The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	0	20087	4380156	transposase	Burkholderia_virus(12.5%)	16	NA	NA
WP_087902221.1|1612_2873_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003400271.1|3376_4585_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	38.9	1.5e-64
WP_003899768.1|4604_5762_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003899769.1|5758_6322_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_003917863.1|6564_8592_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.4e-131
WP_003400286.1|8626_11143_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	1.5e-87
WP_031709324.1|11238_12153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400297.1|12879_13017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400307.1|13198_13636_-	cell wall synthesis protein CwsA	NA	NA	NA	NA	NA
WP_003400321.1|13792_14341_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.5e-24
WP_003899772.1|14457_14883_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003400344.1|15038_15320_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003901765.1|15413_16202_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_003400352.1|16238_16937_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.0e-42
WP_003902584.1|16914_18795_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	35.1	8.0e-17
WP_003906262.1|18791_20087_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	28.8	6.7e-15
>prophage 2
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	29655	30513	4380156		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003901769.1|29655_30513_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	54.3	1.4e-21
>prophage 3
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	35600	37916	4380156		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003901773.1|35600_37916_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.5	5.2e-34
>prophage 4
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	45035	47945	4380156	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902585.1|45035_47945_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.6	2.1e-210
>prophage 5
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	51492	52596	4380156		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003400492.1|51492_52596_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.4	1.4e-74
>prophage 6
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	60066	69864	4380156		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_003400534.1|60066_60561_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	73.8	1.4e-58
WP_003400540.1|60602_60857_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003400543.1|60889_61348_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003900797.1|61376_61898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400547.1|61876_64501_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	47.5	4.9e-20
WP_003400548.1|64680_65373_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003400551.1|65389_66448_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	38.5	2.1e-22
WP_003400562.1|67032_68175_+	cellulase CelA	NA	NA	NA	NA	NA
WP_003902591.1|68403_69864_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.6	1.2e-20
>prophage 7
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	79128	80406	4380156		Aeromonas_phage(100.0%)	1	NA	NA
WP_003899799.1|79128_80406_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.2	2.5e-86
>prophage 8
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	98635	100921	4380156		uncultured_virus(100.0%)	1	NA	NA
WP_003899808.1|98635_100921_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	1.9e-84
>prophage 9
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	106212	120230	4380156		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003400792.1|106212_107835_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	3.2e-14
WP_003400793.1|107839_108076_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003400794.1|108057_115596_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	2.2e-81
WP_003900808.1|115770_117756_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003400797.1|117971_120230_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	3.5e-83
>prophage 10
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	123721	128599	4380156		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003899815.1|123721_128599_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	30.1	5.4e-41
>prophage 11
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	132008	141935	4380156		Synechococcus_phage(40.0%)	9	NA	NA
WP_003900811.1|132008_134066_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.6	2.3e-41
WP_003910039.1|134347_135304_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	31.0	1.3e-36
WP_003400839.1|135377_135968_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.1	6.4e-13
WP_003400840.1|135999_136572_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003902603.1|136571_137732_+	D-alpha-D-heptose-7-phosphate kinase hddA	NA	A0A222YW25	Synechococcus_phage	37.4	2.1e-55
WP_003400850.1|138014_138203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400856.1|138325_139081_-	L,D-transpeptidase LdtMt1	NA	NA	NA	NA	NA
WP_003906284.1|139258_140203_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003400858.1|140186_141935_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.7	1.2e-27
>prophage 12
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	154798	155821	4380156		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003400908.1|154798_155821_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	70.3	1.9e-129
>prophage 13
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	159089	162911	4380156		Human_cytomegalovirus(50.0%)	3	NA	NA
WP_003400924.1|159089_159695_+	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	32.5	1.6e-19
WP_003400935.1|160863_161469_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003906289.1|161585_162911_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.2	4.6e-19
>prophage 14
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	175762	177529	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400998.1|175762_177529_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	39.0	1.0e-21
>prophage 15
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	185652	187059	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401047.1|185652_187059_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.5	2.0e-20
>prophage 16
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	190203	194879	4380156		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_003401058.1|190203_191355_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	7.8e-31
WP_003401060.1|191336_191792_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003401063.1|191845_192331_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003401065.1|192344_193037_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899837.1|193214_194879_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.7e-34
>prophage 17
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	223048	223711	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|223048_223711_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 18
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	231221	234806	4380156		Bacillus_phage(100.0%)	1	NA	NA
WP_003902618.1|231221_234806_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-44
>prophage 19
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	238862	240854	4380156	protease	Klosneuvirus(100.0%)	1	NA	NA
WP_003401172.1|238862_240854_-|protease	zinc metalloprotease	protease	A0A1V0SHG2	Klosneuvirus	38.5	3.2e-80
>prophage 20
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	258015	258987	4380156		Serratia_phage(100.0%)	1	NA	NA
WP_003401213.1|258015_258987_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A1S6UB31	Serratia_phage	28.9	7.8e-24
>prophage 21
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	264269	268370	4380156		Mycobacterium_phage(100.0%)	4	NA	NA
WP_003900831.1|264269_265178_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	31.4	1.2e-05
WP_003901829.1|265270_266599_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003401230.1|266600_267149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899863.1|267158_268370_+	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	42.4	8.7e-49
>prophage 22
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	303210	305151	4380156		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003401322.1|303210_305151_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.4	9.1e-24
