The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	374674	419806	3640707	protease,holin,transposase	Erysipelothrix_phage(15.38%)	32	NA	NA
WP_172825298.1|374674_376393_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_087959816.1|376879_378160_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_008881412.1|378981_379518_+	NfeD family protein	NA	NA	NA	NA	NA
WP_081157607.1|379539_381060_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.7	1.2e-07
WP_008881410.1|381204_382125_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.9	2.3e-25
WP_087959836.1|382199_383582_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.1	2.3e-122
WP_087959837.1|384250_385636_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_011886718.1|385973_386747_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.7e-27
WP_011886719.1|386721_388593_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_029761624.1|388617_388974_+	YxeA family protein	NA	NA	NA	NA	NA
WP_087959838.1|389465_390634_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_087959839.1|390732_391029_+	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_031406929.1|391264_392500_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
WP_029761513.1|395467_395791_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087959840.1|395783_396344_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_011230382.1|396970_397771_-	ExeA family protein	NA	NA	NA	NA	NA
WP_021292743.1|397763_399017_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_042412494.1|399157_399715_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_008881397.1|400625_401459_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	78.0	2.0e-129
WP_011886722.1|401578_402169_+	GrpB family protein	NA	NA	NA	NA	NA
WP_087959841.1|402774_403260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959842.1|403916_405107_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.4	5.2e-30
WP_011886725.1|406170_407640_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_011886726.1|407834_408014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959843.1|408509_409742_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_011886727.1|410016_411408_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	30.7	1.1e-50
WP_087959844.1|411644_412055_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	67.4	5.4e-51
WP_008881273.1|412846_413629_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	35.7	9.1e-07
WP_087959845.1|414902_415460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021292743.1|415600_416854_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_011230382.1|416846_417647_+	ExeA family protein	NA	NA	NA	NA	NA
WP_087959846.1|418528_419806_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	514073	616061	3640707	transposase	Paenibacillus_phage(15.38%)	90	NA	NA
WP_087959859.1|514073_515302_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087959860.1|515592_516318_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_087959861.1|516578_517745_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.9	3.4e-34
WP_087959862.1|518111_518579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959863.1|518881_519952_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_087959838.1|520142_521310_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_029761473.1|521737_522337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886766.1|522351_522699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886767.1|522989_523589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886769.1|524239_524839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172825299.1|524853_526782_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_008881178.1|526797_527130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881177.1|527405_527699_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_008881176.1|527929_528169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029761875.1|528203_529490_+	type VII secretion protein EssB	NA	NA	NA	NA	NA
WP_087959865.1|529526_533966_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.1	9.3e-40
WP_087959866.1|533989_536770_+	type VII secretion protein EsaA	NA	NA	NA	NA	NA
WP_060475596.1|536759_537242_+	type VII secretion protein EssA	NA	NA	NA	NA	NA
WP_008881171.1|537288_537636_+	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_029761977.1|538754_539105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881167.1|540272_540554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023633822.1|540780_542448_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_087959838.1|542910_544079_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_011886777.1|544314_544875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886778.1|545271_545751_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_171355695.1|545802_546210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886780.1|546227_546653_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_011886783.1|547769_548231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230382.1|549165_549966_-	ExeA family protein	NA	NA	NA	NA	NA
WP_021292743.1|549958_551212_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_042412494.1|551352_551910_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_087960366.1|552146_552539_+	recombinase family protein	NA	A0A139ZPH5	Marinitoga_camini_virus	33.9	1.7e-06
WP_087959867.1|552731_553960_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011886787.1|554345_554864_+	VanZ family protein	NA	NA	NA	NA	NA
WP_011886788.1|555491_555848_+	permease	NA	NA	NA	NA	NA
WP_171355534.1|555878_556502_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_008881586.1|556566_557298_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_008881585.1|557294_558320_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008881584.1|558322_558955_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_029761739.1|559316_560774_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.2	5.4e-45
