The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019743	Lactobacillus brevis strain TMW 1.2111 chromosome, complete genome	2571250	883476	921565	2571250	capsid,terminase,tail,plate	Lactobacillus_phage(92.31%)	58	NA	NA
WP_085768824.1|883476_883848_-	helix-turn-helix transcriptional regulator	NA	Q6SEA1	Lactobacillus_prophage	53.3	2.7e-09
WP_155275713.1|884252_884402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086990319.1|884786_884984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768826.1|884980_885358_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	42.1	1.9e-18
WP_085768827.1|885559_885757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130456.1|885911_886082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768828.1|886138_886645_+	hypothetical protein	NA	D6PST4	Lactobacillus_phage	35.7	2.5e-18
WP_085768829.1|886650_886962_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_156646391.1|886964_887123_+	hypothetical protein	NA	D6PST6	Lactobacillus_phage	76.9	7.4e-17
WP_157130457.1|887232_887409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768830.1|887396_887996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768831.1|887982_888738_+	AAA family ATPase	NA	D2KRE2	Lactobacillus_phage	28.6	1.3e-18
WP_085768832.1|888740_889334_+	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_085768833.1|889426_890323_+	DUF4373 domain-containing protein	NA	D6PSU3	Lactobacillus_phage	73.8	3.4e-106
WP_085768834.1|890319_891081_+	phage antirepressor KilAC domain-containing protein	NA	Q38330	Lactococcus_phage	49.1	1.9e-62
WP_085768835.1|891093_891516_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	57.0	3.1e-38
WP_085768836.1|891503_891767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768837.1|891936_892116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768838.1|892167_892515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768839.1|892626_893103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769496.1|893403_893841_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	99.3	4.2e-78
WP_085768840.1|894112_894322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768841.1|894311_894689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768842.1|895186_895633_-	universal stress protein	NA	NA	NA	NA	NA
WP_085768843.1|895920_896280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085768844.1|896417_896612_+	hypothetical protein	NA	D6PSW6	Lactobacillus_phage	93.8	7.1e-30
WP_085768845.1|896595_896829_+	hypothetical protein	NA	D6PSW7	Lactobacillus_phage	92.2	2.3e-35
WP_085768846.1|896887_897607_+	TerS	NA	D6PSW8	Lactobacillus_phage	96.6	8.1e-111
WP_085768847.1|897623_898961_+|terminase	terminase	terminase	D6PSX1	Lactobacillus_phage	98.2	7.4e-166
WP_085768848.1|898977_900339_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	98.5	8.9e-260
WP_094118946.1|900766_901168_+|capsid	minor capsid protein	capsid	D6PSX3	Lactobacillus_phage	97.0	6.6e-70
WP_167571569.1|901190_901460_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSX4	Lactobacillus_phage	88.8	7.9e-19
WP_085768851.1|901471_902575_+	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	91.0	5.9e-161
WP_094118947.1|902589_902778_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	100.0	3.6e-18
WP_094118948.1|902798_903053_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	95.2	7.9e-37
WP_042254688.1|903067_903946_+	DUF2184 domain-containing protein	NA	D6PSX7	Lactobacillus_phage	99.3	1.6e-161
WP_085768853.1|903956_904319_+	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	99.2	8.1e-59
WP_085768854.1|904330_904657_+	DUF4054 domain-containing protein	NA	D6PSX9	Lactobacillus_phage	93.5	5.6e-51
WP_085768855.1|904653_905256_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	97.5	3.5e-107
WP_085768856.1|905255_905630_+	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	95.2	7.8e-65
WP_085763035.1|905622_906093_+	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	94.9	4.2e-60
WP_085768857.1|906105_907143_+	DUF3383 family protein	NA	D6PSY3	Lactobacillus_phage	94.0	6.4e-141
WP_042750524.1|907157_907556_+	hypothetical protein	NA	D6PSY4	Lactobacillus_phage	98.5	1.2e-71
WP_085768858.1|907627_908002_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	90.3	1.4e-61
WP_157128262.1|908012_908183_+	hypothetical protein	NA	D6PSY6	Lactobacillus_phage	94.4	9.7e-23
WP_094118949.1|908197_912928_+|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	94.5	1.6e-159
WP_134787797.1|912990_913962_+	transglycosylase SLT domain-containing protein	NA	D6PSZ3	Lactobacillus_phage	52.7	3.7e-58
WP_085768860.1|913961_914609_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.6	3.4e-108
WP_167571570.1|914620_915013_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	96.9	2.3e-67
WP_134787768.1|914936_916244_+	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	91.5	6.9e-209
WP_085768863.1|916243_916588_+	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	96.5	2.1e-56
WP_085768864.1|916590_916989_+	DUF2634 domain-containing protein	NA	D6PSZ8	Lactobacillus_phage	78.6	2.2e-49
WP_085768865.1|916975_918154_+|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	80.6	4.6e-180
WP_085768866.1|918143_918803_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	83.6	4.3e-74