>prophage 23
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	327111	330597	4380156		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003401383.1|327111_327621_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1C9M039	Mycobacterium_phage	74.4	5.9e-23
WP_003401386.1|327685_328879_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_003899884.1|328914_330597_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.6e-24
>prophage 24
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	346569	354067	4380156		Mycobacterium_phage(100.0%)	3	NA	NA
WP_003401463.1|346569_348465_+	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	40.6	3.1e-101
WP_003401472.1|348461_350078_+	type VII secretion system ESX-3 subunit EccB3	NA	V5UN45	Mycobacterium_phage	35.0	5.6e-59
WP_003401478.1|350074_354067_+	type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3	NA	V5UPA0	Mycobacterium_phage	26.3	8.0e-91
>prophage 25
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	358937	360323	4380156	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401528.1|358937_360323_+|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	39.8	6.6e-69
>prophage 26
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	389587	398460	4380156		Acanthocystis_turfacea_Chlorella_virus(20.0%)	10	NA	NA
WP_003401625.1|389587_390358_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-13
WP_003401627.1|390719_391514_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_003401632.1|391562_392231_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003401636.1|392302_392965_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	42.5	2.4e-24
WP_003898399.1|392996_393569_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	74.7	5.0e-79
WP_003898400.1|393674_395006_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	2.7e-67
WP_003401643.1|394994_395666_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_003401648.1|395766_396447_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003902651.1|396453_397143_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003401650.1|397110_398460_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.8	5.0e-13
>prophage 27
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	403072	403939	4380156		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003401670.1|403072_403939_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.6	4.3e-90
>prophage 28
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	424249	428054	4380156		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_003401814.1|424249_426127_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	2.3e-141
WP_003401817.1|426123_426831_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003401821.1|426866_428054_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.7	2.1e-15
>prophage 29
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	439714	441013	4380156		Pandoravirus(100.0%)	1	NA	NA
WP_003401829.1|439714_441013_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	34.6	6.4e-66
>prophage 30
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	456043	456523	4380156		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003401867.1|456043_456523_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.1	3.5e-17
>prophage 31
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	462084	466246	4380156		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003401894.1|462084_462624_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	44.9	4.3e-16
WP_003401897.1|462704_463559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003401905.1|463699_466246_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	1.1e-120
>prophage 32
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	481572	482802	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003898432.1|481572_482802_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.0	2.4e-17
>prophage 33
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	488222	494184	4380156		Catovirus(50.0%)	2	NA	NA
WP_003900921.1|488222_489980_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	9.8e-09
WP_016719657.1|490212_494184_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.8	4.9e-32
>prophage 34
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	499306	501559	4380156		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_003402100.1|499306_501559_-	serine/threonine protein kinase	NA	Q85650	Moloney_murine_sarcoma_virus	26.1	3.0e-10
>prophage 35
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	514945	519565	4380156		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003898445.1|514945_519565_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.5	6.7e-41
>prophage 36
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	522976	523285	4380156		Gordonia_phage(100.0%)	1	NA	NA
WP_003402188.1|522976_523285_+	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	43.5	1.6e-07
>prophage 37
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	526590	528777	4380156		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003402206.1|526590_528777_-	AAA family ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	42.6	1.4e-36
>prophage 38
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	532851	534474	4380156		uncultured_virus(100.0%)	1	NA	NA
WP_003402236.1|532851_534474_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	9.3e-155
>prophage 39
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	556857	558252	4380156		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003402301.1|556857_558252_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.1e-47
>prophage 40
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	564131	565955	4380156		Tupanvirus(100.0%)	2	NA	NA
WP_003900153.1|564131_564992_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.1	1.1e-29
WP_003402323.1|565091_565955_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.9	7.1e-29
>prophage 41
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	583592	585712	4380156		Bacillus_phage(100.0%)	2	NA	NA
WP_003402390.1|583592_584825_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-28
WP_003402393.1|585028_585712_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.0e-42
>prophage 42
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	594302	598999	4380156		Streptococcus_phage(33.33%)	6	NA	NA
WP_003900159.1|594302_595190_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.0	2.3e-22
WP_003402437.1|595330_595567_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003402602.1|595694_595796_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_003402607.1|595873_597004_+	SDR family oxidoreductase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	27.3	2.4e-08
WP_003898486.1|597010_598087_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003402621.1|598090_598999_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.8	4.9e-28
>prophage 43
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	612965	614276	4380156		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003402810.1|612965_614276_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	1.1e-12
>prophage 44
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	625126	626344	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003910801.1|625126_626344_+	AAA family ATPase	NA	V5UPR8	Mycobacterium_phage	32.6	5.7e-32
>prophage 45
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	631551	632592	4380156		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003901872.1|631551_632592_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	9.5e-20
>prophage 46
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	645399	647115	4380156		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003402917.1|645399_647115_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	5.4e-28
>prophage 47
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	663753	672698	4380156		Mycobacterium_phage(25.0%)	8	NA	NA
WP_003402992.1|663753_665172_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	24.3	3.1e-13
WP_003402995.1|665306_665573_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_003402998.1|665598_667677_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	Q8V6N4	Halorubrum_phage	33.5	2.7e-90
WP_031709257.1|667790_669122_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003898507.1|669345_669687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403006.1|669737_669905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403007.1|670154_671546_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.5	2.1e-67