WP_008881581.1|560960_561746_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157663108.1|561978_562143_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_078172604.1|562339_562462_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_157663109.1|562466_562688_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_029761741.1|562718_564422_+	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_011886792.1|564792_565161_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_008881578.1|565617_567120_+	NADH dehydrogenase subunit 5	NA	NA	NA	NA	NA
WP_087959869.1|567127_569755_+	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_008881576.1|569863_570406_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011886795.1|570398_571142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881574.1|571252_571570_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_008881573.1|571653_572853_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015373961.1|572964_574146_-	CoA transferase	NA	NA	NA	NA	NA
WP_047817789.1|574467_576480_-	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
WP_008881571.1|576661_577492_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_087959870.1|577797_579366_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	4.7e-71
WP_008881570.1|579480_579663_-	YfhD family protein	NA	NA	NA	NA	NA
WP_078172606.1|579753_579882_-	YfhE family protein	NA	NA	NA	NA	NA
WP_008881568.1|580011_580566_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008881567.1|580817_581735_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_008881566.1|581870_582680_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_008881565.1|582748_583084_+	YfhH family protein	NA	NA	NA	NA	NA
WP_008881564.1|583209_583371_-	YpzG family protein	NA	NA	NA	NA	NA
WP_008881563.1|583445_583607_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_008881562.1|583730_584711_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_008881561.1|585061_585550_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_008881560.1|585542_588506_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_029761750.1|588764_589112_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_029761751.1|589377_590169_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_087959871.1|590185_591463_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_029761753.1|591903_593004_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_008881554.1|593000_593225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881553.1|593285_594035_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_008881552.1|594093_594285_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_029761755.1|594516_594720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886805.1|594850_595384_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_087959872.1|595449_597192_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.3e-56
WP_008881548.1|597395_598418_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	6.9e-15
WP_008881547.1|598383_599352_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	8.6e-23
WP_008881546.1|599399_601004_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011886810.1|601074_602079_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008881544.1|602098_602998_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087959873.1|603011_604091_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_078172607.1|604208_605312_-	glutamate synthase	NA	NA	NA	NA	NA
WP_035318721.1|605717_606170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087960367.1|606281_607322_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_087959874.1|607457_608336_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_008881879.1|610160_611333_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_031406929.1|612311_613547_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
WP_087959875.1|614492_616061_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	4.7e-71
>prophage 4
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	874432	927526	3640707	coat,transposase	Tupanvirus(12.5%)	54	NA	NA
WP_087959889.1|874432_875482_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_087959890.1|875711_876851_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_008878950.1|876856_877876_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_008878949.1|877885_878503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011886954.1|878577_879741_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_008878947.1|879737_880694_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	33.6	7.1e-38
WP_029761540.1|880690_881974_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.9	1.8e-73
WP_008878945.1|882647_882983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029761542.1|883152_883503_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_008878943.1|883690_884455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008878942.1|884557_885280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081157064.1|885430_885769_+|coat	spore coat protein regulator protein YlbO	coat	NA	NA	NA	NA
WP_008878940.1|886040_886265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008878939.1|886292_886496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008878938.1|886659_886866_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_081157066.1|886962_887439_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_008878936.1|887450_887930_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_041264264.1|887929_888943_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_008878934.1|888944_889301_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_008878933.1|889312_889519_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_008878932.1|889531_890392_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_008878931.1|890411_890582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008878930.1|890707_891028_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_008878929.1|891152_891389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008878928.1|891466_891601_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_008878927.1|891725_891983_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_008878926.1|892017_892452_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029761546.1|892451_892973_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_008878924.1|893011_893740_-	esterase family protein	NA	NA	NA	NA	NA
