP_014562357.1|1013015_1013999_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	9.2e-49
WP_003681726.1|1013998_1014472_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_035436369.1|1014449_1014848_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003681722.1|1014861_1015767_+	GTPase Era	NA	NA	NA	NA	NA
WP_003681720.1|1015879_1016698_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003681718.1|1016965_1017940_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_021349547.1|1017939_1020018_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_021349546.1|1020169_1022065_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	32.1	3.3e-42
WP_003681711.1|1022064_1023207_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.9e-37
WP_042513964.1|1023667_1024510_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
WP_012391066.1|1024563_1024815_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_021349446.1|1025110_1025671_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|1025682_1025868_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_003681703.1|1025895_1026438_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|1026452_1026704_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|1026715_1026856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513968.1|1027073_1027757_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.2	1.6e-31
WP_014562363.1|1027950_1029237_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683258.1|1029469_1030381_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_035437742.1|1030583_1031591_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003683256.1|1031603_1032962_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003683241.1|1033433_1034753_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003683238.1|1034777_1035491_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015638911.1|1035490_1036645_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003683233.1|1036647_1037583_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_021350307.1|1037575_1038355_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_021350308.1|1038379_1039564_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003683228.1|1039578_1040631_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003683224.1|1040766_1042107_+	ATPase	NA	NA	NA	NA	NA
WP_003683222.1|1042099_1042774_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_035437740.1|1042782_1043484_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_035437738.1|1043476_1044298_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_035437736.1|1044317_1045559_+	peptidase T	NA	NA	NA	NA	NA
WP_003683213.1|1045630_1045858_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_035437734.1|1045948_1049248_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.2	2.2e-142
WP_003684953.1|1049386_1050808_+	pyruvate kinase	NA	NA	NA	NA	NA
1049692:1049707	attL	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_021349849.1|1050963_1051851_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
1049692:1049707	attL	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_015638921.1|1051843_1052722_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	29.1	6.4e-09
WP_003684947.1|1052702_1053086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683203.1|1053078_1053867_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.5	1.2e-11
WP_003683201.1|1053844_1054432_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	7.5e-14
WP_003683200.1|1054432_1055158_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021349848.1|1055429_1056008_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_031284577.1|1056207_1057272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683188.1|1057261_1058719_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
WP_003683187.1|1058779_1059334_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683185.1|1059357_1060038_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003683184.1|1060114_1061347_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_024500900.1|1061424_1062738_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003683180.1|1062961_1063237_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
WP_003684932.1|1063315_1064578_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003683175.1|1064691_1065549_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_021350295.1|1065714_1066917_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	3.4e-45
1066290:1066305	attR	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_015638927.1|1066929_1068816_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.9e-51
1066290:1066305	attR	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_003683168.1|1068881_1069841_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	9.1e-118
WP_003683166.1|1069852_1070356_+	dihydrofolate reductase	NA	A0A223LJP4	Erwinia_phage	37.8	5.6e-18
WP_003684928.1|1070335_1070965_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021350296.1|1071131_1071974_+	DegV family protein	NA	NA	NA	NA	NA
WP_003683161.1|1072107_1073286_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	8.7e-62
WP_003683159.1|1073355_1073982_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_003683158.1|1074112_1075030_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683157.1|1075033_1075627_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003683156.1|1075636_1075861_+	YozE family protein	NA	NA	NA	NA	NA
WP_014562705.1|1076330_1077518_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_003678461.1|1078011_1078371_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.3	8.1e-19
WP_003678459.1|1078357_1078720_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_012391429.1|1078765_1079986_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_042513852.1|1080137_1081868_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_012391429.1|1083209_1084430_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_003678450.1|1084747_1085116_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021349960.1|1085117_1085732_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003678446.1|1085756_1086311_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.3	6.0e-05
WP_021349958.1|1086744_1087965_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	38.9	3.8e-76
WP_021349957.1|1088084_1088336_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	43.3	4.5e-08
WP_035436401.1|1088424_1089684_+|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	26.6	4.1e-25