WP_003403008.1|671555_672698_-	CapA family protein	NA	S4VS02	Pandoravirus	50.8	2.1e-92
>prophage 48
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	703336	706313	4380156	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_003403148.1|703336_704098_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	1.7e-34
WP_003403164.1|704154_704466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900184.1|704537_705488_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_003403171.1|705728_706313_+|transposase	IS607-like element IS1536 family transposase	transposase	F9VHY9	Thermus_phage	32.4	7.7e-19
>prophage 49
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	724303	729312	4380156		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003901883.1|724303_726031_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	3.8e-21
WP_003905355.1|726027_729312_-	RecBCD enzyme subunit RecB	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.9	1.4e-08
>prophage 50
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	740596	746916	4380156		Tupanvirus(60.0%)	6	NA	NA
WP_003900195.1|740596_741502_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.0	7.7e-26
WP_003403302.1|741566_742448_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.7	3.3e-29
WP_003905358.1|742595_743459_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.4	2.2e-30
WP_003403310.1|743625_744486_-	mycolic acid methyltransferase MmaA1	NA	A0A2K9L4K8	Tupanvirus	29.1	7.4e-26
WP_003403314.1|744532_745438_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003403317.1|745449_746916_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	32.1	4.8e-33
>prophage 51
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	756348	757428	4380156		Planktothrix_phage(100.0%)	1	NA	NA
WP_003403363.1|756348_757428_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-22
>prophage 52
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	764638	775382	4380156		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_003910996.1|764638_768157_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	21.8	3.9e-33
WP_031709258.1|768201_772152_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	5.5e-52
WP_003900994.1|772148_772523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900995.1|772515_774429_-	neutral ceramidase	NA	NA	NA	NA	NA
WP_003403419.1|774623_775382_+	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	7.9e-16
>prophage 53
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	787318	790845	4380156		Streptococcus_phage(50.0%)	2	NA	NA
WP_003898554.1|787318_789424_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.6	1.0e-60
WP_003403463.1|789654_790845_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.6	3.1e-30
>prophage 54
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	801766	803206	4380156		Catovirus(100.0%)	1	NA	NA
WP_003901900.1|801766_803206_+	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	25.6	5.6e-10
>prophage 55
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	813579	814479	4380156		Microcystis_virus(100.0%)	1	NA	NA
WP_003403610.1|813579_814479_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	29.0	5.0e-17
>prophage 56
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	825330	826311	4380156		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003403698.1|825330_826311_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.0	9.6e-22
>prophage 57
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	830956	831502	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003403726.1|830956_831502_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	35.1	1.3e-15
>prophage 58
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	856314	862743	4380156		Bacillus_phage(50.0%)	8	NA	NA
WP_003403867.1|856314_857058_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.9e-34
WP_003898576.1|857102_858560_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	5.4e-21
WP_003403876.1|858531_858933_-	HIT family protein	NA	NA	NA	NA	NA
WP_003403880.1|858972_859392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403885.1|859404_860532_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.8e-27
WP_003403887.1|860630_861176_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003403890.1|861178_861385_-	ferredoxin	NA	NA	NA	NA	NA
WP_003898577.1|861387_862743_-	cytochrome P450	NA	M1PWN0	Moumouvirus	23.1	2.4e-07
>prophage 59
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	878048	878942	4380156		Mollivirus(100.0%)	1	NA	NA
WP_003403962.1|878048_878942_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	3.2e-40
>prophage 60
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	893751	895012	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|893751_895012_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 61
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	900526	902791	4380156		Microbacterium_phage(100.0%)	1	NA	NA
WP_003404114.1|900526_902791_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
>prophage 62
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	906817	909526	4380156		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003901017.1|906817_908401_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|908431_909526_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
>prophage 63
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	915678	918209	4380156		Bacillus_phage(50.0%)	3	NA	NA
WP_003898599.1|915678_916446_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|916442_917390_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|917432_918209_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
>prophage 64
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	953796	955479	4380156		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003900222.1|953796_955479_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	21.2	2.7e-08
>prophage 65
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	962883	964512	4380156		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_003404428.1|962883_964512_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	1.0e-15
>prophage 66
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	968672	972666	4380156		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_003900223.1|968672_969896_-	resuscitation-promoting factor RpfA	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-98
WP_003404559.1|970343_970622_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003404564.1|970625_971708_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003404566.1|971704_972094_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003404570.1|972258_972666_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	1.1e-08
>prophage 67
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	996972	997830	4380156		Pandoravirus(100.0%)	1	NA	NA
WP_031651833.1|996972_997830_-	adenylate/guanylate cyclase domain-containing protein	NA	S4VR00	Pandoravirus	32.6	2.1e-09
>prophage 68
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1016106	1018500	4380156		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003898639.1|1016106_1018500_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.5	7.0e-26
>prophage 69
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1026462	1033713	4380156	transposase	Vibrio_phage(25.0%)	7	NA	NA
WP_003404749.1|1026462_1028244_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	3.8e-24
WP_003404750.1|1028240_1028498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404754.1|1028586_1029063_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003404756.1|1029059_1029560_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404757.1|1029872_1031192_-|transposase	IS256-like element IS1554 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.6	2.9e-29
WP_003404760.1|1031479_1032061_+|transposase	IS607-like element IS1535 family transposase	transposase	F9VHY9	Thermus_phage	33.5	1.4e-23
WP_003905412.1|1032060_1033713_+|transposase	transposase	transposase	M4I0H6	Staphylococcus_phage	23.6	6.0e-08
>prophage 70
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1042292	1052788	4380156		Tupanvirus(20.0%)	8	NA	NA
WP_003404782.1|1042292_1044287_-	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	27.5	1.5e-13
WP_003898652.1|1044308_1045421_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003898653.1|1045636_1046467_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.9	4.5e-12