WP_008878923.1|894230_895334_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	27.1	4.7e-17
WP_087959891.1|895337_896516_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_008878921.1|896618_896828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008878920.1|896844_897276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008878919.1|897542_898241_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_008878918.1|898243_899365_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_008878917.1|899361_900417_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_087959845.1|900974_901532_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021292743.1|901672_902926_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_087959892.1|902918_903719_+	ExeA family protein	NA	NA	NA	NA	NA
WP_009361858.1|906559_907315_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.7	9.2e-57
WP_087959893.1|907311_908514_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	6.0e-50
WP_025950780.1|909276_909654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087959894.1|909803_910973_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	26.0	5.7e-21
WP_087959846.1|911234_912512_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087959895.1|913076_914304_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087959896.1|914676_915645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087959898.1|916405_916747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023633822.1|917324_918992_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011886990.1|919547_921035_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_087959901.1|921031_921520_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_008878902.1|921910_922282_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087959902.1|922472_923666_+	MFS transporter	NA	NA	NA	NA	NA
WP_015374614.1|924426_925560_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_008878914.1|926335_927526_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.4	6.8e-30
>prophage 5
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	933925	943757	3640707		Bacillus_phage(66.67%)	7	NA	NA
WP_011886997.1|933925_935833_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	31.0	4.6e-36
WP_011886998.1|936051_937116_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	50.6	2.0e-89
WP_008878890.1|937112_937787_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	64.4	3.8e-78
WP_008878889.1|938017_938809_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081157187.1|938810_939821_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	1.4e-20
WP_081157186.1|940334_942617_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	68.6	3.6e-306
WP_008878886.1|942722_943757_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	61.4	1.3e-122
>prophage 6
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	999132	1039371	3640707	protease,integrase,transposase	Paenibacillus_phage(18.18%)	34	995515:995574	1023403:1024942
995515:995574	attL	CAGACTGTTGACAAAATGGGTTTCAGACGAATGTCTGAAACCCATTTTGTTCCATAAATA	NA	NA	NA	NA
WP_087959910.1|999132_1000302_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.9	3.4e-34
WP_087959911.1|1000614_1002309_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_060475706.1|1002405_1002924_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008878823.1|1003057_1003786_+	heme ABC exporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	35.0	2.2e-31
WP_008878822.1|1003782_1004808_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008878821.1|1004819_1005473_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060475707.1|1005839_1007975_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	40.2	8.2e-127
WP_008878819.1|1008259_1009003_+	FixH family protein	NA	NA	NA	NA	NA
WP_008878818.1|1009114_1010152_+	membrane protein	NA	NA	NA	NA	NA
WP_041264294.1|1010514_1012026_+	spore germination protein	NA	NA	NA	NA	NA
WP_087959912.1|1012038_1013124_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_008878814.1|1013150_1014263_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_008878813.1|1014433_1015105_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.1	1.3e-65
WP_008878812.1|1015101_1015539_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_008878811.1|1015538_1016273_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	45.4	3.1e-57
WP_008878810.1|1016321_1016819_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.9	6.5e-51
WP_049756677.1|1016871_1017558_+	oxidoreductase	NA	NA	NA	NA	NA
WP_013145942.1|1017586_1017766_-	YkvS family protein	NA	NA	NA	NA	NA
WP_042409702.1|1018201_1019338_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	26.3	6.1e-12
WP_042409700.1|1019334_1021443_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042409697.1|1021435_1021816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052510034.1|1021970_1022342_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_015864899.1|1025359_1025818_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
1023403:1024942	attR	CAGACTGTTGACAAAATGGGTTTCAGACGAATGTCTGAAACCCATTTTGTTCCATAAATAGACTATGTTTTCAAAAAAAGTGGGTAGGATGGGAAGCCATGCAAAGGAAAAGAAAGGGCGGTGCTTCGCCTTCCATAGGTAATTCGCCAGTTTTTTTAAATTCATGGCAGCACAAACAAGCATCGCCTGCGCCTCATTTTTTTCCAATCCCCGGTAATGCGTCCAGCGCAGACCATGCTTCTCTTTCATATCGGCGAAATCCCGTTCAATCGTCTCTTTTCGGAGGGCATAGAGTTCCCGGTATTCCGGAACATACCGCAAATGCTCTGCTTCTTCATAGTAGTCCTGCCATACGTGGCGAGTGACTACTTTGGTGTAGCTCTTGCTTTGCGTGCACTGATGAAGATACGGACAGCTTCGGCACACCGCCGGGTCCGATTTGTATTCCCGGTACCCTTCCCGATTCGTAGTAGAGTAAGATAGAACTTGATCATTGGGGCATAGATAACAATCAAAATATTCGTCATACACAAAATCTGATTTCCGAAAGAATCCATCTTTTGTTTTCGGGCGAGTGTACGGCCAAATCGGCTTTACCCCTTGTTCGAGTAAATACTTGGCAATGGCAGGAGTTTTATATCCTGCGTCTACACACACGGCTTCCGGACATGATTGGATTTCCCGTTTCACTCGTTCGAACAGCACAAAAAACGCTTGACTGTCATGGACGTTGGCTGCCGTCACGTAGGTCTGTAGAATCCATCCGTTGCGATCACAAGCTGTATGATACGAATAGGCAAACACTCGCTCCCGTTCATTTTTCACCAACAGTCCGCTCTCCGGATCCGTTTTGCTTACTTTTACTTCCCGTTTTTTTTTTCTCAGATGGCAACGGCGATTTTCCATGAGCGATCCGATCCCGTTCGATTTCTTTTTCGAGTTCCTGTTGGTAGGCTTTGGCTTCGACTTCTGCCATTTCCGTTGTAAACTTCTTTTTATTGGCGCTTGCTTTGACATGAGTGGAGTCTACGTACAAGACACTCGAATCTACCAATCCGTGTTCAAAGGCTTCTTTTAAAATCCGTGAAAAAATTTGATGGAATACATCCGTTCCAGCGAAACGACGCGCATAGTTTTTACTTGGCGTCGAGTGATGAGGAACGGGATCATGAAGACTAAGTCCTAAAAACCAACGGTAGGCGACGTTGGTTCGGATTTGTTCGACGGTTTCACGCATGGAGCGAATCCCAAATACATACTGAATCAAATACATTTTAAACAACATCACTGGATCAATGCTCGGACGTCCATGATCAGGAGAGTAGAGATCTTTCACCACATCATAGATAAAAGAAAAATCAATGGCCGCATCCAGCTTTCTTACCAAGTGATCCTCTGGAACCAGATCATCCAGTTTCACCGTGGTTTCGGTATAGCGCCCATCTTCTTGGTGTGGCCGAAGCATCGTTCCTTTCCTCCATTTCTCCCTCGTCTTACCTTCATAATAAAACAGCTTGTCGACTTTGTCGACAAGCTGAAA	NA	NA	NA	NA
