The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	142854	201428	2630908	transposase	Mycobacterium_phage(40.0%)	51	NA	NA
WP_026138135.1|142854_144180_-|transposase	ISL3-like element ISPfr2 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	3.6e-197
WP_048734242.1|144625_145135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160221.1|145289_146405_-|transposase	ISL3-like element ISPfr20 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.8	2.4e-08
WP_081012528.1|147052_149350_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_138428047.1|149397_149820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044635852.1|150064_151375_+|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
WP_112317707.1|151385_153053_+	ribulokinase	NA	NA	NA	NA	NA
WP_013162070.1|153171_155238_+	transketolase	NA	NA	NA	NA	NA
WP_013162069.1|155518_155830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162068.1|156006_158295_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.1	4.3e-113
WP_013162067.1|158362_159259_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_080516212.1|159130_160207_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_013162065.1|160199_161285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162064.1|161285_162143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162063.1|162315_163545_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013162062.1|163541_164360_+	LmbE-like protein	NA	NA	NA	NA	NA
WP_013162061.1|164530_165142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162060.1|165259_166240_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	33.0	8.9e-36
WP_013162059.1|166323_167013_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_036941512.1|167038_168229_-	MFS transporter	NA	NA	NA	NA	NA
WP_013162057.1|168323_168668_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013162056.1|168750_169305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516161.1|169375_169921_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013162054.1|170049_170400_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013162053.1|170396_172511_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.0	4.1e-86
WP_013162052.1|172562_173054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162051.1|173172_173778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041704873.1|173863_174643_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013162049.1|174715_174940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080516160.1|175085_175829_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112317764.1|175903_176563_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_080516159.1|177106_177817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162045.1|177816_178854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112317708.1|179201_180626_+	CpaF family protein	NA	NA	NA	NA	NA
WP_013162043.1|180622_181516_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_013162042.1|181508_182414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048734334.1|182522_182723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162040.1|182697_183120_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_013162039.1|183344_183743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162038.1|183739_187432_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013162037.1|187442_188033_-	membrane protein	NA	NA	NA	NA	NA
WP_085763828.1|188032_189373_-	MFS transporter	NA	NA	NA	NA	NA
WP_013162033.1|189793_190759_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013160159.1|190867_192175_-|transposase	ISL3-like element ISPfr4 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.5	1.5e-195
WP_013160161.1|192417_193413_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	33.2	1.6e-40
WP_015069149.1|193458_194847_-	MFS transporter	NA	NA	NA	NA	NA
WP_036942789.1|194869_197938_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.8	2.1e-139
WP_155489274.1|197989_198151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044635852.1|198320_199631_+|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
WP_080516180.1|199721_200675_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041704400.1|200636_201428_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	785392	845442	2630908	portal,protease,transposase,tRNA	Propionibacterium_phage(86.54%)	66	NA	NA
WP_085763865.1|785392_786169_+	phage antirepressor	NA	A0A1D8ETE7	Propionibacterium_phage	86.8	6.9e-124
WP_085763866.1|786538_787039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763867.1|787148_787943_+	phage antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	59.1	6.3e-80
WP_085763868.1|788149_788347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060762567.1|788566_788782_+	hypothetical protein	NA	A0A1D8ETR2	Propionibacterium_phage	97.2	5.7e-36
WP_147628955.1|789005_789740_+	hypothetical protein	NA	A0A1D8ETM1	Propionibacterium_phage	96.0	1.2e-96
WP_085763870.1|789736_790408_+	hypothetical protein	NA	A0A1D8ETT3	Propionibacterium_phage	89.8	3.2e-69
WP_085763871.1|790404_791334_+	hypothetical protein	NA	A0A1D8ETR8	Propionibacterium_phage	93.1	2.1e-164
WP_085763872.1|791177_792134_+	hypothetical protein	NA	A0A1D8ETS8	Propionibacterium_phage	97.7	9.7e-144
WP_085763873.1|792130_792463_+	WhiB family transcriptional regulator	NA	A0A1D8EUD3	Propionibacterium_phage	96.4	1.7e-55
