The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017363	Lactiplantibacillus plantarum strain TMW 1.277 chromosome, complete genome	3099387	318987	373929	3099387	protease,bacteriocin	Bacillus_virus(50.0%)	55	NA	NA
WP_003643762.1|318987_319551_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003641929.1|319744_320413_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_085764293.1|320570_322076_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|322340_322709_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|322821_323331_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643764.1|323361_324558_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|324667_325138_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|325156_325612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|325715_326288_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_085764294.1|326453_327374_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_047672629.1|327510_328422_+	oxidoreductase	NA	NA	NA	NA	NA
WP_085764295.1|329311_329758_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|329995_331522_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|331522_332494_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_024971425.1|332571_333903_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|334368_335886_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003641944.1|335900_337730_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|337744_338467_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_085764296.1|339053_342737_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_085764297.1|342738_344430_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_063484811.1|344426_345344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|345387_345651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072540096.1|345762_346041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339238.1|346179_346425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151502030.1|346466_346691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339239.1|346819_347212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339240.1|348839_349103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|349219_349423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646452.1|349547_349787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|349804_350191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157113079.1|351033_351180_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_047672648.1|351256_351664_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_076655685.1|353249_353666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764299.1|353728_353992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057136835.1|354383_354629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|355203_355623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608295.1|355914_356379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764300.1|356657_357275_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_085764301.1|357278_358433_-	MFS transporter	NA	NA	NA	NA	NA
WP_053566434.1|358436_359228_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_085764302.1|359298_360171_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085764303.1|360330_361146_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_027821507.1|361671_363048_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|363092_364277_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_072533003.1|364617_364818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157113081.1|365007_365181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072533006.1|365774_366443_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_063487606.1|367634_367835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641975.1|367962_368130_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063487605.1|369476_370223_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643807.1|370354_370504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643808.1|370517_371858_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_085764305.1|371858_372602_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085764306.1|372895_373669_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|373770_373929_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP017363	Lactiplantibacillus plantarum strain TMW 1.277 chromosome, complete genome	3099387	1227783	1239749	3099387		Lactobacillus_phage(87.5%)	9	NA	NA
WP_003643099.1|1227783_1228731_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1229074_1229689_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_063720948.1|1229691_1232130_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_003643095.1|1232217_1232778_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_003643094.1|1232848_1233289_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_052098033.1|1233633_1234101_+	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	99.4	6.1e-83
WP_053566592.1|1234075_1235050_+	hypothetical protein	NA	A0A2P0ZL95	Lactobacillus_phage	90.7	5.0e-31
WP_161017206.1|1235180_1235363_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003640226.1|1237475_1239749_-	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	23.5	1.3e-37
>prophage 3
NZ_CP017363	Lactiplantibacillus plantarum strain TMW 1.277 chromosome, complete genome	3099387	1689791	1752073	3099387	protease,integrase,tRNA,transposase	Lactobacillus_phage(17.65%)	59	1732281:1732298	1758896:1758913
WP_085764514.1|1689791_1691501_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	1.3e-93
WP_003640703.1|1691668_1693504_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.5e-23
WP_085764515.1|1693667_1694945_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003640705.1|1694941_1695184_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003640706.1|1695207_1696422_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	1.9e-27
WP_085764516.1|1696418_1697945_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.6	7.6e-42
WP_003640708.1|1697987_1698137_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003640709.1|1698168_1699362_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003640710.1|1699777_1700920_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
WP_003640711.1|1701021_1702890_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	7.7e-137
WP_003645970.1|1702933_1703533_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003640713.1|1703553_1704597_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003640714.1|1704987_1705698_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003640715.1|1705698_1706700_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003640716.1|1706712_1707636_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_085764517.1|1708120_1708642_-	shikimate kinase	NA	NA	NA	NA	NA
WP_085764518.1|1708644_1709742_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003640719.1|1709744_1711043_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_024971663.1|1711056_1711584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640721.1|1711592_1712762_-	chorismate synthase	NA	NA	NA	NA	NA
WP_003640722.1|1712754_1714209_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1714856_1715210_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_046947639.1|1715232_1717797_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1717811_1718117_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1718106_1718406_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1718450_1719668_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1719688_1720165_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1720460_1724774_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|1725267_1726977_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|1727016_1728294_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1728331_1729117_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1729132_1729912_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1730031_1730595_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1730596_1731319_-	UMP kinase	NA	NA	NA	NA	NA
WP_003640738.1|1731518_1732397_-	elongation factor Ts	NA	NA	NA	NA	NA