WP_014562383.1|1089820_1090693_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_024500903.1|1090685_1091456_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.2	1.4e-20
WP_024500904.1|1091508_1092384_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_035428782.1|1092466_1094599_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.2	6.8e-97
WP_015638933.1|1094727_1095570_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003683143.1|1095585_1096464_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003683142.1|1096531_1097143_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003683141.1|1097374_1099372_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	7.5e-122
WP_035436398.1|1099388_1101857_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.9e-98
WP_003683135.1|1101922_1102438_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003683133.1|1102548_1103481_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_015638938.1|1103674_1104067_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003683130.1|1104076_1104502_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003684903.1|1104654_1105164_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024271696.1|1105156_1105612_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023466126.1|1105768_1107127_+	cytosine permease	NA	NA	NA	NA	NA
WP_024500909.1|1107129_1108368_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_024500910.1|1108536_1110240_+	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_014562389.1|1110335_1110707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436395.1|1110721_1112068_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.1	3.1e-87
WP_021349896.1|1112064_1112745_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014562392.1|1113331_1114681_+	MFS transporter	NA	NA	NA	NA	NA
WP_035436393.1|1114807_1115011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683109.1|1115025_1115181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015638951.1|1115167_1115458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349899.1|1117300_1118527_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_021349900.1|1118526_1119291_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_035436390.1|1119343_1120822_-	amino acid permease	NA	NA	NA	NA	NA
WP_021349902.1|1120979_1122011_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_031284600.1|1122648_1123290_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021349904.1|1123403_1123970_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_035436387.1|1125104_1126457_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031776.1|1126538_1127675_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.0e-43
>prophage 11
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1133229	1192578	2239921	transposase,capsid,integrase	Staphylococcus_phage(16.67%)	51	1129753:1129771	1198212:1198230
1129753:1129771	attL	CTTGACGATTTCGGCCGCC	NA	NA	NA	NA
WP_021349962.1|1133229_1134126_+|capsid	phage capsid protein	capsid	U3PFU0	Lactobacillus_phage	46.8	2.3e-62
WP_003683059.1|1134655_1135546_-	alpha/beta hydrolase	NA	Q854G2	Mycobacterium_phage	26.8	9.7e-13
WP_021349963.1|1135564_1136089_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683056.1|1136436_1137363_+	YdcF family protein	NA	NA	NA	NA	NA
WP_024271964.1|1137396_1138269_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	9.4e-53
WP_024271965.1|1138361_1138847_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003683053.1|1138862_1139693_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014562402.1|1139879_1141133_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003683045.1|1141893_1142973_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	30.0	1.6e-06
WP_003683043.1|1142974_1143901_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_024500921.1|1143928_1145107_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_048340509.1|1145240_1146404_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	70.9	9.9e-159
WP_035437536.1|1147358_1148411_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	6.1e-14
WP_021350180.1|1148503_1149463_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003684840.1|1149478_1150108_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035437538.1|1150104_1150872_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	4.4e-22
WP_003683036.1|1150852_1151497_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003684836.1|1151647_1152550_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015638987.1|1152691_1153141_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683030.1|1153178_1153604_-	OsmC family protein	NA	NA	NA	NA	NA
WP_021350184.1|1153603_1154140_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349692.1|1157508_1157988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132356.1|1157991_1158426_-	MFS transporter	NA	NA	NA	NA	NA
WP_021349347.1|1160767_1161196_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042513914.1|1161375_1162662_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_086031777.1|1162821_1163286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031761.1|1163351_1164572_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_086031778.1|1164586_1165039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349509.1|1165230_1166238_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.3	5.2e-15
WP_012390893.1|1166295_1167183_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
WP_048340510.1|1167870_1169091_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.6e-95
WP_086031779.1|1169105_1169699_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_048340512.1|1170554_1171169_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	7.3e-28
WP_086031781.1|1171496_1172420_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_021349264.1|1172546_1173167_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.3	3.0e-21
WP_035435926.1|1173463_1174243_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021349259.1|1176242_1176410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|1176655_1176943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349454.1|1178921_1179305_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003683002.1|1179339_1180161_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014562409.1|1180170_1181595_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.5	1.4e-69
WP_003683000.1|1181642_1182836_+	MFS transporter	NA	NA	NA	NA	NA
WP_024500926.1|1183066_1184137_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.0e-08
WP_014562411.1|1184358_1185501_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_012391259.1|1185513_1186425_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.8	5.4e-59