WP_085768867.1|918805_920374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768868.1|920386_920815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134787769.1|920826_920994_+	XkdX family protein	NA	NA	NA	NA	NA
WP_043022776.1|921211_921565_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	68.1	3.8e-37
>prophage 2
NZ_CP019743	Lactobacillus brevis strain TMW 1.2111 chromosome, complete genome	2571250	1371972	1381228	2571250	tRNA	Staphylococcus_phage(42.86%)	8	NA	NA
WP_021741848.1|1371972_1372824_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	5.8e-15
WP_085769039.1|1372992_1373634_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_085769040.1|1373813_1374305_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.2	5.7e-23
WP_085769041.1|1374321_1375272_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_021741845.1|1375283_1377176_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.5	1.2e-49
WP_085769042.1|1377204_1378398_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	7.1e-35
WP_011667555.1|1378531_1379470_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	2.2e-52
WP_011667553.1|1380952_1381228_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
>prophage 3
NZ_CP019743	Lactobacillus brevis strain TMW 1.2111 chromosome, complete genome	2571250	1605472	1686975	2571250	terminase,capsid,tail,tRNA,portal,protease,transposase,holin	Oenococcus_phage(34.21%)	79	NA	NA
WP_021740936.1|1605472_1606120_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011668204.1|1606185_1606977_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_085769118.1|1607038_1608265_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035464041.1|1608261_1608996_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	6.5e-23
WP_024855560.1|1609214_1609664_+	HIT family protein	NA	NA	NA	NA	NA
WP_011668209.1|1610098_1611016_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_085769119.1|1611080_1612055_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_085769120.1|1612067_1614692_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_085769508.1|1614681_1615896_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_085769121.1|1615979_1616324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769122.1|1616415_1618512_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_085769123.1|1618677_1619145_-	arginine repressor	NA	NA	NA	NA	NA
WP_085769124.1|1619383_1621075_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.6	3.8e-74
WP_011668217.1|1621546_1621768_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_011668218.1|1622101_1623361_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	40.0	1.8e-17
WP_085769126.1|1624424_1626476_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_085769127.1|1626627_1628352_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_085769128.1|1628374_1630399_-	transketolase	NA	NA	NA	NA	NA
WP_085769129.1|1630440_1631808_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_021742200.1|1631840_1632140_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_085769130.1|1632139_1632589_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_021742202.1|1632768_1633482_-	amino acid racemase	NA	NA	NA	NA	NA
WP_085769131.1|1633488_1634745_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_011668226.1|1639219_1639456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769134.1|1639593_1641396_-	cell surface protein	NA	NA	NA	NA	NA
WP_003555349.1|1641508_1642246_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.4	7.4e-59
WP_085769005.1|1642255_1643479_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	51.5	2.1e-106
WP_094118967.1|1643888_1646093_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_021742209.1|1646549_1646801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769137.1|1647538_1650049_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.5	2.2e-139
WP_134787778.1|1650614_1651148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769139.1|1651529_1651799_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	70.2	1.1e-25
WP_085769140.1|1651798_1652623_-	autolysin	NA	L0P6H6	Lactobacillus_phage	30.2	6.8e-13
WP_085769141.1|1652615_1653044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134787779.1|1653104_1653281_-	XkdX family protein	NA	NA	NA	NA	NA
WP_085769142.1|1653280_1653640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769143.1|1653653_1655606_-	hypothetical protein	NA	Q6SE73	Lactobacillus_prophage	35.6	8.0e-20
WP_167571577.1|1655630_1656053_-	DUF1617 family protein	NA	NA	NA	NA	NA
WP_085769145.1|1656080_1658456_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	40.8	3.4e-89
WP_085769509.1|1658473_1658803_-	hypothetical protein	NA	V9QIZ3	Oenococcus_phage	48.6	1.8e-25
WP_094118968.1|1658852_1660871_-	hypothetical protein	NA	Q6SE70	Lactobacillus_prophage	30.5	2.3e-46
WP_094118969.1|1660858_1664395_-	hypothetical protein	NA	V5URV5	Oenococcus_phage	35.7	1.1e-64
WP_085769510.1|1664407_1664692_-	hypothetical protein	NA	V5US89	Oenococcus_phage	47.3	3.3e-15
WP_085769147.1|1664778_1665189_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	50.8	1.3e-28
WP_167571578.1|1665252_1665501_-	hypothetical protein	NA	U5PW26	Acinetobacter_phage	55.6	8.3e-07
WP_085769149.1|1665514_1666039_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	59.3	7.1e-40
WP_085769150.1|1666057_1666432_-	hypothetical protein	NA	Q6SE74	Lactobacillus_prophage	44.2	3.7e-22
