The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019750	Lactobacillus brevis strain TMW 1.2113 chromosome, complete genome	2537412	870913	995836	2537412	terminase,protease,integrase,plate,capsid,tail,transposase	Lactobacillus_phage(80.81%)	159	870691:870711	991467:991487
870691:870711	attL	TGGCGGAACTGGCAGACGCGC	NA	NA	NA	NA
WP_191981936.1|870913_872113_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	64.1	1.3e-142
WP_085763003.1|872544_873426_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	36.6	4.1e-16
WP_085763004.1|873544_873928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763005.1|873981_874305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275714.1|874415_874586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052415627.1|874597_875233_-	DUF4145 domain-containing protein	NA	A0A1X9I6S1	Streptococcus_phage	33.2	8.7e-24
WP_085763729.1|875243_875630_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	94.5	1.3e-67
WP_085763006.1|875658_876039_-	helix-turn-helix domain-containing protein	NA	D6PSS9	Lactobacillus_phage	53.1	1.3e-22
WP_047021620.1|876179_876407_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085763007.1|876676_876862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763008.1|876850_877099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157128259.1|877255_877420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763009.1|877480_877990_+	helix-turn-helix domain-containing protein	NA	D6PST4	Lactobacillus_phage	53.8	1.3e-41
WP_085763010.1|877994_878270_+	hypothetical protein	NA	D6PST5	Lactobacillus_phage	60.9	9.8e-25
WP_157128260.1|878275_878434_+	hypothetical protein	NA	D6PST6	Lactobacillus_phage	78.8	3.3e-17
WP_085763011.1|878543_878858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763012.1|878857_879745_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	56.6	1.7e-94
WP_085763013.1|879747_880701_+	recombinase RecT	NA	D2IYT9	Enterococcus_phage	56.9	4.9e-79
WP_085763014.1|880729_881671_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	35.2	3.8e-15
WP_085763015.1|881667_882369_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	46.6	4.1e-51
WP_085763016.1|882361_882781_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	59.0	9.4e-43
WP_085763017.1|882768_883032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763018.1|883201_884005_+	DNA adenine methylase	NA	Q24LC8	Clostridium_phage	43.3	3.2e-63
WP_085763019.1|884107_884305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525425.1|884297_884573_+	DUF3850 domain-containing protein	NA	U5U430	Lactobacillus_phage	61.8	2.3e-18
WP_069359856.1|884606_884909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763020.1|884938_885259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763021.1|885263_885461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763022.1|885539_886013_+	hypothetical protein	NA	U5U7A6	Lactobacillus_phage	35.9	3.9e-13
WP_084994700.1|886877_887954_+	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	34.5	1.6e-06
WP_157128261.1|888012_888189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035464847.1|888226_888442_-	CsbD family protein	NA	NA	NA	NA	NA
WP_085763023.1|888639_888873_+	hypothetical protein	NA	D6PSW7	Lactobacillus_phage	87.0	1.1e-32
WP_085763024.1|888931_889684_+	TerS	NA	D6PSW8	Lactobacillus_phage	90.3	5.1e-108
WP_085763025.1|889661_891005_+|terminase	PBSX family phage terminase large subunit	terminase	D6PSX1	Lactobacillus_phage	99.6	7.9e-168
WP_085763026.1|891021_892383_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	97.8	4.9e-258
WP_085763027.1|892385_893213_+|capsid	minor capsid protein	capsid	D6PSX3	Lactobacillus_phage	96.7	9.0e-130
WP_191981937.1|893235_893505_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSX4	Lactobacillus_phage	86.5	8.7e-18
WP_085763029.1|893516_894620_+	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	89.6	1.6e-158
WP_042254689.1|894634_895099_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	98.7	6.4e-77
WP_085763030.1|895113_895992_+	encapsulin	NA	D6PSX7	Lactobacillus_phage	98.6	6.8e-160
WP_085763031.1|896002_896365_+	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	99.2	8.1e-59
WP_085763032.1|896376_896703_+	DUF4054 domain-containing protein	NA	D6PSX9	Lactobacillus_phage	95.4	3.9e-52
WP_085763033.1|896699_897302_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	87.9	1.5e-97
WP_085763034.1|897301_897676_+	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	94.4	5.9e-65
WP_085763035.1|897668_898139_+	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	94.9	4.2e-60
WP_085763036.1|898151_899189_+	DUF3383 family protein	NA	D6PSY3	Lactobacillus_phage	95.1	1.7e-141
WP_085763037.1|899203_899602_+	hypothetical protein	NA	D6PSY4	Lactobacillus_phage	99.2	3.1e-72
WP_085763038.1|899672_900047_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	91.1	2.8e-62
WP_157128262.1|900057_900228_+	hypothetical protein	NA	D6PSY6	Lactobacillus_phage	94.4	9.7e-23
WP_085763039.1|900242_905966_+|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	85.2	1.1e-138