WP_003682996.1|1186766_1187033_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_021349455.1|1187042_1188386_+	PFL family protein	NA	NA	NA	NA	NA
WP_003682993.1|1188576_1189509_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003682992.1|1189589_1189982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349457.1|1190203_1190404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562415.1|1191591_1192578_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	3.6e-45
1198212:1198230	attR	CTTGACGATTTCGGCCGCC	NA	NA	NA	NA
>prophage 12
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1213539	1266643	2239921	transposase,integrase	Staphylococcus_phage(33.33%)	48	1263456:1263492	1271447:1271483
WP_173425567.1|1213539_1214526_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	2.8e-45
WP_014562430.1|1214692_1216078_-	amino acid permease	NA	NA	NA	NA	NA
WP_003682956.1|1216352_1217315_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_042513919.1|1217631_1219410_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_035437577.1|1219569_1220805_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003682951.1|1220808_1221489_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_021353998.1|1221644_1222622_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_024271972.1|1222659_1223097_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.2	1.2e-24
WP_024271971.1|1223102_1223645_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024271970.1|1223736_1224270_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003682943.1|1224418_1224691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349991.1|1224831_1225947_-	membrane protein	NA	NA	NA	NA	NA
WP_003682939.1|1226426_1227257_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021349990.1|1227451_1228825_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_021349989.1|1229192_1230377_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_035437463.1|1230552_1231884_-	guanine deaminase	NA	NA	NA	NA	NA
WP_004563085.1|1232005_1233157_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_021349987.1|1233413_1233563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138464718.1|1233575_1233887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349985.1|1234066_1234483_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.8	1.5e-13
WP_024271969.1|1235233_1235662_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003688751.1|1235929_1236217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340463.1|1236240_1237119_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003682913.1|1237656_1238424_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_035437564.1|1239402_1241085_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_035437566.1|1241569_1243294_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_023465823.1|1243389_1244142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639076.1|1244324_1244885_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_107760586.1|1245117_1246002_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050755181.1|1245989_1246610_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_021349699.1|1246792_1247512_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035435887.1|1248037_1249957_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_021349211.1|1250127_1250841_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_021349212.1|1250851_1252513_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_080650636.1|1254480_1255698_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021350120.1|1255657_1255804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683569.1|1256318_1256651_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.9	3.0e-12
WP_004563102.1|1256647_1257013_-	CrcB family protein	NA	NA	NA	NA	NA
WP_004563103.1|1257136_1257529_+	VOC family protein	NA	NA	NA	NA	NA
WP_003683563.1|1257603_1258161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683557.1|1260218_1260917_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021350118.1|1261205_1262123_-	ROK family protein	NA	NA	NA	NA	NA
WP_021350117.1|1262194_1262470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350116.1|1262496_1262955_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
1263456:1263492	attL	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
WP_042513877.1|1263574_1264417_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.4	3.9e-64
WP_003688751.1|1264486_1264774_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391066.1|1265495_1265747_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_042513964.1|1265800_1266643_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
1271447:1271483	attR	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
>prophage 13
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1383327	1489494	2239921	transposase,tRNA	Paenibacillus_phage(25.0%)	87	NA	NA
WP_048340520.1|1383327_1384578_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	9.0e-57
WP_042513997.1|1384872_1386030_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	3.6e-36
WP_003617037.1|1386174_1386810_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003683319.1|1387002_1389507_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_035437492.1|1389508_1390591_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_046947974.1|1390620_1391496_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021350105.1|1391536_1391974_-	signal peptidase II	NA	NA	NA	NA	NA
WP_035437494.1|1391973_1392408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683308.1|1392420_1392822_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_004563210.1|1392977_1393580_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003683304.1|1393803_1394667_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012391396.1|1394880_1395570_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080650635.1|1395656_1396355_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|1396476_1396764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130343.1|1397649_1398498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132368.1|1399203_1400682_+	amidase	NA	NA	NA	NA	NA
WP_024501009.1|1401894_1403028_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683293.1|1403070_1403520_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021349973.1|1403523_1404705_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_035436886.1|1404812_1406747_-	GTP-binding protein	NA	D0R0F5	Streptococcus_phage	28.6	5.3e-64