WP_003900236.1|1046487_1047612_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	27.0	1.2e-20
WP_003404792.1|1047671_1048688_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003404794.1|1048689_1049595_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003404795.1|1049571_1050393_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	51.5	6.1e-70
WP_003898655.1|1050508_1052788_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.8	5.7e-41
>prophage 71
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1061672	1068424	4380156		Bacillus_phage(50.0%)	7	NA	NA
WP_003404833.1|1061672_1061903_-	mycolyltransferase	NA	A0A2I6B0H1	Macacine_betaherpesvirus	60.4	1.0e-06
WP_003404835.1|1061819_1062014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404838.1|1062018_1062336_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003404859.1|1062632_1064948_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.1	2.4e-119
WP_003404862.1|1065028_1066027_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	41.5	8.3e-13
WP_003898659.1|1066336_1067500_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_003900240.1|1067512_1068424_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	29.9	2.0e-13
>prophage 72
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1071933	1074149	4380156		Synechococcus_phage(50.0%)	2	NA	NA
WP_003898661.1|1071933_1072581_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.5	9.5e-18
WP_003404890.1|1072577_1074149_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	41.0	1.5e-53
>prophage 73
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1083115	1085428	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003404941.1|1083115_1085428_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.7e-91
>prophage 74
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1101206	1101893	4380156		Bacillus_phage(100.0%)	1	NA	NA
WP_003916757.1|1101206_1101893_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	8.2e-36
>prophage 75
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1106187	1106934	4380156		Planktothrix_phage(100.0%)	1	NA	NA
WP_003900248.1|1106187_1106934_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-34
>prophage 76
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1113656	1114577	4380156		Bacillus_phage(100.0%)	1	NA	NA
WP_003405145.1|1113656_1114577_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	4.2e-43
>prophage 77
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1120915	1121533	4380156		Pacmanvirus(100.0%)	1	NA	NA
WP_003898684.1|1120915_1121533_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	3.4e-09
>prophage 78
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1126606	1133564	4380156	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_072433503.1|1126606_1128043_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	6.5e-35
WP_003405180.1|1128098_1129802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405183.1|1129828_1131388_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
WP_003405185.1|1131473_1132268_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003405187.1|1132475_1133564_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
>prophage 79
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1139885	1140866	4380156		Hokovirus(100.0%)	1	NA	NA
WP_003405263.1|1139885_1140866_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
>prophage 80
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1148948	1153492	4380156		Streptococcus_phage(50.0%)	5	NA	NA
WP_003901975.1|1148948_1150238_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.6	1.6e-133
WP_003405293.1|1150242_1150929_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003905434.1|1150945_1151413_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_003405299.1|1151403_1152363_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003905437.1|1152811_1153492_-	response regulator	NA	W8CYM9	Bacillus_phage	30.2	2.1e-23
>prophage 81
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1158108	1163121	4380156		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003405320.1|1158108_1160238_+	potassium-transporting ATPase subunit KdpB	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
WP_003405322.1|1160237_1160807_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003405324.1|1160810_1162340_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003405328.1|1162347_1163121_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
>prophage 82
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1173808	1175056	4380156	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1173808_1175056_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 83
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1181313	1181759	4380156	integrase	Mycobacterium_phage(50.0%)	2	1179604:1179619	1187519:1187534
1179604:1179619	attL	GTGTCCTCGACCAGCG	NA	NA	NA	NA
WP_003905442.1|1181313_1181628_+	hypothetical protein	NA	Q854H9	Mycobacterium_phage	53.6	1.0e-09
WP_072139304.1|1181564_1181759_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1187519:1187534	attR	CGCTGGTCGAGGACAC	NA	NA	NA	NA
>prophage 84
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1185069	1186701	4380156		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003405625.1|1185069_1186701_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.6	8.8e-28
>prophage 85
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1205688	1209205	4380156		Streptococcus_phage(50.0%)	3	NA	NA
WP_003405730.1|1205688_1207083_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.6e-57
WP_003901991.1|1207284_1208007_+	RDD family protein	NA	NA	NA	NA	NA
WP_003405736.1|1208038_1209205_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	34.9	2.5e-24
>prophage 86
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1214566	1215355	4380156		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003903314.1|1214566_1215355_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.0	1.2e-14
>prophage 87
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1224540	1228265	4380156		Aeromonas_phage(50.0%)	3	NA	NA
WP_003405797.1|1224540_1225821_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-86
WP_003405801.1|1225925_1226753_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003405802.1|1226963_1228265_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.2	1.0e-23
>prophage 88
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1236805	1239422	4380156		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_003405840.1|1236805_1237918_-	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	1.9e-29
WP_003405844.1|1237927_1238185_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003405846.1|1238174_1239422_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.3	7.5e-72
>prophage 89
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1244148	1250113	4380156		Mycobacterium_phage(33.33%)	7	NA	NA
WP_003898733.1|1244148_1244847_+	hypothetical protein	NA	A0A0K2FNG4	Mycobacterium_phage	35.7	1.9e-08
WP_003901093.1|1244964_1245150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651777.1|1245076_1245352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085701489.1|1245594_1245918_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003898734.1|1245932_1246793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898735.1|1247668_1249069_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.6	1.2e-62
WP_003405880.1|1249090_1250113_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	53.4	7.0e-92
>prophage 90
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1253893	1255366	4380156		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003898737.1|1253893_1255366_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	1.4e-69
>prophage 91
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1266966	1268228	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1266966_1268228_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 92
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1276474	1277227	4380156		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003405961.1|1276474_1277227_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	3.7e-05
>prophage 93
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1284223	1284937	4380156		Escherichia_phage(100.0%)	1	NA	NA
WP_003406044.1|1284223_1284937_-	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	33.5	4.4e-16
>prophage 94
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1296384	1298061	4380156		Escherichia_phage(100.0%)	1	NA	NA
WP_003406090.1|1296384_1298061_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	1.5e-19