WP_085763874.1|792459_793020_+	hypothetical protein	NA	A0A1D8EUB4	Propionibacterium_phage	95.7	6.6e-92
WP_085763876.1|793482_793866_+	hypothetical protein	NA	A0A1D8EU48	Propionibacterium_phage	96.0	1.7e-62
WP_085763877.1|793865_794441_+	HNH endonuclease	NA	A0A1D8EUE9	Propionibacterium_phage	99.0	2.4e-105
WP_085763878.1|794418_794814_+	hypothetical protein	NA	A0A1D8EUC8	Propionibacterium_phage	99.0	3.7e-49
WP_085763879.1|794980_795328_+	hypothetical protein	NA	A0A1D8ETG5	Propionibacterium_phage	87.0	2.0e-54
WP_085763880.1|795324_795792_+	single-stranded DNA-binding protein	NA	A0A1D8EUD4	Propionibacterium_phage	89.0	2.4e-71
WP_085763881.1|795853_796084_+	hypothetical protein	NA	A0A1D8ETS4	Propionibacterium_phage	86.8	2.7e-28
WP_085763882.1|796117_796843_+	hypothetical protein	NA	A0A1D8ETT8	Propionibacterium_phage	92.5	2.8e-135
WP_085763883.1|796947_797163_+	hypothetical protein	NA	A0A1D8ETV1	Propionibacterium_phage	90.1	6.1e-30
WP_155642680.1|797422_797599_+	hypothetical protein	NA	A0A1D8ETN0	Propionibacterium_phage	100.0	6.1e-28
WP_081083056.1|797595_797934_+	HNH endonuclease	NA	A0A1D8ETU6	Propionibacterium_phage	100.0	4.4e-59
WP_060762541.1|798188_798683_+	hypothetical protein	NA	A0A1D8EU54	Propionibacterium_phage	100.0	1.8e-69
WP_097776132.1|801444_801639_+	hypothetical protein	NA	A0A1D8ETG8	Propionibacterium_phage	98.4	9.7e-27
WP_060762540.1|801592_803047_+	hypothetical protein	NA	A0A1D8ETU0	Propionibacterium_phage	97.7	8.0e-275
WP_085763885.1|803043_804555_+|portal	phage portal protein	portal	A0A1D8ETN4	Propionibacterium_phage	93.6	4.4e-268
WP_085763886.1|804541_805327_+	hypothetical protein	NA	A0A1D8ETP7	Propionibacterium_phage	99.2	1.8e-148
WP_060762537.1|805585_806218_+	hypothetical protein	NA	A0A1D8EU60	Propionibacterium_phage	99.5	4.0e-106
WP_085763887.1|806234_807215_+	hypothetical protein	NA	A0A1D8ETI7	Propionibacterium_phage	98.8	8.6e-180
WP_060762535.1|807240_807441_+	hypothetical protein	NA	A0A1D8ETN7	Propionibacterium_phage	100.0	1.3e-29
WP_085763888.1|807427_807808_+	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	96.0	1.3e-62
WP_085763889.1|807828_808146_+	hypothetical protein	NA	A0A1D8ETP0	Propionibacterium_phage	98.1	5.2e-54
WP_060761578.1|808138_808387_+	hypothetical protein	NA	A0A1D8EUB6	Propionibacterium_phage	98.8	9.8e-40
WP_085763890.1|808383_808752_+	hypothetical protein	NA	A0A1D8EU21	Propionibacterium_phage	91.0	4.2e-55
WP_085763891.1|808760_809624_+	hypothetical protein	NA	A0A1D8EU16	Propionibacterium_phage	99.7	5.8e-156
WP_085763892.1|809721_810075_+	hypothetical protein	NA	A0A1D8EU71	Propionibacterium_phage	99.1	1.1e-55
WP_085763893.1|810074_810443_+	hypothetical protein	NA	A0A1D8ETH1	Propionibacterium_phage	98.4	1.5e-65
WP_112317739.1|810355_814633_+	tape measure protein	NA	A0A1D8EU70	Propionibacterium_phage	95.9	0.0e+00
WP_085763895.1|814634_815450_+	hypothetical protein	NA	A0A1D8EU13	Propionibacterium_phage	94.5	8.0e-147
WP_147628956.1|815449_816622_+	hypothetical protein	NA	A0A1D8ETQ1	Propionibacterium_phage	97.2	9.8e-215
WP_085763897.1|816618_816849_+	hypothetical protein	NA	A0A1D8ETJ3	Propionibacterium_phage	97.4	7.4e-34
WP_147628957.1|816888_817497_+	hypothetical protein	NA	A0A1D8ETK0	Propionibacterium_phage	95.5	7.3e-105
WP_112317738.1|817500_818649_+	hypothetical protein	NA	A0A1D8ETJ1	Propionibacterium_phage	83.9	4.2e-77
WP_085763899.1|818701_819136_+	hypothetical protein	NA	A0A1D8ETR9	Propionibacterium_phage	97.0	6.5e-71
WP_060762096.1|819132_819408_+	hypothetical protein	NA	A0A1D8ETK8	Propionibacterium_phage	100.0	1.2e-49
WP_085763900.1|820312_820534_+	hypothetical protein	NA	A0A1D8EU85	Propionibacterium_phage	94.5	2.8e-30
WP_147628958.1|820615_821542_-	hypothetical protein	NA	A0A1D8EU84	Propionibacterium_phage	79.9	2.2e-140
WP_085763902.1|822004_822394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763903.1|822496_822691_-	ribbon-helix-helix protein, CopG family	NA	A0A1D8ETS3	Propionibacterium_phage	88.7	1.1e-22
WP_085763904.1|822816_823068_-	hypothetical protein	NA	A0A173G9I1	Propionibacterium_phage	78.9	2.2e-23
WP_013160730.1|823934_825518_+	trigger factor	NA	NA	NA	NA	NA
WP_013160731.1|825742_826936_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013160732.1|827126_828401_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_112317799.1|828496_829123_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.6	1.3e-40
WP_013160734.1|829146_829836_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	38.7	7.4e-29
WP_013160735.1|829957_831235_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	4.4e-136
WP_013160736.1|831346_831661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160737.1|831779_833222_+	threonine synthase	NA	NA	NA	NA	NA
WP_013160738.1|833300_834422_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_013160739.1|834506_835256_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_041704115.1|835363_837991_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	36.3	5.3e-160
WP_013160741.1|838080_838875_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_112317735.1|839967_840558_-	DoxX family protein	NA	NA	NA	NA	NA
WP_013160744.1|840693_842199_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_085763905.1|842309_842885_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.2	2.4e-28