WP_015864898.1|1025814_1026225_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_015864897.1|1026339_1026504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374614.1|1026815_1027949_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_009361858.1|1028360_1029116_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.7	9.2e-57
WP_081157651.1|1030262_1031831_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_081157650.1|1031827_1032592_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	5.5e-49
WP_008881771.1|1033035_1033386_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_011230382.1|1035296_1036097_-	ExeA family protein	NA	NA	NA	NA	NA
WP_021292743.1|1036089_1037343_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_087960369.1|1037483_1038056_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_031406929.1|1038135_1039371_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
>prophage 7
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	1732411	1772645	3640707	coat,transposase	Paenibacillus_phage(20.0%)	32	NA	NA
WP_148206527.1|1732411_1733599_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_011887377.1|1733720_1734389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172825305.1|1734496_1735831_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	29.4	9.9e-46
WP_157663114.1|1736158_1736410_-	S-adenosylmethionine decarboxylase	NA	Q5GQE8	Synechococcus_phage	63.2	3.4e-08
WP_008879155.1|1736762_1737263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011887380.1|1737598_1739449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008879152.1|1739647_1740283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008879151.1|1740389_1740968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029760777.1|1741090_1741576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171355651.1|1741917_1742886_+	UV DNA damage repair endonuclease UvsE	NA	A0A1C9LW13	Vibrio_phage	25.0	8.0e-13
WP_031406929.1|1743575_1744811_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
WP_087959983.1|1745734_1746613_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087960001.1|1746660_1747377_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_081157496.1|1747519_1749043_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_008879145.1|1749042_1749279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959838.1|1749699_1750868_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_029760770.1|1751224_1752538_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	8.4e-13
WP_008879140.1|1753760_1755968_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_042381134.1|1756364_1756790_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_060475848.1|1757225_1758323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195805.1|1758409_1758859_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087960003.1|1759907_1761482_+	Vga family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	37.7	8.6e-73
WP_087960004.1|1761737_1762346_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087960005.1|1762964_1764029_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011887391.1|1764439_1764829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960006.1|1764857_1766321_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_008879130.1|1766597_1767491_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_015374820.1|1767601_1768477_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087960007.1|1768695_1769121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008879127.1|1769123_1769327_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	52.5	5.0e-10
WP_087960008.1|1769906_1770545_-|transposase	transposase	transposase	A9YX10	Burkholderia_phage	27.3	7.9e-09
WP_157663115.1|1770782_1772645_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	1.0e-141
>prophage 8
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	1783093	1841515	3640707	integrase,transposase	Synechococcus_phage(15.38%)	50	1789519:1789578	1834475:1835024
WP_087959845.1|1783093_1783651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021292743.1|1783791_1785045_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_011230382.1|1785037_1785838_+	ExeA family protein	NA	NA	NA	NA	NA
WP_008879114.1|1786636_1786918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959814.1|1787281_1788451_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.1	2.5e-24
WP_171355662.1|1788754_1788901_+	DUF469 family protein	NA	NA	NA	NA	NA
WP_081432660.1|1789301_1789403_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
1789519:1789578	attL	CCCGAGTTCGACAGTGACTAGGCAAACAAATCGCCTCCCAGCCCTTGATACAGAAGGGCT	NA	NA	NA	NA
WP_087960013.1|1790346_1790694_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	37.8	3.5e-11
WP_087960014.1|1790721_1791783_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011230093.1|1791803_1792226_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	62.9	2.7e-42
WP_087959916.1|1792366_1793935_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	4.7e-71
WP_087960015.1|1794168_1794615_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061579765.1|1794690_1795557_+	permease	NA	NA	NA	NA	NA
WP_157663117.1|1795570_1795726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960016.1|1795796_1796288_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_087960017.1|1796388_1797177_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008881859.1|1799174_1799369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087960019.1|1799632_1800874_-	oligoribonuclease	NA	NA	NA	NA	NA
WP_087960020.1|1800893_1802804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029761310.1|1802814_1803690_-	AAA family ATPase	NA	E3SJ29	Synechococcus_phage	27.9	9.8e-10
WP_008881855.1|1803821_1804196_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CP62	Brevibacillus_phage	39.5	1.1e-13