WP_015639179.1|1407280_1407640_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_024501011.1|1407747_1408344_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_021349975.1|1408435_1409071_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	1.1e-23
WP_004563220.1|1409063_1411328_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004563221.1|1411442_1412354_-	EamA family transporter	NA	NA	NA	NA	NA
WP_014562510.1|1412476_1413496_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003683271.1|1413687_1414695_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_035436895.1|1414794_1415523_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_004563225.1|1415614_1416910_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_004563226.1|1416936_1417455_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_004563227.1|1417505_1420346_-	3'-5' exoribonuclease	NA	A0A1X9I5C8	Streptococcus_phage	34.6	3.6e-61
WP_003683265.1|1420574_1421510_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_035436899.1|1421511_1422501_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003683263.1|1422520_1423630_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683262.1|1423685_1424771_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_035436902.1|1424927_1425686_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	1.8e-12
WP_157660922.1|1425881_1426109_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	56.1	2.2e-14
WP_014562705.1|1426254_1427442_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_035435997.1|1429079_1430453_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_035435993.1|1430580_1431387_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_086031786.1|1431608_1432106_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151130348.1|1433059_1433902_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.6e-41
WP_086031788.1|1433962_1434250_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031789.1|1434468_1435083_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.5	4.0e-26
WP_157660921.1|1436040_1436331_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.2	1.5e-10
WP_086031791.1|1436293_1437235_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	1.7e-12
WP_035435979.1|1437317_1438424_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024500815.1|1438580_1439495_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.3	4.3e-32
WP_003606447.1|1439796_1440045_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_048340531.1|1440119_1441340_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
WP_086031734.1|1446015_1446948_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	8.5e-28
WP_086031793.1|1446989_1447217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035437581.1|1447393_1449166_-	oleate hydratase	NA	NA	NA	NA	NA
WP_035437582.1|1449653_1450985_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035437584.1|1451663_1453403_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_035437501.1|1455830_1456748_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_086031794.1|1456760_1459940_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_024501023.1|1459939_1461022_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	1.9e-55
WP_024501024.1|1461023_1462313_-	dihydroorotase	NA	NA	NA	NA	NA
WP_035437505.1|1462312_1463278_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.5	5.9e-24
WP_035437507.1|1463613_1464408_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_086031795.1|1464975_1466289_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035436293.1|1466341_1467307_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	28.7	4.4e-19
WP_035436289.1|1467546_1468092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436286.1|1468278_1468407_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_035436283.1|1468433_1468598_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_035436280.1|1468597_1468915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031796.1|1468902_1469016_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_154244373.1|1469164_1469323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154244374.1|1469370_1469535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436277.1|1471341_1471893_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_035436274.1|1471904_1473305_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_035436271.1|1473430_1474327_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035436269.1|1474371_1474791_-	amino acid decarboxylase	NA	NA	NA	NA	NA
WP_154244375.1|1474810_1474978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436266.1|1475251_1475731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436263.1|1477322_1478201_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_015639203.1|1478204_1479143_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015639204.1|1479139_1479796_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_035436299.1|1479808_1480516_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_035436260.1|1480496_1481597_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_035436257.1|1481605_1482190_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_035436252.1|1482206_1483865_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_035436249.1|1483845_1486587_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003683897.1|1486817_1487177_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024501037.1|1487297_1488725_-	amino acid permease	NA	NA	NA	NA	NA
WP_003683893.1|1488735_1489494_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1598847	1727990	2239921	tRNA,transposase,protease	Streptococcus_phage(25.0%)	116	NA	NA
WP_035436180.1|1598847_1599531_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003686160.1|1599549_1600557_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003683654.1|1600630_1601239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683652.1|1601368_1602001_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.8	8.6e-48
WP_035436178.1|1602100_1603219_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.8	3.5e-20
WP_035436175.1|1603309_1604698_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_021816360.1|1604823_1605324_-	universal stress protein	NA	NA	NA	NA	NA
WP_035436174.1|1605403_1606804_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_035436171.1|1606911_1607787_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_012391496.1|1607780_1608158_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_015639265.1|1608202_1609849_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003683636.1|1609961_1610225_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_023466532.1|1610668_1613086_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.1	0.0e+00