1732281:1732298	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_085764519.1|1732499_1733303_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1733527_1734250_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1734538_1735537_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640742.1|1735621_1735927_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015825656.1|1735910_1736669_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1736780_1737416_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1737473_1737710_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1737807_1738047_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1738198_1738831_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089197934.1|1738920_1739151_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640748.1|1739454_1740084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640749.1|1740133_1741303_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|1741338_1741731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640751.1|1741894_1742287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640752.1|1742732_1743674_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003640754.1|1744432_1744684_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_003640755.1|1744905_1745289_+	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	27.4	4.7e-09
WP_085764520.1|1745433_1747560_+	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	25.7	2.2e-15
WP_158070696.1|1747624_1748179_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_079994877.1|1748573_1748831_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.7	7.6e-11
WP_015825666.1|1748962_1749379_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	35.0	9.1e-06
WP_033607682.1|1749438_1749906_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077726998.1|1750153_1750543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085764521.1|1750909_1752073_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	38.4	1.1e-61
1758896:1758913	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP017363	Lactiplantibacillus plantarum strain TMW 1.277 chromosome, complete genome	3099387	2052298	2112865	3099387	protease,tail,terminase,head,transposase,integrase,capsid,portal	Lactobacillus_phage(34.88%)	74	2096437:2096458	2110208:2110229
WP_024002521.1|2052298_2052682_-	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	62.5	7.6e-15
WP_003641414.1|2052668_2052965_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	4.9e-38
WP_187337988.1|2052965_2054081_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	77.4	2.3e-32
WP_003642832.1|2054259_2054694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642831.1|2054696_2055146_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
WP_085764563.1|2055152_2060381_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	1.8e-143
WP_033608823.1|2060395_2060758_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	71.2	3.3e-44
WP_085764564.1|2060771_2066603_-|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.0	1.0e-219
WP_031275283.1|2066618_2066882_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_033608825.1|2066989_2067388_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.0	6.6e-46
WP_099447638.1|2067487_2067871_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_033608826.1|2067972_2068338_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	54.2	1.8e-29
WP_060417584.1|2068337_2068889_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	6.7e-65
WP_003642822.1|2068890_2069238_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355731.1|2069237_2069570_-|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2069581_2069758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2069770_2070793_-|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_013355732.1|2070812_2071160_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_013355733.1|2071174_2071852_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355734.1|2072024_2072231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2072282_2072561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355736.1|2072535_2074221_-|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_024971552.1|2074367_2074664_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_085764565.1|2074593_2076102_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.8	6.9e-136
WP_033098955.1|2076113_2077352_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
WP_085764566.1|2077341_2077869_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.1	1.7e-57
WP_085764567.1|2078102_2078318_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	61.2	1.5e-07
WP_085764568.1|2078520_2079132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764569.1|2079103_2080000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096770.1|2080872_2081334_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	6.3e-40
WP_021356389.1|2081411_2081552_-	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	96.3	3.4e-05
WP_071665406.1|2081544_2081925_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_057138635.1|2081921_2082440_-	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	2.9e-54
WP_022638119.1|2082436_2082724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598975.1|2082720_2083629_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_052748123.1|2083708_2084674_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
WP_080392647.1|2084685_2085216_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	58.6	2.3e-54
WP_060598973.1|2085720_2086233_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	3.6e-28
WP_003642793.1|2086300_2086606_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|2086617_2086788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101086.1|2086946_2087147_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2087293_2087530_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_013355753.1|2087567_2087882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060598972.1|2087938_2088166_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|2088294_2088657_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_003644968.1|2088668_2089082_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_060598971.1|2089104_2089896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642782.1|2089905_2090160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642781.1|2090239_2090608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642780.1|2091211_2091931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642779.1|2092152_2092434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642778.1|2092708_2092885_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_003642777.1|2093089_2093527_+	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	37.0	7.8e-16
WP_003642776.1|2093574_2094348_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003642775.1|2094450_2095572_+|integrase	tyrosine-type recombinase/integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	1.7e-46
WP_003642774.1|2095923_2096130_-	hypothetical protein	NA	NA	NA	NA	NA
2096437:2096458	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_063487358.1|2096549_2096855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_178138091.1|2096937_2097309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063487356.1|2097466_2097736_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_085764570.1|2099389_2100490_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.9	1.2e-49
WP_085764571.1|2100644_2102348_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	2.2e-122
WP_062690051.1|2102344_2102818_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_085764572.1|2103592_2103982_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	8.8e-19
WP_072535850.1|2103974_2104313_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	7.1e-09
WP_027823040.1|2104299_2104491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072534928.1|2104506_2104986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764573.1|2105131_2106526_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	39.4	4.3e-68
WP_072534925.1|2107323_2107542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640734.1|2107822_2108002_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_072534924.1|2108149_2108794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076633652.1|2108872_2110030_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.3	2.5e-53