WP_087960021.1|1804315_1805218_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	39.8	1.7e-12
WP_087960022.1|1805379_1806618_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_008881851.1|1806788_1807235_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_008881849.1|1807747_1807900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881848.1|1807980_1808853_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_029761307.1|1809014_1810208_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_008881844.1|1810383_1811883_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SL42	Klosneuvirus	31.7	3.6e-52
WP_008881843.1|1811999_1812455_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_060475862.1|1812817_1814230_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_011887441.1|1814428_1815142_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_008881840.1|1815164_1816856_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_008881839.1|1816966_1818382_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_008881838.1|1818672_1819380_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008881837.1|1819771_1822216_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.9	1.8e-101
WP_008881836.1|1822276_1824214_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	45.8	2.1e-137
WP_008881835.1|1824373_1824793_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_087960023.1|1825087_1825657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881833.1|1825804_1827481_-	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	30.7	1.7e-47
WP_087960024.1|1827532_1827832_-	polyhydroxyalkanoate synthesis regulator	NA	NA	NA	NA	NA
WP_087960025.1|1827998_1828847_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011887449.1|1831234_1831867_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_041264860.1|1831911_1833582_-	membrane protein	NA	NA	NA	NA	NA
WP_029761299.1|1833805_1834423_+	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_008880192.1|1835052_1835637_-	ECF transporter S component	NA	NA	NA	NA	NA
1834475:1835024	attR	CCCGAGTTCGACAGTGACTAGGCAAACAAATCGCCTCCCAGCCCTTGATACAGAAGGGCTGAGAGGCAATTGGGCATACTTCTAGCGTGTATCTAGGAGCGAGGATGAATGTCTAGGATCTTCAGAGGAGGCTCCAGCCCTAGAGCCACAGAGGTTTTCCTTTGTTTGGTCGTGATCTTTGTACACTGATAGAGGTCACGATATTTTGAAGAAAAATGTCCTAACGTGGAGCGCTGACATTTGTCTCTTACTTTCGGCCACGATTTTACTCTCGATTCGGATCAAGAGGAGGATTAGACCGTGGAGAAGCACGTGAGCATAGATGCAATCCTCCAATTGATGGTACATTGACAGTAACCACGGTTACCCATCGAATGTACATGTCTATATTATAAACAAAAAAACTTTATATTAAAAGGATTAAATTATAAAGCGTGTGCCTATGAAATTCGGCGTTTTTTCCTAGGTTAACCACCGCTAAACCCTTGATATAACGGCATTTCTGGCATTTTCATTTGCCTAAAATGGGCCTCAAACTGTCGAACTCGGG	NA	NA	NA	NA
WP_060475866.1|1836067_1837279_-	threonine synthase	NA	NA	NA	NA	NA
WP_008880190.1|1837684_1838920_+	peptidase T	NA	NA	NA	NA	NA
WP_131261692.1|1839458_1839758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029761295.1|1839846_1840272_-	OsmC family protein	NA	NA	NA	NA	NA
WP_076611651.1|1840470_1841515_+|transposase	IS630-like element ISBs2 family transposase	transposase	S5VXX4	Leptospira_phage	27.5	4.7e-27
>prophage 9
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	2167855	2220399	3640707	integrase,transposase	Streptococcus_phage(37.5%)	55	2158849:2158863	2183790:2183804
2158849:2158863	attL	CCGGGCAACGGCGGA	NA	NA	NA	NA
WP_081157677.1|2167855_2169292_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	5.4e-05
WP_008880611.1|2169711_2170854_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_008880610.1|2171041_2171992_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_008880609.1|2172060_2172612_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_008880608.1|2172801_2173668_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_029761801.1|2173912_2175124_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_008880606.1|2175165_2176029_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_087960101.1|2176220_2177738_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_029761799.1|2177755_2178529_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011887594.1|2178541_2179318_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_029761798.1|2179310_2179622_-	EthD family reductase	NA	NA	NA	NA	NA
WP_008880601.1|2179638_2180121_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_011887597.1|2180283_2181117_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_011887598.1|2181092_2181452_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_029761796.1|2181459_2182428_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_008880597.1|2182537_2183869_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
2183790:2183804	attR	TCCGCCGTTGCCCGG	NA	NA	NA	NA
WP_008880596.1|2184488_2186168_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_008880595.1|2186685_2187810_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	3.4e-71
WP_081157454.1|2187806_2189051_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	2.1e-98
WP_008880593.1|2189225_2189627_-	GtrA family protein	NA	NA	NA	NA	NA
WP_081157574.1|2191189_2191639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960102.1|2191724_2192291_-	shikimate kinase	NA	NA	NA	NA	NA
WP_087960103.1|2192353_2193127_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_157663120.1|2193594_2193777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960104.1|2194625_2194994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374822.1|2195051_2196557_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041468500.1|2196553_2197306_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.4	6.6e-39
WP_008880569.1|2197606_2198275_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	1.4e-24
WP_008880568.1|2198271_2199618_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_029761787.1|2199727_2200639_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.0	2.0e-42