>prophage 95
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1308250	1310821	4380156		Mamastrovirus(100.0%)	1	NA	NA
WP_003406167.1|1308250_1310821_+	FO synthase	NA	A9ZMK9	Mamastrovirus	33.8	3.4e-18
>prophage 96
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1319045	1325303	4380156		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003406192.1|1319045_1325303_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.6	5.7e-27
>prophage 97
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1329852	1330932	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003406195.1|1329852_1330932_-	PE-PPE domain-containing protein	NA	A0A222ZS78	Mycobacterium_phage	36.1	2.4e-18
>prophage 98
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1341114	1342536	4380156		Hepacivirus(100.0%)	1	NA	NA
WP_003905485.1|1341114_1342536_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	31.0	5.8e-28
>prophage 99
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1346677	1347925	4380156	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1346677_1347925_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 100
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1354038	1354602	4380156		Enterococcus_phage(100.0%)	1	NA	NA
WP_003898770.1|1354038_1354602_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	32.1	1.7e-10
>prophage 101
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1367117	1372783	4380156	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003900295.1|1367117_1368053_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.3e-19
WP_003406254.1|1368042_1368681_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911448.1|1368822_1369497_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003406257.1|1369732_1370506_+	ECF RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	9.6e-09
WP_003406258.1|1370663_1371128_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003898779.1|1371196_1372783_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.2	8.6e-12
>prophage 102
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1386006	1387188	4380156		Planktothrix_phage(100.0%)	1	NA	NA
WP_003406299.1|1386006_1387188_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.2	6.6e-25
>prophage 103
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1405172	1408012	4380156		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003898793.1|1405172_1406864_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	4.6e-56
WP_003406347.1|1406860_1408012_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	26.8	3.8e-09
>prophage 104
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1419162	1421043	4380156		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003898799.1|1419162_1421043_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	34.1	6.8e-16
>prophage 105
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1425620	1429261	4380156		Bacillus_phage(100.0%)	2	NA	NA
WP_003406569.1|1425620_1427516_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.4e-55
WP_003406574.1|1427512_1429261_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.7e-42
>prophage 106
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1435272	1440482	4380156		Klosneuvirus(50.0%)	3	NA	NA
WP_003406598.1|1435272_1436859_+	oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	28.0	1.5e-48
WP_003900310.1|1436875_1438651_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_003406602.1|1438643_1440482_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-19
>prophage 107
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1444117	1445962	4380156		Hokovirus(100.0%)	1	NA	NA
WP_003406621.1|1444117_1445962_+	adenylyl-sulfate kinase	NA	A0A1V0SGC3	Hokovirus	25.6	1.1e-34
>prophage 108
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1462710	1463364	4380156		Pandoravirus(100.0%)	1	NA	NA
WP_003898815.1|1462710_1463364_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	2.3e-19
>prophage 109
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1482286	1485977	4380156		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_003406857.1|1482286_1482784_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	5.4e-21
WP_003406860.1|1482780_1484271_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003406864.1|1484351_1485977_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.1	2.5e-14
>prophage 110
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1489340	1491044	4380156		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031709366.1|1489340_1491044_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	2.2e-13
>prophage 111
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1503985	1514978	4380156	protease	Bacillus_phage(20.0%)	13	NA	NA
WP_003901136.1|1503985_1505980_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.2	2.0e-50
WP_003900321.1|1506003_1507350_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	36.3	9.4e-44
WP_003406906.1|1507451_1507757_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003898829.1|1507716_1508373_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003406908.1|1508389_1509424_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_003898830.1|1509431_1509872_+	CysO-cysteine peptidase	NA	NA	NA	NA	NA
WP_003406910.1|1509893_1510175_+	sulfur carrier protein CysO	NA	NA	NA	NA	NA
WP_003406912.1|1510184_1511156_+	O-phosphoserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	37.5	5.9e-48
WP_003898831.1|1511146_1511869_+|protease	rhomboid family intramembrane serine protease	protease	L7RCY0	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-06
WP_003406919.1|1511865_1512681_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003406922.1|1512707_1513529_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003406926.1|1513545_1514325_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003406931.1|1514363_1514978_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	30.5	7.6e-09
>prophage 112
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1519837	1525025	4380156		Bacillus_phage(66.67%)	3	NA	NA
WP_003406958.1|1519837_1522417_+	iron ABC transporter ATP-binding protein/permease IrtA	NA	W8CYL7	Bacillus_phage	26.7	4.8e-28
WP_003900322.1|1522413_1524153_+	iron ABC transporter ATP-binding protein/permease IrtB	NA	W8CYL7	Bacillus_phage	25.3	2.6e-22
WP_003406963.1|1524281_1525025_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	3.6e-05
>prophage 113
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1545180	1546231	4380156		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003407164.1|1545180_1546002_+	GTP pyrophosphokinase family protein	NA	A0A142K822	Mycobacterium_phage	51.1	1.7e-48
WP_003907641.1|1545970_1546231_+	hypothetical protein	NA	A0A142K823	Mycobacterium_phage	60.6	8.7e-15
>prophage 114
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1549447	1550709	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1549447_1550709_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 115
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1571192	1577761	4380156		Abalone_herpesvirus(25.0%)	6	NA	NA
WP_003900331.1|1571192_1571819_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.2	1.1e-15
WP_003407248.1|1571884_1572217_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003898859.1|1572232_1573489_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.7e-37
WP_003900333.1|1573616_1574828_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.4	5.7e-117
WP_003407257.1|1574900_1576379_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003407260.1|1576375_1577761_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.6	2.2e-24
>prophage 116
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1582624	1583587	4380156		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003905554.1|1582624_1583587_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	28.3	2.4e-25
>prophage 117
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1591984	1598944	4380156		Staphylococcus_phage(100.0%)	8	NA	NA
WP_003898867.1|1591984_1593004_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	5.8e-38
WP_003407310.1|1593000_1594557_-	MFS transporter	NA	NA	NA	NA	NA
WP_003407315.1|1594562_1595273_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003407318.1|1595357_1595963_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.1	4.1e-31
WP_071854210.1|1596170_1596692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407330.1|1596681_1597083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407334.1|1597187_1598465_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	5.7e-91
