The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	1312624	1327346	5264852	tail,integrase	Morganella_phage(50.0%)	17	1312377:1312397	1332441:1332461
1312377:1312397	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004213157.1|1312624_1313878_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|1313973_1314981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1315111_1315330_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1315329_1315764_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1315777_1316380_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1316379_1316559_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1316555_1317521_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1317517_1318021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1318017_1318227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1318223_1318850_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1318859_1319210_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1319202_1321965_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1322304_1322751_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077252710.1|1322764_1323115_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1323119_1323593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1323946_1324273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1324280_1327346_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1332441:1332461	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	1444173	1481370	5264852	lysis,terminase	Escherichia_phage(42.11%)	50	NA	NA
WP_002913370.1|1444173_1444632_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
WP_002913369.1|1444764_1445673_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_023302677.1|1445682_1446564_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004214072.1|1446932_1447415_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023301637.1|1447751_1447952_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_085787642.1|1447948_1448185_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.8	1.4e-08
WP_085787643.1|1448181_1448886_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.6	4.2e-27
WP_032427727.1|1448882_1449449_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	48.3	1.5e-40
WP_029884650.1|1449663_1450788_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	48.1	3.0e-88
WP_072004922.1|1450784_1450943_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	2.3e-10
WP_029884651.1|1450939_1451563_-	hypothetical protein	NA	S0A2A9	Cellulophaga_phage	49.0	3.5e-46
WP_161267657.1|1451559_1451868_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	33.3	2.9e-09
WP_076741996.1|1452074_1452359_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	59.6	2.0e-28
WP_032717012.1|1452447_1452642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073970525.1|1452634_1452760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267113.1|1453281_1454034_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.7	1.3e-71
WP_004177099.1|1454074_1454308_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	71.4	4.6e-23
WP_064147795.1|1454326_1454647_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	8.5e-36
WP_004151298.1|1454733_1454880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085787644.1|1454872_1455772_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.3	8.4e-81
WP_161267668.1|1455776_1457192_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	1.6e-182
WP_085787646.1|1457191_1457494_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181701.1|1458035_1458296_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|1459064_1459277_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_111474833.1|1459882_1460128_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	83.8	5.0e-36
WP_064161787.1|1460696_1461431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161788.1|1462123_1462579_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	2.3e-55
WP_085787648.1|1462578_1462749_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	9.7e-15
WP_085787649.1|1462741_1463380_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	2.4e-74
WP_032427735.1|1463376_1463517_+	YlcG family protein	NA	NA	NA	NA	NA
WP_050485953.1|1463699_1464155_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	39.4	3.6e-24
WP_085787650.1|1464669_1464984_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	85.1	2.4e-43
WP_085787651.1|1464986_1465490_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	79.6	1.5e-74
WP_077268745.1|1465486_1465951_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	56.5	7.0e-39
WP_001064347.1|1466142_1466661_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_085787652.1|1466720_1467461_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	6.1e-13
WP_064161794.1|1467464_1468796_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	2.1e-152
WP_065892269.1|1468807_1470223_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.0	2.0e-89
WP_053274344.1|1470219_1471050_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.2	6.2e-54
WP_065892271.1|1471062_1472676_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_065892275.1|1472691_1473552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042632526.1|1473565_1474597_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.1	8.7e-74
WP_017898838.1|1474668_1475151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004884210.1|1475147_1475576_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.3	3.8e-23
WP_085787653.1|1475572_1476007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161800.1|1475990_1476929_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	6.5e-52
WP_064161801.1|1476933_1478328_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.7	5.1e-69
WP_064161802.1|1478331_1478769_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.2	7.0e-25
WP_064161803.1|1478772_1479345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097403955.1|1479402_1481370_+	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	40.4	2.1e-15
>prophage 3
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	1714949	1721854	5264852	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1714949_1715813_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1715823_1716597_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1716837_1717734_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1717976_1719338_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1719656_1720379_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1720375_1721854_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 4
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	2688795	2698197	5264852		Escherichia_phage(87.5%)	9	NA	NA
WP_161267581.1|2688795_2690430_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	4.4e-181
WP_004176258.1|2690484_2691750_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2691780_2692869_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2692955_2693216_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2693513_2694374_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2694394_2695156_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_085787672.1|2695416_2696307_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	3.0e-155