WP_035436168.1|1613423_1614155_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_035436165.1|1614413_1615655_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.4	6.5e-108
WP_015639270.1|1615657_1616449_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.1	1.6e-43
WP_003686137.1|1616731_1617919_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.9	2.7e-143
WP_021349074.1|1618112_1618844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436163.1|1618937_1619474_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_014562566.1|1619512_1620946_-	MFS transporter	NA	NA	NA	NA	NA
WP_021349073.1|1621067_1621523_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_021349072.1|1621741_1623109_-	amino acid permease	NA	NA	NA	NA	NA
WP_003683616.1|1623280_1623439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349071.1|1623448_1624066_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003686125.1|1624168_1624411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031799.1|1624718_1625969_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	9.0e-57
WP_012390701.1|1626047_1626500_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_173425572.1|1626532_1626670_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015639280.1|1626659_1627178_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012391508.1|1627332_1627764_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012391509.1|1627975_1628479_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_021349266.1|1628632_1629493_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	66.7	8.2e-17
WP_042513917.1|1629901_1630972_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.2	1.5e-07
WP_035437347.1|1631180_1632518_-	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	29.0	8.5e-21
WP_012391513.1|1632669_1633542_-	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012391514.1|1633550_1634132_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_031284742.1|1634076_1636293_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.8	1.3e-247
WP_003683592.1|1636660_1637344_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014562572.1|1637366_1638188_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035437353.1|1638453_1638774_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003683586.1|1638921_1639071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683584.1|1639087_1639468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562466.1|1639654_1640653_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_021350166.1|1647048_1647297_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_004563064.1|1647630_1648650_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_035437166.1|1648651_1649677_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035437163.1|1649669_1650887_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035437160.1|1651102_1652833_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_004563061.1|1652834_1653101_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_051132377.1|1653230_1653473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350169.1|1653646_1655893_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_012391521.1|1656145_1656853_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003684192.1|1656979_1657555_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012391523.1|1657547_1658975_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	2.3e-96
WP_003684189.1|1659261_1659855_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_021349807.1|1660010_1660730_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003684186.1|1660740_1661529_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	7.5e-25
WP_035437156.1|1661518_1662403_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024501089.1|1662481_1663726_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_014562415.1|1663790_1664777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	3.6e-45
WP_086031800.1|1665335_1666586_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_086031801.1|1666664_1667117_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	1.8e-31
WP_035435855.1|1667468_1668167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024501090.1|1668179_1669040_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.3e-17
WP_003684176.1|1669026_1669404_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035435859.1|1669513_1670446_-	dTDP-glucose 4,6-dehydratase	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	40.2	6.1e-58
WP_035435862.1|1670472_1672218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031274336.1|1672263_1673172_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_100184896.1|1673189_1674221_-	sugar transferase	NA	NA	NA	NA	NA
WP_003684164.1|1674259_1675840_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.3	2.5e-32
WP_042513950.1|1676141_1677500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035437589.1|1677628_1678606_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	34.8	1.0e-47
WP_035437591.1|1678694_1679804_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021350368.1|1679803_1680736_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.0	5.8e-77
WP_080650637.1|1680825_1681389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031802.1|1681531_1683127_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	43.0	3.6e-10
WP_086031804.1|1685181_1686105_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	1.8e-30
WP_035436033.1|1686164_1687751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031805.1|1688070_1689291_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_154244343.1|1689529_1691098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031806.1|1691714_1693433_-	glucosaminidase domain-containing protein	NA	Q9ZXE4	Bacillus_phage	45.0	3.5e-19
WP_035436865.1|1693578_1694637_-	acyltransferase	NA	NA	NA	NA	NA
WP_004563040.1|1694646_1696065_-	flippase	NA	NA	NA	NA	NA
WP_003684138.1|1696067_1697189_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.8	7.5e-172
WP_004563039.1|1697303_1697921_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_004563038.1|1697895_1699119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391550.1|1699129_1699891_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_003684130.1|1699902_1700556_-	sugar transferase	NA	NA	NA	NA	NA