WP_085763040.1|905965_906613_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.1	3.4e-108
WP_191981938.1|906624_907017_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	100.0	7.1e-69
WP_085763042.1|907006_908248_+	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	90.8	1.4e-206
WP_085763043.1|908247_908592_+	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	97.4	2.5e-57
WP_085763044.1|908591_908990_+	hypothetical protein	NA	D6PSZ8	Lactobacillus_phage	80.2	5.8e-50
WP_085763045.1|908976_909744_+|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	81.0	1.4e-89
WP_157128263.1|909644_910154_+	hypothetical protein	NA	D6PSZ9	Lactobacillus_phage	79.9	1.1e-72
WP_085763047.1|910143_910803_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	82.4	2.8e-73
WP_085763048.1|910805_912701_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	58.6	3.6e-41
WP_085763049.1|912712_913141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157128264.1|913152_913320_+	XkdX family protein	NA	NA	NA	NA	NA
WP_085763730.1|913423_913777_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	67.3	6.5e-37
WP_085763050.1|913766_914150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763051.1|914161_914680_+	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	93.0	8.2e-81
WP_157128265.1|915809_916607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763053.1|916614_917748_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	26.4	3.5e-23
WP_085763054.1|918154_918361_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_042521251.1|918533_918911_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085762957.1|919328_920504_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_085763055.1|920898_922080_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_191981936.1|922555_923755_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	64.1	1.3e-142
WP_085763003.1|924186_925068_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	36.6	4.1e-16
WP_085763004.1|925186_925570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763005.1|925623_925947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275714.1|926057_926228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052415627.1|926239_926875_-	DUF4145 domain-containing protein	NA	A0A1X9I6S1	Streptococcus_phage	33.2	8.7e-24
WP_085763729.1|926885_927272_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	94.5	1.3e-67
WP_085763006.1|927300_927681_-	helix-turn-helix domain-containing protein	NA	D6PSS9	Lactobacillus_phage	53.1	1.3e-22
WP_047021620.1|927821_928049_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085763007.1|928318_928504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763008.1|928492_928741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157128259.1|928897_929062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763009.1|929122_929632_+	helix-turn-helix domain-containing protein	NA	D6PST4	Lactobacillus_phage	53.8	1.3e-41
WP_085763010.1|929636_929912_+	hypothetical protein	NA	D6PST5	Lactobacillus_phage	60.9	9.8e-25
WP_157128260.1|929917_930076_+	hypothetical protein	NA	D6PST6	Lactobacillus_phage	78.8	3.3e-17
WP_085763011.1|930185_930500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763012.1|930499_931387_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	56.6	1.7e-94
WP_085763056.1|932393_933311_+	DUF4373 domain-containing protein	NA	D6PSU3	Lactobacillus_phage	73.7	2.2e-12
WP_085763015.1|933307_934009_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	46.6	4.1e-51
WP_085763016.1|934001_934421_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	59.0	9.4e-43
WP_085763057.1|934408_934645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763019.1|935745_935943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525425.1|935935_936211_+	DUF3850 domain-containing protein	NA	U5U430	Lactobacillus_phage	61.8	2.3e-18
WP_085763058.1|936244_936487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763059.1|936575_936836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763022.1|937172_937646_+	hypothetical protein	NA	U5U7A6	Lactobacillus_phage	35.9	3.9e-13
WP_085763061.1|938617_939526_+	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	36.0	4.4e-05
WP_157128261.1|939639_939816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035464847.1|939853_940069_-	CsbD family protein	NA	NA	NA	NA	NA
WP_085763024.1|940555_941308_+	TerS	NA	D6PSW8	Lactobacillus_phage	90.3	5.1e-108
WP_085763062.1|943268_943589_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	81.5	2.2e-31
WP_085763063.1|944644_944935_+	hypothetical protein	NA	D6PSX3	Lactobacillus_phage	100.0	1.5e-10
WP_085763064.1|945217_945550_+	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	91.9	4.3e-43
WP_085763065.1|945638_946010_+	hypothetical protein	NA	D6PSX5	Lactobacillus_phage	80.9	4.9e-27
WP_085763066.1|946244_946694_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	89.5	9.1e-28
WP_085763067.1|946866_947457_+	encapsulin	NA	D6PSX7	Lactobacillus_phage	93.3	3.7e-85