WP_004183946.1|2696318_2697584_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2697576_2698197_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	2733405	2815184	5264852	protease,holin,capsid,head,integrase,portal,terminase,tail	Escherichia_phage(19.57%)	89	2751583:2751601	2802034:2802052
WP_004209779.1|2733405_2734218_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002903685.1|2734231_2734348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2734391_2734721_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2734707_2735070_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2735512_2736547_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903677.1|2736771_2738427_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2738426_2739269_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903639.1|2739286_2739586_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2739578_2740412_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004209782.1|2740411_2741212_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004209783.1|2741348_2742308_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209784.1|2742311_2742929_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004209787.1|2742928_2743831_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148289.1|2743820_2744747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022615525.1|2744904_2746560_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004209791.1|2746824_2747745_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2747908_2748265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2748420_2750037_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2750033_2750753_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004209794.1|2750733_2751684_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
2751583:2751601	attL	GAAAACGCTGGAGGCCATC	NA	NA	NA	NA
WP_004209796.1|2751751_2754529_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_002903581.1|2755246_2756683_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2756737_2758390_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023302609.1|2758552_2760169_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2761213_2761603_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004215412.1|2761595_2762360_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_020316475.1|2762349_2763702_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004214878.1|2763711_2764914_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004176317.1|2764924_2765581_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2765591_2766278_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2766447_2767254_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2767250_2767814_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2767915_2768824_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004214881.1|2768990_2770301_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2770300_2771746_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|2771865_2772984_+	transporter	NA	NA	NA	NA	NA
WP_004214887.1|2773112_2774213_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|2775413_2775713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|2775880_2776525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|2776580_2777315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615520.1|2777327_2779481_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
WP_016530179.1|2779553_2782631_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615519.1|2782627_2783008_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004864228.1|2783020_2783497_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2783483_2783957_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_016530181.1|2783977_2787367_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.6	0.0e+00
WP_016530182.1|2787427_2787661_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530183.1|2787734_2788040_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530184.1|2788042_2788447_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530185.1|2788477_2789182_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530186.1|2789238_2789586_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530187.1|2789582_2790032_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530188.1|2790028_2790367_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530189.1|2790375_2790693_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_004104235.1|2790770_2792009_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_000999827.1|2792018_2792618_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_016530190.1|2792610_2793837_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_025108055.1|2793984_2795736_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530193.1|2795739_2796237_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_016530194.1|2796394_2796745_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.8	7.8e-51
WP_016530196.1|2797378_2798005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049016906.1|2798009_2798945_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_016530199.1|2799168_2799444_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	36.0	1.7e-05
WP_016530200.1|2799451_2800081_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	1.4e-103
WP_016530201.1|2800080_2800362_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.0	1.6e-30
WP_004213330.1|2800348_2800744_-	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_032427780.1|2800836_2801409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213332.1|2801520_2802099_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	3.5e-48
2802034:2802052	attR	GATGGCCTCCAGCGTTTTC	NA	NA	NA	NA
WP_004213334.1|2802112_2803093_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	7.1e-134
WP_004184734.1|2803105_2803483_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_016530204.1|2803492_2804302_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	4.5e-110
WP_016530205.1|2804298_2805237_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.5	2.6e-101
WP_004184738.1|2805226_2805406_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_004213338.1|2805643_2806105_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|2806130_2806328_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|2806432_2807080_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_004213349.1|2807847_2808147_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_085787674.1|2808250_2808391_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	77.5	6.3e-12
WP_004213338.1|2808628_2809090_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|2809115_2809313_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|2809417_2810065_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_004213349.1|2810832_2811132_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|2811131_2811917_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|2812044_2812389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|2812381_2813044_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213359.1|2813040_2813226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2813345_2813606_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2814217_2814376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213367.1|2814668_2815184_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 6