WP_085769151.1|1666412_1666970_-	hypothetical protein	NA	V5USK0	Oenococcus_phage	57.1	3.0e-52
WP_085769152.1|1666962_1667307_-	hypothetical protein	NA	V5US85	Oenococcus_phage	43.6	3.1e-20
WP_134787800.1|1667303_1667609_-	hypothetical protein	NA	V5UQW8	Oenococcus_phage	53.2	3.2e-16
WP_085769154.1|1667634_1668696_-|capsid	major capsid protein E	capsid	V9QKJ3	Oenococcus_phage	59.4	4.7e-115
WP_085769156.1|1669124_1669781_-	DUF4355 domain-containing protein	NA	V5URU4	Oenococcus_phage	50.0	1.1e-13
WP_134787780.1|1669944_1670127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167571579.1|1670123_1671338_-|capsid	minor capsid protein	capsid	V9QKG7	Oenococcus_phage	48.5	1.1e-104
WP_167571580.1|1671330_1671654_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_085769160.1|1671631_1673059_-|portal	phage portal protein	portal	V5USP8	Oenococcus_phage	49.1	2.8e-123
WP_085769161.1|1673078_1674446_-|terminase	PBSX family phage terminase large subunit	terminase	U3PBE8	Lactobacillus_phage	58.7	4.4e-150
WP_085769162.1|1674429_1675146_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	38.1	1.4e-09
WP_047021361.1|1676239_1676656_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	47.5	4.3e-32
WP_085769163.1|1676797_1677013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130462.1|1677021_1677189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769164.1|1677325_1677781_-	DUF1642 domain-containing protein	NA	A0A2K9VC51	Lactobacillus_phage	45.3	1.4e-28
WP_085769165.1|1677823_1678543_-	SAM-dependent DNA methyltransferase	NA	A0A097BYG1	Leuconostoc_phage	94.5	8.1e-127
WP_085769166.1|1678539_1678923_-	hypothetical protein	NA	A0A2P0ZKS9	Lactobacillus_phage	48.9	6.2e-25
WP_085769168.1|1679088_1679286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769169.1|1679278_1679689_-	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	74.4	1.3e-28
WP_085769170.1|1679859_1680630_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	52.5	5.3e-68
WP_085769172.1|1681361_1682081_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	71.4	1.9e-96
WP_085769173.1|1682095_1682614_-	DUF669 domain-containing protein	NA	Q6J1V7	Lactobacillus_phage	38.8	2.7e-23
WP_085769174.1|1682613_1683411_-	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	58.3	2.3e-74
WP_085769175.1|1683425_1683932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769176.1|1683934_1684213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769177.1|1684319_1684523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130463.1|1684512_1684677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769178.1|1684736_1685000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769179.1|1685059_1685344_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	45.7	3.9e-16
WP_167571560.1|1685340_1685484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769180.1|1685541_1686207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769181.1|1686264_1686975_-	hypothetical protein	NA	E9LUT0	Lactobacillus_phage	89.4	1.6e-119
>prophage 1
NZ_CP019744	Lactobacillus brevis strain TMW 1.2111 plasmid pl12111-1, complete sequence	107027	0	45459	107027	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_085769544.1|0_684_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	52.0	1.1e-61
WP_085769545.1|814_1675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769546.1|1815_2814_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.3	4.6e-56
WP_085769547.1|3013_3328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769548.1|3327_3582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769549.1|3591_3969_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	30.7	3.0e-08
WP_085769550.1|4045_4822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695418.1|5328_6354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.7e-41
WP_085769551.1|6602_7778_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	2.0e-26
WP_085769552.1|7993_8551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769553.1|8553_9570_+	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_085769554.1|9590_9821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053906162.1|11280_11559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769555.1|11580_11808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769556.1|12060_14121_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_085769557.1|14304_15429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769592.1|15848_16442_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_167571603.1|17347_18082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134787804.1|18352_19139_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042749385.1|19639_20998_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_054646974.1|23327_24311_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_042749381.1|24313_24985_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_042749380.1|25118_26048_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_003555349.1|26248_26986_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.4	7.4e-59
WP_085769005.1|26995_28219_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	51.5	2.1e-106
WP_085769558.1|28379_29120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769560.1|29444_29681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769561.1|29806_30358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769562.1|30445_30670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769563.1|30763_31693_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.5	3.9e-25