WP_112317734.1|842820_844030_+|transposase	IS3-like element ISPfr11 family transposase	transposase	U5P429	Shigella_phage	34.4	1.4e-35
WP_013160746.1|844101_845442_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	2195310	2220884	2630908	transposase,integrase	Mycobacterium_phage(66.67%)	17	2195537:2195551	2226216:2226230
WP_044635852.1|2195310_2196621_-|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
2195537:2195551	attL	AGCAGCGCGGGGACG	NA	NA	NA	NA
WP_138428047.1|2196865_2197288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081012528.1|2197335_2199633_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_013160232.1|2202368_2203349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764014.1|2203693_2204974_+|transposase	ISL3-like element ISPfr3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	76.7	9.8e-192
WP_112317749.1|2205013_2205574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160226.1|2205675_2206068_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	35.1	2.5e-05
WP_013160225.1|2206067_2206547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160224.1|2206746_2211528_+	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	25.5	4.0e-36
WP_026138135.1|2212013_2213339_-|transposase	ISL3-like element ISPfr2 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	3.6e-197
WP_013161944.1|2213563_2214871_+|transposase	ISL3-like element ISPfr7 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.5	5.9e-168
WP_143828517.1|2214842_2215085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013161946.1|2215449_2216454_+|transposase	IS481-like element ISPfr15 family transposase	transposase	NA	NA	NA	NA
WP_013161947.1|2216515_2217778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112317751.1|2217984_2218509_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013161949.1|2218489_2218966_-	VOC family protein	NA	NA	NA	NA	NA
WP_049770860.1|2219159_2220884_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2226216:2226230	attR	AGCAGCGCGGGGACG	NA	NA	NA	NA
>prophage 4
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	2225857	2302271	2630908	transposase,integrase	Staphylococcus_phage(15.38%)	60	2213585:2213616	2300982:2301013
2213585:2213616	attL	ACCCCTGACCTGACCACGTTCTGCCGTCTCGA	NA	NA	NA	NA
WP_013161956.1|2225857_2226451_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013161957.1|2226681_2227023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112317812.1|2227951_2228404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013161961.1|2228587_2229022_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	47.6	8.5e-23
WP_013161962.1|2228997_2230317_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.8	1.1e-76
WP_013161963.1|2230398_2230809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013161964.1|2230805_2231030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080516152.1|2231906_2233130_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_013160158.1|2233288_2234707_+|transposase	IS30-like element ISPfr9 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	3.5e-33
WP_085763981.1|2234856_2236212_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.6	6.0e-91
WP_112317734.1|2236725_2237936_-|transposase	IS3-like element ISPfr11 family transposase	transposase	U5P429	Shigella_phage	34.4	1.4e-35
WP_013161972.1|2239912_2240542_+	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_013161975.1|2241040_2243041_+	site-specific DNA-methyltransferase	NA	A0A0M7Q8J6	Escherichia_phage	30.5	2.5e-40
WP_013161976.1|2243040_2245614_+	type III restriction enzyme	NA	NA	NA	NA	NA
WP_013161977.1|2245782_2246418_+	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_146206029.1|2246523_2247624_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_013161979.1|2247925_2249434_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_036943453.1|2249590_2250058_-	6,7-dimethyl-8-ribityllumazine synthase	NA	NA	NA	NA	NA
WP_063493675.1|2250054_2251524_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	35.7	1.1e-69
WP_013161982.1|2251520_2252183_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_013161983.1|2252272_2253493_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	NA	NA	NA	NA
WP_013161984.1|2253893_2254253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013161985.1|2254310_2254793_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_063493674.1|2254863_2256819_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_013161987.1|2256951_2257131_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_080516153.1|2257487_2257871_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_013161989.1|2258078_2259491_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_013161990.1|2259497_2261051_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_048735524.1|2261919_2262444_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013161992.1|2262962_2264033_+	daunorubicin/doxorubicin resistance ABC transporter ATP-binding protein DrrA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	2.0e-20
WP_013161993.1|2264029_2264860_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013161994.1|2265172_2266225_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	6.7e-29
WP_041704860.1|2266221_2267028_-	sulfate ABC transporter permease	NA	NA	NA	NA	NA