WP_191981939.1|947732_947927_+	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	98.1	1.0e-20
WP_085763069.1|947919_948105_+	hypothetical protein	NA	D6PSX9	Lactobacillus_phage	97.7	1.9e-16
WP_191981940.1|948070_948244_+	hypothetical protein	NA	D6PSX9	Lactobacillus_phage	94.6	1.3e-22
WP_157128354.1|948521_948764_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	75.4	6.9e-22
WP_085763070.1|948836_949103_+	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	98.8	3.8e-42
WP_085763035.1|949201_949672_+	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	94.9	4.2e-60
WP_085763071.1|949684_950197_+	hypothetical protein	NA	D6PSY3	Lactobacillus_phage	91.5	1.6e-65
WP_085763072.1|950297_950720_+	DUF3383 family protein	NA	D6PSY3	Lactobacillus_phage	96.7	1.1e-27
WP_085763037.1|950734_951133_+	hypothetical protein	NA	D6PSY4	Lactobacillus_phage	99.2	3.1e-72
WP_085763073.1|951203_951383_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	98.0	5.2e-19
WP_157128355.1|951587_951803_+	hypothetical protein	NA	D6PSY6	Lactobacillus_phage	94.1	8.8e-21
WP_085763039.1|951771_957495_+|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	85.2	1.1e-138
WP_085763040.1|957494_958142_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.1	3.4e-108
WP_191981938.1|958153_958546_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	100.0	7.1e-69
WP_085763042.1|958535_959777_+	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	90.8	1.4e-206
WP_085763043.1|959776_960121_+	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	97.4	2.5e-57
WP_085763044.1|960120_960519_+	hypothetical protein	NA	D6PSZ8	Lactobacillus_phage	80.2	5.8e-50
WP_085763075.1|960505_961684_+|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	81.1	2.7e-180
WP_085763047.1|961673_962333_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	82.4	2.8e-73
WP_085763048.1|962335_964231_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	58.6	3.6e-41
WP_085763049.1|964242_964671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157128264.1|964682_964850_+	XkdX family protein	NA	NA	NA	NA	NA
WP_085763730.1|964953_965307_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	67.3	6.5e-37
WP_085763050.1|965296_965680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763076.1|966208_967261_+	Lyzozyme M1 (1,4-beta-N-acetylmuramidase)	NA	D6PSS2	Lactobacillus_phage	97.2	2.5e-177
WP_157128265.1|967339_968137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085763053.1|968144_969278_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	26.4	3.5e-23
WP_085763054.1|969684_969891_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_042521251.1|970063_970441_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085762957.1|970858_972034_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_085763055.1|972429_973611_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_043023458.1|974388_974856_-	universal stress protein	NA	NA	NA	NA	NA
WP_085763077.1|975109_975679_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_024526645.1|976066_976390_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	9.2e-06
WP_043023199.1|976600_977170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043023198.1|977216_977558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763078.1|977662_978370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473935.1|978613_979801_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.4	9.5e-149
WP_021742220.1|980006_981482_+	MFS transporter	NA	NA	NA	NA	NA
WP_011668242.1|981555_981882_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_011668241.1|981929_982577_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.9	9.1e-45
WP_043023195.1|982730_983501_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_085763079.1|983554_984226_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_043023193.1|984238_986953_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_021742214.1|987172_988135_-	NAD(P)-binding domain-containing protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.7	5.3e-25
WP_085763080.1|988284_988533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043023191.1|988841_989522_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011668234.1|989573_990050_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043023189.1|990605_991124_+	VanZ family protein	NA	NA	NA	NA	NA
WP_085763081.1|991114_991438_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085763082.1|991793_994304_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.6	4.5e-140
991467:991487	attR	TGGCGGAACTGGCAGACGCGC	NA	NA	NA	NA
WP_085762961.1|994846_995836_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.2	2.2e-58
>prophage 2
NZ_CP019750	Lactobacillus brevis strain TMW 1.2113 chromosome, complete genome	2537412	1275918	1285172	2537412	tRNA	Staphylococcus_phage(42.86%)	9	NA	NA
WP_011667553.1|1275918_1276194_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
WP_085763171.1|1276299_1277559_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_179205386.1|1277677_1278574_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.5	9.6e-53