WP_003684129.1|1700725_1701544_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003684128.1|1701637_1701844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684127.1|1701879_1702095_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_014562591.1|1702275_1703172_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_035436862.1|1703300_1706240_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_021349826.1|1706395_1707253_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_012391556.1|1707365_1707812_+	flavodoxin	NA	NA	NA	NA	NA
WP_024501110.1|1707821_1708256_+	GtrA family protein	NA	NA	NA	NA	NA
WP_107504378.1|1708494_1708584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436871.1|1708911_1710231_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.8	9.5e-33
WP_003684114.1|1710243_1711254_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_035436858.1|1711418_1711784_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003684112.1|1711925_1712495_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_035436855.1|1712495_1713398_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_035436852.1|1713562_1715071_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003684109.1|1715185_1715965_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003684108.1|1716107_1716461_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_024271931.1|1717002_1718628_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.3e-44
WP_014562466.1|1719902_1720901_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_014081459.1|1721192_1721591_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_004563019.1|1721772_1722240_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	9.2e-15
WP_004563015.1|1722320_1722884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684096.1|1723353_1724613_-	LCP family protein	NA	NA	NA	NA	NA
WP_003684094.1|1724835_1725384_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349820.1|1725591_1726002_+	MFS transporter	NA	NA	NA	NA	NA
WP_145998167.1|1725955_1726756_+	MFS transporter	NA	NA	NA	NA	NA
WP_035437180.1|1726787_1727306_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.5	6.0e-31
WP_035437183.1|1727396_1727990_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1731879	1796675	2239921	transposase,terminase,holin,tRNA,head,tail,protease,capsid,integrase,portal	Erysipelothrix_phage(45.45%)	66	1759667:1759726	1802760:1802871
WP_080650627.1|1731879_1732386_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_035437193.1|1732461_1733244_+	dimethylargininase	NA	NA	NA	NA	NA
WP_035437196.1|1733631_1735029_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_080650628.1|1735454_1736576_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_035437199.1|1736985_1737249_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_035437201.1|1737245_1737500_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_041807836.1|1737748_1738036_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031809.1|1738059_1738938_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.8e-40
WP_080650602.1|1739735_1740500_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_154244344.1|1740706_1741612_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035431426.1|1741548_1742163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003688751.1|1743618_1743906_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035436028.1|1744220_1745339_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035436025.1|1745326_1745644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154244345.1|1745907_1746750_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.9	9.1e-154
WP_086031812.1|1746803_1747055_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	94.0	7.8e-37
WP_014562705.1|1747386_1748574_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_154244346.1|1748570_1748903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681672.1|1748874_1749525_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681670.1|1749549_1749831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681668.1|1749882_1750110_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_035435921.1|1750132_1752061_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.1e-93
WP_024501125.1|1752209_1752770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042513934.1|1752855_1753311_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_012391038.1|1753384_1754635_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_086031815.1|1756051_1757239_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.0e-37
WP_086031817.1|1757721_1758861_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.1e-42
WP_021816442.1|1758950_1759454_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1759667:1759726	attL	TCGAGCACATCGGGGATTCAAGGACTGTCACGACACGCTTGATTCGATGTTTTAGAATCG	NA	NA	NA	NA
WP_035437646.1|1760301_1760532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035437649.1|1760557_1763674_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.5	1.3e-67
WP_048340506.1|1764025_1764958_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_086031818.1|1764948_1765359_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035435818.1|1765355_1765898_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035435815.1|1765914_1766886_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.8	6.8e-36
WP_035435812.1|1766958_1768104_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035435809.1|1768093_1769626_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.8	2.8e-52
WP_035435808.1|1769628_1769835_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	68.7	2.3e-18
WP_035435803.1|1769997_1770894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435799.1|1771278_1771737_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035435797.1|1771818_1772022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435794.1|1772005_1772341_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	32.7	1.6e-05
WP_035435791.1|1772337_1773477_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	53.0	4.9e-110
WP_035435789.1|1773478_1774030_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.2	2.0e-72
WP_014562466.1|1774190_1775189_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_035435845.1|1775211_1777146_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.0	4.6e-225
WP_035435842.1|1777232_1777619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435838.1|1777621_1779877_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.6	4.7e-213
WP_021349830.1|1780090_1780372_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	53.3	2.6e-20
WP_035435834.1|1780352_1781708_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.8	4.1e-156