WP_085769564.1|32027_33050_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.7	5.9e-30
WP_085769565.1|33018_33708_-	hypothetical protein	NA	A0A2K9VDG6	Lactobacillus_phage	39.8	8.8e-30
WP_085769566.1|34840_35020_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_085769567.1|35046_35349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769568.1|35373_35523_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_085769569.1|35542_35812_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_134787806.1|35834_35972_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_085769570.1|36329_37241_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_134787809.1|38187_38268_+	hydrophobic toxin	NA	NA	NA	NA	NA
WP_085769571.1|38752_39682_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	5.2e-25
WP_085769572.1|39966_40584_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.5	9.0e-18
WP_134787807.1|40912_41473_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085769546.1|41860_42859_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.3	4.6e-56
WP_003555349.1|43488_44226_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.4	7.4e-59
WP_085769005.1|44235_45459_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	51.5	2.1e-106
>prophage 1
NZ_CP019745	Lactobacillus brevis strain TMW 1.2111 plasmid pl12111-2, complete sequence	82967	12754	70539	82967	holin,integrase,protease,transposase	unidentified_phage(22.22%)	45	39863:39922	43528:43596
WP_085769618.1|12754_14650_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	33.9	5.3e-85
WP_085769619.1|14801_15260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769620.1|15280_16111_+	class A sortase	NA	NA	NA	NA	NA
WP_085769621.1|16131_17079_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_085769622.1|17127_19455_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_085769623.1|19540_20668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769624.1|20657_20870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769625.1|21002_21359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769626.1|21935_22025_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_085769628.1|22770_23700_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	1.1e-24
WP_085769630.1|23867_24263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094119005.1|24599_26558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094119006.1|26536_26845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769632.1|26857_27079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130472.1|27106_27283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134787810.1|27288_30102_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_134787811.1|32530_32788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769635.1|32919_33519_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_085769636.1|33518_34100_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_085769594.1|34111_37837_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_085769637.1|37889_41537_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
39863:39922	attL	TCTCTATCGAACTAACCAAACGAACTTCGGAAAGATTCCCGGAAGCCCAATTGCGTATTG	NA	NA	NA	NA
WP_021350004.1|41593_42673_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	40.6	6.3e-67
WP_134787812.1|42674_44963_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
43528:43596	attR	CAATACGCAATTGGGCTTCCGGGAATCTTTCCGAAGTTCGTTTGGTTAGTTCGATAGAGATATTTCACC	NA	NA	NA	NA
WP_085769596.1|44983_47518_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_085769597.1|47507_49637_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_015638646.1|49665_51453_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_157130471.1|51476_51620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769598.1|51763_54223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769599.1|54353_54686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769600.1|54682_55369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769601.1|55380_57390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085769602.1|57389_58592_+	M23 family metallopeptidase	NA	E9LUJ4	Lactobacillus_phage	37.1	1.6e-10
WP_085769603.1|58607_59219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052256164.1|59284_59668_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	30.5	9.3e-05
WP_085769604.1|59670_59985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039106879.1|60581_60902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085769605.1|60923_61793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039106883.1|62232_62490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039106885.1|62789_63422_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	34.3	2.4e-18
WP_085769606.1|63492_63855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386897.1|64114_64399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080769722.1|64382_65282_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.3	6.3e-20
WP_075168839.1|65853_67377_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_075168776.1|68193_69432_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.0	3.8e-39
WP_085763795.1|69609_70539_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