WP_003898872.1|1598461_1598944_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.4	3.6e-14
>prophage 118
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1602769	1604700	4380156		Thermobifida_phage(50.0%)	2	NA	NA
WP_003898873.1|1602769_1603675_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.3e-08
WP_003407352.1|1603671_1604700_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	7.9e-35
>prophage 119
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1607849	1614763	4380156		Mycobacterium_phage(66.67%)	5	NA	NA
WP_003407371.1|1607849_1609112_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	37.4	1.5e-35
WP_003898876.1|1609111_1610719_-	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.6e-27
WP_003407374.1|1610722_1611550_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003407376.1|1611668_1612937_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003407378.1|1613176_1614763_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	40.8	2.9e-28
>prophage 120
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1626583	1628884	4380156		Escherichia_phage(100.0%)	1	NA	NA
WP_003902073.1|1626583_1628884_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	31.6	2.4e-71
>prophage 121
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1632213	1633758	4380156		Synechococcus_phage(100.0%)	1	NA	NA
WP_003407443.1|1632213_1633758_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	35.8	1.5e-74
>prophage 122
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1650499	1660490	4380156		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1650499_1651441_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1651596_1653372_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1653419_1654226_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1654222_1656763_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1656759_1657953_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1657949_1658750_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1658751_1660005_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1660001_1660490_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 123
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1664291	1670876	4380156	transposase	Burkholderia_virus(25.0%)	6	NA	NA
WP_151230898.1|1664291_1665553_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	1.1e-81
WP_003905583.1|1665551_1667528_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1667571_1667946_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1667961_1668333_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1668354_1669212_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1669247_1670876_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 124
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1677010	1677736	4380156		Streptomyces_phage(100.0%)	1	NA	NA
WP_003407525.1|1677010_1677736_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	36.4	6.7e-12
>prophage 125
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1682031	1682775	4380156		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003898892.1|1682031_1682775_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.6e-08
>prophage 126
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1699441	1700470	4380156		Salmonella_phage(100.0%)	1	NA	NA
WP_003407612.1|1699441_1700470_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	32.2	2.6e-33
>prophage 127
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1708456	1714380	4380156		Synechococcus_phage(25.0%)	6	NA	NA
WP_003407628.1|1708456_1708819_+	hypothetical protein	NA	M4QRT5	Synechococcus_phage	60.0	7.2e-07
WP_003407632.1|1708802_1709684_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_085701491.1|1709885_1711184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407639.1|1711664_1712687_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.8	4.0e-103
WP_003407642.1|1712683_1713652_+	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	49.7	1.5e-83
WP_003407647.1|1713648_1714380_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	28.0	2.1e-05
>prophage 128
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1720892	1722644	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_085701492.1|1720892_1722644_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.8	8.3e-08
>prophage 129
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1727316	1730651	4380156		Shahe_endorna-like_virus(100.0%)	3	NA	NA
WP_003407671.1|1727316_1728561_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	37.5	2.5e-06
WP_003407672.1|1728607_1729393_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003407676.1|1729370_1730651_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	7.4e-06
>prophage 130
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1745109	1748235	4380156	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003407714.1|1745109_1748235_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.2	1.0e-162
>prophage 131
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1756284	1764023	4380156		Saccharomonospora_phage(50.0%)	4	NA	NA
WP_003407751.1|1756284_1759839_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	60.2	0.0e+00
WP_003903497.1|1759887_1761924_-	PPE family protein	NA	NA	NA	NA	NA
WP_024742859.1|1762080_1762629_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_003917498.1|1762634_1764023_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.1e-39
>prophage 132
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1780230	1785296	4380156		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003407794.1|1780230_1782420_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.4	2.3e-23
WP_003407798.1|1782518_1783211_-	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	36.5	4.3e-08
WP_003407802.1|1783450_1783735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407803.1|1783982_1785296_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.2e-13
>prophage 133
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1800239	1801382	4380156		Faustovirus(100.0%)	1	NA	NA
WP_003407947.1|1800239_1801382_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.7e-17
>prophage 134
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1809583	1810402	4380156		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003407990.1|1809583_1810402_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.1	8.0e-30
>prophage 135
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1827523	1832723	4380156		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_003408045.1|1827523_1828141_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.0	3.9e-05
WP_003408054.1|1828208_1829417_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003408058.1|1829413_1829905_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_003901211.1|1830008_1832723_+	DNA polymerase I	NA	A0A060AFQ3	Listeria_phage	30.6	2.5e-43
>prophage 136
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1842241	1852222	4380156	tRNA	Mycobacterium_phage(25.0%)	6	NA	NA
WP_078387219.1|1842241_1843036_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	67.4	6.2e-11
WP_003408092.1|1843084_1846003_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	7.0e-294
WP_003408096.1|1846059_1846317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408099.1|1846332_1847802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003905614.1|1847860_1851379_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	35.8	9.6e-72
WP_003901217.1|1851616_1852222_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	35.3	9.5e-12
>prophage 137
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1858076	1859102	4380156	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003901219.1|1858076_1859102_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	5.1e-26
>prophage 138
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1868087	1869290	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003408163.1|1868087_1869290_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	28.2	8.7e-17
>prophage 139
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1874668	1885877	4380156		Paenibacillus_phage(100.0%)	2	NA	NA
WP_003902218.1|1874668_1881049_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	1.9e-25
WP_003902217.1|1881068_1885877_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.6	4.1e-25
>prophage 140