WP_008880566.1|2200635_2201355_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_029761786.1|2201355_2202099_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015374614.1|2202370_2203504_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157663122.1|2203920_2204085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880555.1|2204623_2205472_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_087960106.1|2206297_2207416_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_087960107.1|2207607_2207886_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_087960109.1|2208037_2208820_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_029761631.1|2208903_2210040_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_008880548.1|2210089_2210659_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_008880547.1|2210682_2210979_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_008880546.1|2210991_2211357_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_087960110.1|2211382_2211865_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_029761633.1|2211913_2212141_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_008880543.1|2212243_2212504_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_029761634.1|2212470_2212866_-	rhodanese	NA	NA	NA	NA	NA
WP_087959979.1|2213264_2213591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157663112.1|2213587_2214460_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	1.3e-49
WP_087960111.1|2214608_2216171_-	MFS transporter	NA	NA	NA	NA	NA
WP_029761636.1|2216185_2216908_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_060475979.1|2216913_2217618_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_008880538.1|2217624_2218254_-	YhbD family protein	NA	NA	NA	NA	NA
WP_008880537.1|2218825_2219182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157663123.1|2219829_2219991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080320064.1|2220003_2220399_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	41.1	4.9e-17
>prophage 10
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	2342490	2353196	3640707		Pandoravirus(25.0%)	13	NA	NA
WP_008879611.1|2342490_2343510_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.2	2.4e-68
WP_008879612.1|2343503_2345030_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	37.7	9.0e-35
WP_008879613.1|2345261_2345642_-	chorismate mutase	NA	NA	NA	NA	NA
WP_011887695.1|2345638_2346739_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	28.5	4.8e-22
WP_008879615.1|2346741_2347908_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.2	3.8e-41
WP_008879616.1|2348009_2348780_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_008879617.1|2348858_2349308_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	7.0e-28
WP_008879618.1|2349405_2350368_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	23.6	1.1e-06
WP_029760974.1|2350384_2351089_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_029760975.1|2351093_2351873_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008879621.1|2351986_2352211_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_029760976.1|2352223_2352790_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.9	4.8e-50
WP_008879623.1|2352923_2353196_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	78.9	3.5e-30
>prophage 11
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	2415344	2425823	3640707		Staphylococcus_phage(50.0%)	12	NA	NA
WP_029761014.1|2415344_2416490_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	1.1e-21
WP_087960136.1|2416790_2418140_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.6	9.1e-39
WP_087960137.1|2418355_2418580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008879698.1|2419012_2419411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008879699.1|2419457_2420087_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	9.5e-15
WP_029761017.1|2420318_2421074_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.1	3.2e-09
WP_008879701.1|2421340_2421853_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_008879702.1|2421908_2422259_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011887731.1|2422379_2422844_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.4	8.8e-42
WP_008879704.1|2422861_2424055_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	8.7e-118
WP_011887733.1|2424078_2424723_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.6	1.5e-39
WP_008879706.1|2424722_2425823_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.8	1.1e-58
>prophage 12
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	2698053	2755292	3640707	protease,coat,tRNA	Pacmanvirus(20.0%)	55	NA	NA
WP_087960161.1|2698053_2699622_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_011887898.1|2699780_2700884_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_008881057.1|2700898_2701729_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_087960162.1|2701761_2703324_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_008881059.1|2703428_2704574_+	IscS subfamily cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	9.5e-29
WP_011887901.1|2704561_2705110_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_011887902.1|2705388_2706237_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_008881062.1|2706258_2706702_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_087960163.1|2706719_2708021_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_008881064.1|2708115_2708676_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_008881065.1|2708853_2709144_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011887906.1|2709159_2709492_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_008881067.1|2709495_2709804_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_029760656.1|2710049_2710910_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011887908.1|2710902_2711670_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_008881070.1|2712104_2712908_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011887909.1|2712910_2713594_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011887910.1|2713643_2714162_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_008881074.1|2714158_2715025_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_008881075.1|2715045_2716068_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_171355528.1|2716225_2716897_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_008881078.1|2717021_2717603_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_008881079.1|2717721_2718846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029760654.1|2718962_2719397_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011887912.1|2719415_2720084_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