WP_003642773.1|2110520_2110754_+	hypothetical protein	NA	NA	NA	NA	NA
2110208:2110229	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_003642772.1|2110778_2111051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764574.1|2111209_2112865_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	3.5e-93
>prophage 5
NZ_CP017363	Lactiplantibacillus plantarum strain TMW 1.277 chromosome, complete genome	3099387	2309734	2318245	3099387		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642593.1|2309734_2310313_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
WP_003642592.1|2310305_2311331_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642591.1|2311327_2312782_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642590.1|2312766_2314986_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	7.7e-144
WP_003644726.1|2314978_2315659_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2315658_2315913_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2315914_2316646_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003644727.1|2316648_2317779_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2317762_2318245_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP017365	Lactiplantibacillus plantarum strain TMW 1.277 plasmid pL1277-2, complete sequence	64302	2087	61892	64302	transposase,protease	unidentified_phage(18.75%)	54	NA	NA
WP_012695406.1|2087_3017_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	1.8e-25
WP_157113110.1|3129_3913_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_139592727.1|3892_4186_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_012695400.1|4455_5073_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.5	1.1e-18
WP_012695399.1|5388_6372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695398.1|7551_7986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157113775.1|8039_8501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695397.1|8543_9245_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012695396.1|9483_10167_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.6	7.3e-61
WP_042751027.1|10462_11389_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	27.9	6.3e-23
WP_012695393.1|11853_14205_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_012695392.1|14253_15147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176552752.1|15172_15991_-	class A sortase	NA	NA	NA	NA	NA
WP_042751037.1|16012_16462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764786.1|16481_16802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764787.1|16804_18922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695389.1|19046_19370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764788.1|19435_21229_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	35.9	2.9e-93
WP_012695387.1|21249_22032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764789.1|22033_24151_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	25.8	4.6e-29
WP_012695432.1|24261_25497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695431.1|25652_26051_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	47.0	4.6e-23
WP_012695430.1|26080_26263_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	58.3	3.2e-16
WP_012695429.1|26312_26708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764790.1|26831_27026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695428.1|27018_28320_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.1	4.6e-80
WP_187337992.1|28477_30184_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_042751048.1|30167_30392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695426.1|30446_32432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039107365.1|32421_32907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039107367.1|32926_33382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695425.1|33392_33689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695424.1|33913_34837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042751051.1|34829_35258_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_042751053.1|35257_35452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042751055.1|35448_35736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695422.1|35925_36918_-	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	46.9	6.9e-36
WP_042751061.1|40017_40878_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	35.1	2.7e-36
WP_012695419.1|40874_41273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695418.1|41472_42498_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.7e-41
WP_012695417.1|42578_43199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764792.1|43200_43782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695416.1|43791_45081_-	CHAP domain-containing protein	NA	A0A076G7X7	Bacillus_phage	34.3	1.8e-12
WP_085764793.1|45095_47048_-	ATPase	NA	NA	NA	NA	NA
WP_012695414.1|47060_47711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695413.1|47703_48051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764794.1|48176_50654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764795.1|50723_52211_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_085764796.1|52282_53437_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012695409.1|55482_57639_-	peptide cleavage/export ABC transporter	NA	F2Y302	Organic_Lake_phycodnavirus	33.5	5.6e-22
WP_012695408.1|57705_58338_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	46.7	3.6e-06
WP_012695407.1|59891_60035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157113112.1|60234_60393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695406.1|60962_61892_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	1.8e-25
>prophage 1
NZ_CP017367	Lactiplantibacillus plantarum strain TMW 1.277 plasmid pL1277-4, complete sequence	31304	0	19001	31304	transposase,integrase,bacteriocin	Staphylococcus_phage(33.33%)	21	196:211	17972:17987
WP_085764822.1|133_523_+	hypothetical protein	NA	NA	NA	NA	NA
196:211	attL	CAAAGAAATTGACATC	NA	NA	NA	NA
WP_085764823.1|548_932_+	YxeA family protein	NA	NA	NA	NA	NA
WP_085764824.1|1064_2423_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_085764825.1|2419_2863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764826.1|2905_3214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764827.1|3210_3504_-	DUF2089 family protein	NA	NA	NA	NA	NA
WP_157113116.1|3649_3802_+|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_033609921.1|4151_4334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764828.1|5019_5508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527164.1|5998_6997_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.9	2.9e-50
WP_085764829.1|7270_8542_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001748110.1|8791_9136_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003643337.1|9129_9393_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646144.1|9478_10066_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.7	1.3e-21
WP_085764831.1|12483_13659_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
WP_003646095.1|14134_14653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646093.1|14796_15174_-	YxeA family protein	NA	NA	NA	NA	NA
WP_157113118.1|15840_16506_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.1	9.8e-119
WP_002816285.1|16559_16811_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_085764833.1|17137_18334_-	ABC transporter permease	NA	NA	NA	NA	NA
17972:17987	attR	GATGTCAATTTCTTTG	NA	NA	NA	NA
WP_085764834.1|18323_19001_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	2.9e-33
>prophage 2
NZ_CP017367	Lactiplantibacillus plantarum strain TMW 1.277 plasmid pL1277-4, complete sequence	31304	22837	23425	31304	integrase	Bacillus_phage(100.0%)	1	21691:21704	29427:29440
21691:21704	attL	ATTTTTAAGAATAG	NA	NA	NA	NA
WP_003646103.1|22837_23425_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	32.6	3.7e-21
WP_003646103.1|22837_23425_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	32.6	3.7e-21
29427:29440	attR	CTATTCTTAAAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP017367	Lactiplantibacillus plantarum strain TMW 1.277 plasmid pL1277-4, complete sequence	31304	29621	30691	31304	transposase	Lactobacillus_phage(100.0%)	1	NA	NA
WP_157113119.1|29621_30691_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	4.1e-26