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1892941	1894717	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003408257.1|1892941_1894717_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.1e-39
>prophage 141
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1911527	1914251	4380156	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_003898975.1|1911527_1912295_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.9e-21
WP_003408373.1|1912353_1912965_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003408375.1|1912976_1914251_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.2	8.0e-61
>prophage 142
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1923203	1926512	4380156		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003408396.1|1923203_1924964_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	1.4e-127
WP_003408399.1|1924956_1925580_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003408401.1|1925576_1926512_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.7e-20
>prophage 143
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1935734	1938216	4380156		Natrialba_phage(50.0%)	3	NA	NA
WP_003898982.1|1935734_1936691_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.4	1.9e-22
WP_003408432.1|1936687_1937524_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003408436.1|1937520_1938216_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.2	2.5e-08
>prophage 144
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1951226	1954009	4380156		Pandoravirus(50.0%)	3	NA	NA
WP_003900395.1|1951226_1952612_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1952644_1953214_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1953238_1954009_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
>prophage 145
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1959378	1960011	4380156		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003408506.1|1959378_1960011_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
>prophage 146
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1968527	1975751	4380156		Tupanvirus(33.33%)	5	NA	NA
WP_003898998.1|1968527_1970228_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1970512_1970914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1970903_1971515_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1971661_1973092_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|1973153_1975751_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
>prophage 147
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	1986363	1988435	4380156	transposase,integrase	Burkholderia_virus(100.0%)	2	1977135:1977150	1991151:1991166
1977135:1977150	attL	AACCCGCCGTCGCCGC	NA	NA	NA	NA
WP_087902221.1|1986363_1987625_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|1988195_1988435_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
1991151:1991166	attR	GCGGCGACGGCGGGTT	NA	NA	NA	NA
>prophage 148
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2006792	2012485	4380156		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003899021.1|2006792_2008313_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2008309_2012485_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
>prophage 149
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2022781	2030473	4380156	protease	Mycobacterium_phage(100.0%)	5	NA	NA
WP_003408854.1|2022781_2024539_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
WP_003408859.1|2024535_2025756_+	type VII secretion system ESX-5 subunit EccE5	NA	NA	NA	NA	NA
WP_003408868.1|2025752_2027585_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	31.0	3.1e-66
WP_003899024.1|2028211_2028403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901256.1|2028505_2030473_+	PPE family protein PPE28	NA	A0A222ZKN7	Mycobacterium_phage	31.7	2.2e-17
>prophage 150
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2042495	2043200	4380156		Bacillus_virus(100.0%)	1	NA	NA
WP_003899032.1|2042495_2043200_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	3.8e-12
>prophage 151
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2051870	2053790	4380156		Bacillus_virus(100.0%)	1	NA	NA
WP_031709287.1|2051870_2053790_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.2	1.1e-05
>prophage 152
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2064882	2067708	4380156		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003900418.1|2064882_2067708_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	3.0e-257
>prophage 153
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2081264	2084188	4380156		Klosneuvirus(50.0%)	2	NA	NA
WP_003900420.1|2081264_2082701_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.1	3.1e-45
WP_025234866.1|2082736_2084188_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.6	6.6e-35
>prophage 154
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2095573	2099585	4380156		Planktothrix_phage(50.0%)	4	NA	NA
WP_003899051.1|2095573_2096683_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.0e-19
WP_003409337.1|2096735_2097713_+	alanine and proline-rich secreted protein Apa	NA	NA	NA	NA	NA
WP_003409339.1|2098164_2098470_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003409345.1|2098544_2099585_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.9	1.6e-19
>prophage 155
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2112174	2116968	4380156		Bodo_saltans_virus(50.0%)	6	NA	NA
WP_003409385.1|2112174_2112612_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	39.8	5.6e-14
WP_003904723.1|2112684_2113371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899059.1|2113381_2113825_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003910872.1|2113830_2114043_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003409398.1|2114340_2114820_+	bacterioferritin BfrA	NA	NA	NA	NA	NA
WP_003899060.1|2114904_2116968_+	MFS-type transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	3.2e-19
>prophage 156
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2122746	2124883	4380156		Macacine_betaherpesvirus(100.0%)	3	NA	NA
WP_003409420.1|2122746_2123277_-	resuscitation-promoting factor RpfC	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	2.7e-95
WP_003899064.1|2123288_2123888_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003409456.1|2123905_2124883_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	99.7	1.1e-190
>prophage 157
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2134239	2139345	4380156		Scale_drop_disease_virus(33.33%)	4	NA	NA
WP_003899068.1|2134239_2135316_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	32.5	3.9e-08
WP_003409539.1|2135315_2136704_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_003900426.1|2136732_2138025_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	9.7e-14
WP_031709290.1|2138076_2139345_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	1.8e-12
>prophage 158
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2155874	2157136	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2155874_2157136_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 159
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2165550	2166666	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003409667.1|2165550_2166666_+	lipoprotein	NA	S5Z991	Mycobacterium_phage	29.7	1.9e-18
>prophage 160
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2171933	2172701	4380156		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003409686.1|2171933_2172701_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	1.9e-17
>prophage 161
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2179979	2185151	4380156		Synechococcus_phage(50.0%)	4	NA	NA
WP_003409714.1|2179979_2182499_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	34.9	7.7e-07
WP_003902252.1|2182510_2183581_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003409718.1|2183577_2184093_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003899092.1|2184089_2185151_+	riboflavin biosynthesis protein RibA	NA	A0A2H4PQS2	Staphylococcus_phage	33.9	3.1e-34
>prophage 162
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2220198	2221167	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899116.1|2220198_2221167_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.2	2.2e-127
>prophage 163
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2230969	2233285	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899120.1|2230969_2233285_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
>prophage 164
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2243637	2244420	4380156		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003410047.1|2243637_2244420_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