WP_008881082.1|2720080_2720656_-	fimbrial protein	NA	NA	NA	NA	NA
WP_008881083.1|2720645_2721578_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011887913.1|2721603_2722350_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_172825309.1|2722355_2722838_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_081156941.1|2722924_2724136_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_008881087.1|2724122_2725178_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_008881088.1|2725190_2726855_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_087960165.1|2726851_2728219_-	VanW family protein	NA	NA	NA	NA	NA
WP_011887916.1|2728588_2729935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881091.1|2730059_2730671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881092.1|2730654_2731230_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_087960166.1|2731246_2732824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960167.1|2732932_2734939_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087960168.1|2734997_2736302_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_087960169.1|2736432_2739075_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.0	7.2e-165
WP_008881097.1|2739659_2739848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029760645.1|2739844_2740876_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_008881099.1|2740919_2741984_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_008881100.1|2742102_2743392_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011887919.1|2743407_2744382_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_087960170.1|2744382_2745153_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_008881103.1|2745152_2746082_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_008881104.1|2746097_2746913_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011887920.1|2746923_2748291_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_008881106.1|2748455_2748941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881107.1|2749014_2749602_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011887921.1|2749598_2751941_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.0	2.8e-184
WP_157663126.1|2752019_2752196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881109.1|2752209_2753886_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.2	1.8e-12
WP_087960171.1|2754026_2755292_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.7	1.8e-150
>prophage 13
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	2949577	2958793	3640707	holin	Staphylococcus_phage(57.14%)	13	NA	NA
WP_008880953.1|2949577_2951164_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	7.3e-197
WP_008880954.1|2951362_2951605_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_008880955.1|2951753_2952542_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	36.9	2.6e-33
WP_081157199.1|2952760_2953765_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008880957.1|2953783_2954602_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.2e-31
WP_011888013.1|2954588_2955398_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_029760561.1|2955450_2955918_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	36.8	8.6e-21
WP_008880960.1|2955976_2956315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880961.1|2956569_2956965_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	49.6	1.8e-24
WP_008880962.1|2957107_2957548_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	68.5	6.2e-53
WP_008880963.1|2957642_2957858_+	YtzI protein	NA	NA	NA	NA	NA
WP_008880964.1|2957882_2958359_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_087960383.1|2958556_2958793_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	63.5	3.9e-22
>prophage 14
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	3387056	3398432	3640707	transposase	Rhodobacter_phage(100.0%)	12	NA	NA
WP_087960120.1|3387056_3387614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021292743.1|3387754_3389008_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_011230382.1|3389000_3389801_+	ExeA family protein	NA	NA	NA	NA	NA
WP_087960294.1|3389998_3390838_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011886984.1|3390828_3391140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081157551.1|3392221_3393508_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023633822.1|3393949_3395617_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011888350.1|3395965_3396418_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011888351.1|3396767_3397025_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_087960295.1|3396993_3397389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025039361.1|3397388_3397667_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_087960296.1|3397955_3398432_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	3537057	3592072	3640707	protease,coat,transposase,tRNA	Bacillus_phage(30.0%)	54	NA	NA
WP_008880742.1|3537057_3537726_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011888418.1|3537857_3538046_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_008880744.1|3538147_3539449_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.0	1.6e-48
WP_029761107.1|3539503_3540022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880746.1|3540035_3541334_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.2	1.4e-23
WP_008880747.1|3541478_3541706_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_008880748.1|3541876_3542533_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	3.8e-06
WP_081157464.1|3542642_3543503_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_060476330.1|3543459_3543756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880750.1|3543816_3544791_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_035499495.1|3545025_3545772_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_008880752.1|3546065_3546494_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_008880753.1|3546518_3547091_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_008880754.1|3547227_3547728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880755.1|3547747_3548650_+	prenyltransferase	NA	NA	NA	NA	NA