WP_081014902.1|2267020_2268085_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_112317752.1|2268081_2269188_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080516209.1|2269976_2271782_+	sulfite reductase	NA	NA	NA	NA	NA
WP_055344978.1|2271778_2272528_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_112317813.1|2272635_2273622_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_055344318.1|2273624_2274974_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	25.8	3.1e-31
WP_013162002.1|2275306_2275789_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_044636415.1|2276123_2276804_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_112317814.1|2276814_2277549_-	VIT family protein	NA	NA	NA	NA	NA
WP_080774550.1|2278201_2279812_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_063493673.1|2279862_2284239_-	activase	NA	NA	NA	NA	NA
WP_080516211.1|2284431_2284776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036943408.1|2285723_2286533_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_036943471.1|2286538_2287258_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_044636881.1|2287410_2288466_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013162009.1|2288567_2288987_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_085763982.1|2288986_2289862_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_063493907.1|2289918_2291385_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_080969706.1|2291323_2291950_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013162014.1|2292008_2292593_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_013162015.1|2292596_2293046_-	HIT family protein	NA	NA	NA	NA	NA
WP_026138135.1|2293750_2295076_-|transposase	ISL3-like element ISPfr2 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	3.6e-197
WP_048734242.1|2295521_2296031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160221.1|2296185_2297301_-|transposase	ISL3-like element ISPfr20 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.8	2.4e-08
WP_081012528.1|2297948_2300246_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_138428047.1|2300293_2300716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044635852.1|2300960_2302271_+|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
2300982:2301013	attR	ACCCCTGACCTGACCACGTTCTGCCGTCTCGA	NA	NA	NA	NA
>prophage 5
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	2320055	2377698	2630908	integrase,transposase,protease,tRNA	Mycobacterium_phage(20.0%)	43	2310248:2310264	2379996:2380012
2310248:2310264	attL	CCCTGCCCGGCGTCGAG	NA	NA	NA	NA
WP_044635852.1|2320055_2321366_-|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
WP_155489274.1|2321535_2321697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036942789.1|2321748_2324817_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.8	2.1e-139
WP_015069149.1|2324839_2326228_+	MFS transporter	NA	NA	NA	NA	NA
WP_013160161.1|2326273_2327269_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	33.2	1.6e-40
WP_013160159.1|2327511_2328819_+|transposase	ISL3-like element ISPfr4 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.5	1.5e-195
WP_013160158.1|2328965_2330384_+|transposase	IS30-like element ISPfr9 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	3.5e-33
WP_085763981.1|2330533_2331889_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.6	6.0e-91
WP_112317734.1|2332402_2333613_-|transposase	IS3-like element ISPfr11 family transposase	transposase	U5P429	Shigella_phage	34.4	1.4e-35
WP_080713575.1|2333869_2335237_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_048733818.1|2335789_2337232_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_129931506.1|2337235_2337976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160152.1|2338134_2341530_+	PPi-type phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_013160150.1|2342411_2342933_+	EXLDI protein	NA	NA	NA	NA	NA
WP_013160149.1|2343052_2343907_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013160148.1|2343948_2344593_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.9	5.1e-40
WP_013160147.1|2344705_2345440_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_013160146.1|2345618_2345906_+	cell division protein CrgA	NA	NA	NA	NA	NA
WP_085763983.1|2346221_2347256_+	DUF4862 family protein	NA	NA	NA	NA	NA
WP_013160144.1|2347481_2348828_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_013160143.1|2348838_2349813_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_013160142.1|2349809_2350922_-	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_044657700.1|2351066_2351789_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041704387.1|2351974_2353441_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	35.2	1.2e-68
WP_085763984.1|2353725_2355420_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.9	3.1e-20
WP_036940097.1|2356640_2357003_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013160136.1|2357163_2358666_-	amino acid permease	NA	NA	NA	NA	NA
WP_013160135.1|2358918_2359809_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_080516035.1|2359856_2360579_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160133.1|2360578_2362312_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	8.7e-34
WP_013160132.1|2362308_2364372_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	9.3e-59