WP_021349831.1|1781704_1782172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349832.1|1782318_1782696_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	54.7	5.7e-31
WP_021349833.1|1782816_1783359_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.1e-56
WP_048340505.1|1784243_1785122_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_041812698.1|1785145_1785433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349835.1|1785979_1786600_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	43.6	6.5e-40
WP_021349836.1|1786602_1786809_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_080650631.1|1786909_1788472_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.5	5.5e-245
WP_021349838.1|1788500_1789766_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	62.3	5.5e-155
WP_003671987.1|1789762_1790434_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	4.4e-58
WP_021349839.1|1790452_1791631_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.1e-128
WP_003671991.1|1791647_1791926_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021349840.1|1791925_1792309_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_021349841.1|1792295_1792706_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	1.7e-41
WP_035437374.1|1793174_1793408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437377.1|1793443_1795105_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.1	5.5e-102
WP_035437379.1|1795097_1796675_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	48.9	1.1e-131
1802760:1802871	attR	TCGAGCACATCGGGGATTCAAGGACTGTCACGACACGCTTGATTCGATGTTTTAGAATCGCCAATTCATGCGGGCGAAGTTTCCTTTTTTACACAACATTCTTGACACTCTC	NA	NA	NA	NA
>prophage 16
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	1853923	1882310	2239921	transposase,protease	Lactococcus_phage(25.0%)	31	NA	NA
WP_024501138.1|1853923_1856428_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.7	1.1e-125
WP_003681550.1|1856446_1856917_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024501139.1|1857056_1858076_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.9	1.1e-28
WP_003681545.1|1858362_1859079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024501140.1|1859140_1859806_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_080963713.1|1859838_1860096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031821.1|1861433_1861871_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	1.4e-49
WP_086031822.1|1861933_1862959_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	8.7e-42
WP_051132383.1|1863145_1863571_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035437484.1|1863567_1864071_-	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_024501143.1|1864914_1865745_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_035437481.1|1865803_1866091_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035437478.1|1866063_1866384_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015639408.1|1866396_1866567_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003681522.1|1867307_1867949_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.5	5.4e-58
WP_024501145.1|1868079_1869573_-	amino acid permease	NA	NA	NA	NA	NA
WP_012391607.1|1869879_1870347_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024501146.1|1870391_1871201_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024501147.1|1871419_1872088_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003681512.1|1872142_1872631_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_024501148.1|1872640_1873390_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_086031824.1|1873553_1874840_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014562466.1|1875033_1876032_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_004562929.1|1876163_1876364_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	6.9e-20
WP_004562927.1|1876512_1877172_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014562621.1|1877325_1878231_+	cation transporter	NA	A0A1V0SED0	Indivirus	32.0	1.3e-09
WP_024501149.1|1878385_1879081_-	VIT family protein	NA	NA	NA	NA	NA
WP_003681498.1|1879098_1879782_-	VIT family protein	NA	NA	NA	NA	NA
WP_003681496.1|1879930_1880407_-	universal stress protein	NA	NA	NA	NA	NA
WP_035436404.1|1880612_1881047_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024501150.1|1881095_1882310_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 17
NZ_CP021104	Limosilactobacillus fermentum strain FTDC 8312 chromosome, complete genome	2239921	2095577	2223610	2239921	transposase,tRNA	Paenibacillus_phage(17.24%)	106	NA	NA
WP_080965008.1|2095577_2096486_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_014562701.1|2096785_2097796_-	nickel transporter NixA	NA	NA	NA	NA	NA
WP_021349213.1|2097824_2098652_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_012391743.1|2098676_2099387_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_012391744.1|2099388_2100753_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_012391429.1|2100915_2102136_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_012391746.1|2102857_2104141_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_023466300.1|2104381_2105053_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562705.1|2107137_2108325_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_014562706.1|2109590_2111312_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003681137.1|2111499_2112828_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003681135.1|2112842_2113238_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_021349696.1|2113261_2114179_-	ribokinase	NA	NA	NA	NA	NA
WP_021349649.1|2114423_2115383_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012391752.1|2115486_2116140_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003685477.1|2116153_2117170_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003685479.1|2117203_2118151_+	ribokinase	NA	NA	NA	NA	NA
WP_014562709.1|2118210_2119635_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014562710.1|2119832_2120837_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350294.1|2121390_2122896_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_042513835.1|2123686_2125045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562712.1|2125636_2128036_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012391758.1|2128241_2129039_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003685491.1|2129045_2129774_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|2129917_2130418_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_035436983.1|2130421_2131165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349122.1|2131224_2132661_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_014562716.1|2132896_2133709_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|2133974_2134490_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003685499.1|2134499_2135027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|2135175_2136561_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|2136647_2137112_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021349399.1|2137356_2137788_-	VOC family protein	NA	NA	NA	NA	NA