WP_085763173.1|1278749_1279943_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.3	2.7e-34
WP_043022299.1|1279971_1281864_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.3	4.7e-49
WP_021741846.1|1281875_1282826_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_085763174.1|1282842_1283334_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.2	7.4e-23
WP_011667560.1|1283511_1284153_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_085763175.1|1284320_1285172_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	5.8e-15
>prophage 3
NZ_CP019750	Lactobacillus brevis strain TMW 1.2113 chromosome, complete genome	2537412	1742936	1749164	2537412	integrase	Staphylococcus_phage(16.67%)	9	1733593:1733611	1757345:1757363
1733593:1733611	attL	CAAAGAAGACTTGCGGACC	NA	NA	NA	NA
WP_085763353.1|1742936_1744337_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	37.1	5.3e-74
WP_085763354.1|1744349_1745120_-	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	31.7	2.1e-16
WP_085763355.1|1745132_1745357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763356.1|1745356_1745587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763357.1|1745898_1746183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085763358.1|1746199_1746880_-	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	36.0	4.5e-26
WP_085763359.1|1746881_1747097_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	43.5	3.6e-06
WP_085763360.1|1747225_1747864_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	48.8	1.3e-11
WP_085763361.1|1748009_1749164_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.0	3.3e-53
1757345:1757363	attR	CAAAGAAGACTTGCGGACC	NA	NA	NA	NA
>prophage 1
NZ_CP019751	Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-1, complete sequence	41093	0	8948	41093	transposase	unidentified_phage(40.0%)	7	NA	NA
WP_041816175.1|315_645_+	DUF5388 domain-containing protein	NA	NA	NA	NA	NA
WP_085763760.1|894_1377_-	RepB family protein	NA	NA	NA	NA	NA
WP_085763761.1|1559_2483_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.4	1.1e-30
WP_033615067.1|2811_3366_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	6.8e-33
WP_085763762.1|3741_5778_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.2	1.0e-62
WP_085763763.1|5943_6645_-	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	29.1	4.8e-07
WP_085763764.1|8018_8948_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	4.8e-23
>prophage 2
NZ_CP019751	Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-1, complete sequence	41093	18616	20752	41093		Streptococcus_phage(100.0%)	1	NA	NA
WP_085763773.1|18616_20752_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.0	5.6e-107
>prophage 1
NZ_CP019752	Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-2, complete sequence	34270	0	28230	34270	holin,transposase	unidentified_phage(30.0%)	24	NA	NA
WP_020923847.1|1588_1867_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_048001079.1|2879_4049_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_100223170.1|5187_5975_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003581702.1|6049_7321_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003581705.1|7317_8076_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_016511778.1|8072_8537_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_016511777.1|8882_9380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511776.1|9865_11800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003581715.1|11809_12757_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	37.5	2.4e-46
WP_016511775.1|12738_13410_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003581721.1|13399_14050_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_048001087.1|14266_15625_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.2e-17
WP_085763788.1|15634_16330_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	6.3e-36
WP_024526065.1|16497_17421_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_085763789.1|18285_20124_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	6.8e-69
WP_016511950.1|20167_20380_+	tyrosine recombinase	NA	A0A1S5SEW4	Streptococcus_phage	45.6	5.4e-07
WP_085763790.1|20397_21327_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.1	2.0e-24
WP_076619057.1|21899_22061_+	LtrC-like protein	NA	NA	NA	NA	NA
WP_016511417.1|22199_22304_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_024855730.1|22646_23423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060416966.1|23530_24115_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.2	7.7e-19
WP_024526065.1|24305_25229_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_002825823.1|25532_26738_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024855732.1|26853_28230_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.5	1.3e-11
>prophage 2
NZ_CP019752	Lactobacillus brevis strain TMW 1.2113 plasmid pl12113-2, complete sequence	34270	32550	33480	34270	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_015474656.1|32550_33480_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.8	5.2e-25