WP_013160131.1|2364663_2365563_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112317753.1|2365580_2366300_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_112317816.1|2366317_2366767_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160128.1|2367178_2367751_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013160127.1|2367747_2368413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160126.1|2368486_2368930_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_147628971.1|2368933_2369398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147628972.1|2369438_2369825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160123.1|2373479_2374079_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013160122.1|2374092_2375403_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.9	1.4e-12
WP_112317754.1|2375793_2376378_+	helix-turn-helix transcriptional regulator	NA	A0A2H4PE70	Mycobacterium_phage	39.7	7.7e-11
WP_013160119.1|2376408_2377698_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.1	5.3e-36
2379996:2380012	attR	CTCGACGCCGGGCAGGG	NA	NA	NA	NA
>prophage 6
NZ_CP018002	Propionibacterium freudenreichii strain P.UF1 chromosome, complete genome	2630908	2459386	2513588	2630908	transposase,holin,tRNA	Mycobacterium_phage(30.77%)	47	NA	NA
WP_013160195.1|2459386_2460694_+|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.1	1.8e-169
WP_085763988.1|2460665_2461370_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	43.9	5.8e-21
WP_112317757.1|2464151_2464511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080713571.1|2465222_2466167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516176.1|2466185_2466545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063493589.1|2466435_2466744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159941.1|2466780_2468088_-|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.3	4.8e-170
WP_080516026.1|2468106_2468859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160047.1|2468861_2469206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080713591.1|2469843_2470803_+	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	39.4	1.1e-25
WP_013160045.1|2470975_2472124_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.8	1.6e-31
WP_080713589.1|2472133_2473750_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_080516024.1|2473895_2474798_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_013160042.1|2474908_2475712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044635867.1|2476214_2477519_+	citrate synthase	NA	NA	NA	NA	NA
WP_013160040.1|2477730_2478339_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GVU2	Streptomyces_phage	44.1	1.2e-27
WP_063493591.1|2478653_2480855_+	serine/threonine protein kinase	NA	A0A1M7XTW9	Cedratvirus	26.9	9.1e-12
WP_013160038.1|2481330_2482056_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_013160037.1|2482048_2482912_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_080516023.1|2482969_2484706_+	gluconokinase	NA	NA	NA	NA	NA
WP_013160035.1|2484883_2485690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112317734.1|2485796_2487007_-|transposase	IS3-like element ISPfr11 family transposase	transposase	U5P429	Shigella_phage	34.4	1.4e-35
WP_013160028.1|2487094_2487292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036940431.1|2488021_2490436_+	nitric oxide reductase	NA	NA	NA	NA	NA
WP_036940428.1|2491444_2492209_+	slipin family protein	NA	A0A2K9L035	Tupanvirus	32.6	5.0e-26
WP_044636453.1|2492322_2492745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057374829.1|2492803_2492995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764015.1|2493012_2494122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763989.1|2494305_2494869_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013160018.1|2494931_2496026_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_036943364.1|2496072_2496327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763990.1|2496250_2497606_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.2	5.9e-187
WP_013160015.1|2497572_2498361_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013160014.1|2498644_2499244_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
WP_013160013.1|2499247_2500252_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_013160012.1|2500390_2500771_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013160011.1|2500767_2501232_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_013160010.1|2501287_2502202_+	peptidase E	NA	NA	NA	NA	NA
WP_013160009.1|2502208_2502904_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080969631.1|2502900_2504328_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.4e-21
WP_112317820.1|2504356_2505544_-	MFS transporter	NA	NA	NA	NA	NA
WP_013160006.1|2505615_2506614_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_013160005.1|2507046_2507823_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	6.7e-18
WP_013160004.1|2507896_2508949_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_085763991.1|2509001_2510558_-	xylulose kinase	NA	NA	NA	NA	NA
WP_085763992.1|2510986_2512246_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_013159941.1|2512280_2513588_-|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.3	4.8e-170