WP_021349400.1|2137980_2139150_+	MFS transporter	NA	NA	NA	NA	NA
WP_024501234.1|2139521_2141003_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	3.1e-72
WP_012391767.1|2141187_2142627_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_021350129.1|2142881_2143355_-	universal stress protein	NA	NA	NA	NA	NA
WP_021350128.1|2143516_2143972_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350127.1|2144130_2144898_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	5.6e-17
WP_024501235.1|2144914_2145916_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350126.1|2146187_2147996_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014562721.1|2147998_2149291_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_021350125.1|2149538_2150210_+	membrane protein	NA	NA	NA	NA	NA
WP_023467458.1|2151865_2153545_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004562986.1|2154127_2154787_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_042513953.1|2156246_2157467_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_187343256.1|2159274_2160261_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	4.0e-44
WP_086031833.1|2160441_2161728_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_102116229.1|2162032_2162467_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_021353998.1|2162680_2163658_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_042513953.1|2164266_2165487_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_035437573.1|2165751_2166048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688746.1|2166066_2166231_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_035437571.1|2166283_2168479_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	4.0e-60
WP_035437569.1|2168729_2169161_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_012391781.1|2170656_2171328_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	5.0e-30
WP_003685525.1|2171332_2172379_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080965022.1|2173089_2173524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031834.1|2173724_2174633_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_035436770.1|2174888_2176832_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_021349353.1|2176907_2179130_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_012391784.1|2179344_2180346_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.8	9.9e-06
WP_035436767.1|2180373_2181828_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_021350297.1|2181855_2183022_-	galactokinase	NA	NA	NA	NA	NA
WP_012391787.1|2183193_2184144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436764.1|2184149_2184938_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_021350299.1|2184956_2185469_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_035436761.1|2185481_2185706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021816648.1|2185821_2186556_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.6	1.9e-14
WP_035436758.1|2186557_2187247_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003685553.1|2187349_2188150_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003682214.1|2188288_2188615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436755.1|2188716_2189655_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	5.4e-30
WP_035436752.1|2189656_2190139_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003682221.1|2190355_2191150_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_035436749.1|2191256_2191766_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.4	7.2e-37
WP_021353558.1|2191774_2193679_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	3.4e-71
WP_187343258.1|2193938_2195240_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.0	3.0e-47
WP_003682227.1|2195345_2195639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436742.1|2195631_2196792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682231.1|2196784_2197927_-	AAA family ATPase	NA	A0A141HRX4	Bacillus_phage	31.1	1.7e-22
WP_003682233.1|2197928_2198558_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003682235.1|2198617_2198986_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_012391797.1|2199276_2199462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685576.1|2199462_2200137_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021349314.1|2200139_2200463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682248.1|2200556_2201183_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003682249.1|2201363_2201921_-	elongation factor P	NA	NA	NA	NA	NA
WP_021349677.1|2202067_2202700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682253.1|2202836_2203070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682254.1|2203116_2204064_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_086031836.1|2204492_2206556_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	49.0	1.4e-27
WP_003682256.1|2206674_2206995_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054173696.1|2207337_2208588_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_015638507.1|2208661_2209117_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	9.5e-33
WP_003685587.1|2209182_2209641_-	arginine repressor	NA	NA	NA	NA	NA
WP_035437714.1|2209802_2210495_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	8.5e-33
WP_086031837.1|2210507_2211569_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035437716.1|2211492_2212095_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046948259.1|2213493_2214417_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.1e-33
WP_086031838.1|2215327_2215792_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.4	7.0e-31
WP_086031839.1|2215802_2216990_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.6e-37
WP_086031754.1|2217281_2218568_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_046948626.1|2218695_2220288_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_035436809.1|2220730_2221489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436813.1|2221804_2223610_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.0	3.7e-88