WP_008880756.1|3548703_3549075_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_081157460.1|3549211_3549457_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_008880758.1|3549700_3550000_-	YwdI family protein	NA	NA	NA	NA	NA
WP_008880759.1|3550016_3550706_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	50.2	7.9e-55
WP_081157459.1|3550852_3551203_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_008880761.1|3551199_3551688_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_008880762.1|3551647_3552418_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RV91	Bacillus_phage	32.2	1.2e-16
WP_087960346.1|3552467_3554375_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_008880764.1|3554593_3555229_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_008880765.1|3555410_3555560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880766.1|3555824_3557207_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	30.4	1.5e-52
WP_087960347.1|3557471_3558323_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_008880768.1|3558545_3559742_-	MFS transporter	NA	NA	NA	NA	NA
WP_008880769.1|3560072_3560567_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011888430.1|3560659_3561727_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008880771.1|3561866_3563102_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008880772.1|3563219_3564353_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_008880773.1|3564671_3565487_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_008880775.1|3565899_3567357_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_008880776.1|3567766_3568588_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008880777.1|3568658_3569315_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011888433.1|3569311_3570034_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	3.6e-34
WP_087960348.1|3570227_3570527_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_011888435.1|3570528_3571143_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_087960349.1|3571146_3573093_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011888437.1|3573110_3574019_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_029761091.1|3574292_3575015_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_008880787.1|3575249_3576638_+	amino acid permease	NA	NA	NA	NA	NA
WP_108437899.1|3576783_3577152_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.9	2.3e-08
WP_008880788.1|3577749_3579135_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_087960350.1|3579319_3580846_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008880790.1|3581013_3581976_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_015374614.1|3582163_3583297_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087960351.1|3583388_3584549_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	1.9e-53
WP_008880792.1|3585167_3586406_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_099233577.1|3586735_3587155_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087959814.1|3587321_3588491_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.1	2.5e-24
WP_011888445.1|3589498_3590203_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023633822.1|3590404_3592072_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP020030	Geobacillus thermodenitrificans strain T12 chromosome, complete genome	3640707	3611138	3620933	3640707		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_035499498.1|3611138_3612356_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.3	3.6e-18
WP_008880801.1|3612457_3613252_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.9	1.6e-43
WP_008880802.1|3613258_3614041_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_087960359.1|3614027_3615356_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_087960360.1|3615348_3617178_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.5	1.1e-23
WP_008880805.1|3617184_3617898_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.3	1.0e-44
WP_008880807.1|3618122_3619409_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.4	1.7e-71
WP_008880808.1|3619568_3620933_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.4	1.8e-122
>prophage 1
NZ_CP020031	Geobacillus thermodenitrificans strain T12 plasmid pGeo12a, complete sequence	58808	23978	46522	58808	tRNA,protease,integrase,transposase	Bacillus_phage(33.33%)	22	40305:40318	46608:46621
WP_033017076.1|23978_25232_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_042412494.1|25372_25930_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_087960404.1|27308_28577_+	diaminopimelate decarboxylase	NA	A0A2K9L0W9	Tupanvirus	25.1	8.9e-20
WP_087960405.1|28608_29643_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_087960406.1|29894_30173_+	PqqD family protein	NA	NA	NA	NA	NA
WP_087960407.1|30181_31171_+	hypothetical protein	NA	F8WQ32	Bacillus_phage	26.7	1.2e-11
WP_087960408.1|31174_32128_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_157663135.1|32105_33005_+	thymidylate synthase	NA	G3MA60	Bacillus_virus	39.7	5.3e-43
WP_087960410.1|32964_33492_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_087960411.1|33482_34121_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087960412.1|34113_34794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960413.1|34808_35084_+	PqqD family protein	NA	NA	NA	NA	NA
WP_087960414.1|35083_35857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960415.1|36013_36730_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_157663136.1|36751_37363_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_087960417.1|37368_38349_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	2.0e-27
WP_087960418.1|38345_39134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087960419.1|39127_39922_+	ABC transporter permease	NA	NA	NA	NA	NA
40305:40318	attL	AAAGATTGAACCTA	NA	NA	NA	NA
WP_087960420.1|41304_42219_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.0	6.0e-18
WP_081157650.1|42348_43113_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	5.5e-49
WP_081157651.1|43109_44678_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_008881770.1|45514_46522_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
46608:46621	attR	TAGGTTCAATCTTT	NA	NA	NA	NA