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	3407114	3416578	5264852	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3407114_3408836_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3408862_3409582_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3409935_3410154_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3410274_3412554_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3412584_3412902_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3413227_3413449_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3413525_3415466_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3415462_3416578_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP015120	Klebsiella pneumoniae strain kp757 chromosome, complete genome	5264852	3894336	3939559	5264852	tRNA,holin,integrase,terminase	Salmonella_phage(30.77%)	68	3896205:3896221	3947409:3947425
WP_085787696.1|3894336_3896499_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	1.1e-89
3896205:3896221	attL	CCAGCGCGCTGTCGTCC	NA	NA	NA	NA
WP_072271767.1|3896566_3896752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074188355.1|3896751_3897657_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	59.4	1.3e-49
WP_040217254.1|3897656_3898433_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	57.3	4.7e-80
WP_039108741.1|3898429_3899629_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	72.9	1.1e-157
WP_004152573.1|3899628_3899982_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_085787697.1|3899983_3900637_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_085787698.1|3900678_3901095_-	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
WP_085787699.1|3901096_3901669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085787700.1|3901872_3902217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064162788.1|3902213_3903242_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.8	3.0e-98
WP_074421621.1|3903244_3903472_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	2.1e-20
WP_004225238.1|3903547_3903961_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_085787701.1|3904146_3906072_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	71.3	8.1e-182
WP_016244729.1|3906061_3906214_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_085787702.1|3906255_3906705_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	54.6	3.1e-36
WP_025269949.1|3906708_3907149_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_025269950.1|3907159_3908311_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_071057245.1|3908312_3908864_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.2e-40
WP_009652660.1|3908856_3909261_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_025269952.1|3909260_3909767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064161941.1|3909763_3910183_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.0	4.8e-39
WP_040217287.1|3910151_3910433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064161940.1|3910472_3911414_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
WP_000528476.1|3911425_3911920_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_064161939.1|3911923_3913126_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	7.0e-107
WP_064161951.1|3913177_3913726_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	2.3e-49
WP_064161938.1|3913781_3915233_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	3.2e-191
WP_021312714.1|3915470_3916871_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_074422973.1|3916821_3917310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045354782.1|3917855_3918305_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	1.2e-59
WP_025987688.1|3918291_3918597_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	97.9	8.6e-46
WP_085787703.1|3919070_3919277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085787704.1|3919278_3919650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085787743.1|3920086_3920770_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.5e-53
WP_085787705.1|3920769_3920910_-	YlcG family protein	NA	NA	NA	NA	NA
WP_017898851.1|3920906_3921131_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	63.0	2.0e-23
WP_085787706.1|3921127_3921709_-	protein NinG	NA	E7C9S3	Salmonella_phage	45.3	6.0e-40
WP_085787707.1|3921701_3921872_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
WP_085787708.1|3921852_3922320_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	5.7e-33
WP_085787709.1|3922521_3922779_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	2.4e-25
WP_085787710.1|3922824_3923055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085787711.1|3923139_3923493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023339691.1|3923901_3924090_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_032427730.1|3924613_3924802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804842.1|3924798_3925284_-	Eae protein	NA	Q858D1	Salmonella_phage	53.4	1.2e-33
WP_012542626.1|3925280_3925574_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_032427729.1|3925570_3926440_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	3.4e-95
WP_004178813.1|3927363_3927585_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001548452.1|3927664_3927856_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_032419325.1|3927960_3928671_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.6	3.7e-92
WP_032426564.1|3929073_3930147_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	86.8	3.8e-181
WP_032427826.1|3930185_3930389_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	7.0e-20
WP_004219883.1|3930698_3930824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|3930816_3931023_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_016529276.1|3931103_3931388_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_014342891.1|3931797_3932133_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_049016883.1|3932129_3932753_+	YqaJ-like viral recombinase domain protein	NA	S0A2A9	Cellulophaga_phage	48.6	3.5e-46
WP_023283323.1|3932749_3932908_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_074384827.1|3932904_3933432_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	2.4e-56
WP_074384826.1|3933645_3934323_+	hypothetical protein	NA	Q71T76	Escherichia_phage	55.8	2.0e-58
WP_074384825.1|3934319_3935024_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.6	7.1e-27
WP_074384824.1|3935020_3935239_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	49.3	1.1e-10
WP_004223135.1|3935240_3935576_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004191604.1|3935452_3936616_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
WP_004143017.1|3937047_3937914_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|3937915_3938128_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3938173_3939559_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
3947409:3947425	attR	CCAGCGCGCTGTCGTCC	NA	NA	NA	NA