>prophage 165
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2259647	2262374	4380156	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_087902221.1|2259647_2260909_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003918359.1|2260986_2261337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410103.1|2261333_2262374_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
>prophage 166
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2266675	2272576	4380156		Gordonia_phage(50.0%)	2	NA	NA
WP_003410136.1|2266675_2267572_-	hypothetical protein	NA	A0A1B3AYM4	Gordonia_phage	34.7	1.8e-35
WP_003900451.1|2267755_2272576_-	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	23.0	6.4e-34
>prophage 167
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2278775	2281267	4380156		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003410178.1|2278775_2280821_-	hypothetical protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	26.5	3.7e-07
WP_003410189.1|2280832_2281267_-	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	35.0	3.3e-06
>prophage 168
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2285081	2287131	4380156		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003410214.1|2285081_2286056_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.5	6.6e-15
WP_003410218.1|2286057_2287131_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.5e-23
>prophage 169
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2291015	2293555	4380156		Indivirus(50.0%)	3	NA	NA
WP_003410243.1|2291015_2291576_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A1V0SEH9	Indivirus	26.8	6.1e-05
WP_003410246.1|2291616_2291934_-	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_085701493.1|2292019_2293555_-	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	31.9	3.6e-15
>prophage 170
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2310465	2313090	4380156		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_003902238.1|2310465_2313090_-	apolipoprotein N-acyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.3	1.0e-25
>prophage 171
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2328220	2329144	4380156		Salmonella_phage(100.0%)	1	NA	NA
WP_003410677.1|2328220_2329144_-	class A beta-lactamase BlaA	NA	A0A1B0VBP7	Salmonella_phage	42.2	2.7e-50
>prophage 172
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2335657	2336629	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899159.1|2335657_2336629_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	34.9	1.3e-15
>prophage 173
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2346757	2354287	4380156		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003905749.1|2346757_2348527_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.4	6.4e-16
WP_003905750.1|2348543_2349671_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011799244.1|2349719_2350787_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.8	6.1e-14
WP_003410762.1|2350790_2351525_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_003899167.1|2351566_2354287_-	RNA helicase	NA	M1HCW4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.3e-71
>prophage 174
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2362538	2369147	4380156	transposase	Yellowstone_lake_phycodnavirus(50.0%)	6	NA	NA
WP_003899171.1|2362538_2365580_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.3	1.0e-37
WP_003899172.1|2365572_2366406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003905754.1|2366384_2366819_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003410814.1|2366825_2367080_-	antitoxin	NA	NA	NA	NA	NA
WP_003410816.1|2367095_2367353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2367886_2369147_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 175
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2376815	2378645	4380156		Lymphocystis_disease_virus(100.0%)	1	NA	NA
WP_003411035.1|2376815_2378645_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	39.1	3.5e-33
>prophage 176
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2393568	2394813	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003411091.1|2393568_2394813_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	35.5	1.1e-30
>prophage 177
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2438939	2443316	4380156	transposase	Pandoravirus(50.0%)	5	NA	NA
WP_003899202.1|2438939_2440139_+	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	30.0	8.7e-17
WP_003899203.1|2440280_2440946_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003905774.1|2440879_2441062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411323.1|2441330_2442719_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_003411331.1|2442809_2443316_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A142UMD2	Mycobacterium_phage	44.0	1.9e-26
>prophage 178
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2449158	2457742	4380156		Catovirus(25.0%)	7	NA	NA
WP_003901348.1|2449158_2450961_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.1e-50
WP_003411369.1|2450991_2452149_-	GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase	NA	NA	NA	NA	NA
WP_003411371.1|2452245_2453019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411373.1|2453113_2454271_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.6	2.0e-18
WP_003411376.1|2454456_2454708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901350.1|2454817_2456755_+	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	33.9	9.4e-13
WP_003411387.1|2456629_2457742_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	8.6e-43
>prophage 179
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2465938	2467897	4380156		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003411413.1|2465938_2467897_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	28.2	7.3e-21
>prophage 180
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2479279	2482643	4380156		Mycoplasma_phage(50.0%)	2	NA	NA
WP_003899220.1|2479279_2480827_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	8.6e-33
WP_003411445.1|2480864_2482643_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	25.9	1.4e-07
>prophage 181
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2502585	2503680	4380156		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003899226.1|2502585_2503680_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	33.3	1.1e-05
>prophage 182
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2533135	2534221	4380156		Synechococcus_phage(100.0%)	1	NA	NA
WP_003899236.1|2533135_2534221_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.2	2.5e-31
>prophage 183
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2547062	2547932	4380156	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003411681.1|2547062_2547932_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	26.1	2.4e-08
>prophage 184
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2551994	2553653	4380156		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_045245504.1|2551994_2553653_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
>prophage 185
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2568882	2570826	4380156		Catovirus(100.0%)	1	NA	NA
WP_003411855.1|2568882_2570826_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.2	1.0e-107
>prophage 186
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2578327	2582603	4380156	integrase	Mycobacterium_phage(66.67%)	8	2572713:2572726	2584032:2584045
2572713:2572726	attL	TCGAGGTGCGCTCC	NA	NA	NA	NA
WP_003899265.1|2578327_2578759_-	hypothetical protein	NA	A0A076GDT8	Mycobacterium_phage	47.1	2.0e-16
WP_003902166.1|2578851_2579034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902167.1|2579242_2579959_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_003411888.1|2579968_2580301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899267.1|2580666_2581122_-|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	47.2	3.6e-24
WP_003909645.1|2581138_2581264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902168.1|2581868_2582156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411901.1|2582258_2582603_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.3	7.3e-09
2584032:2584045	attR	GGAGCGCACCTCGA	NA	NA	NA	NA
>prophage 187
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2597629	2599723	4380156		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003411969.1|2597629_2599723_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	1.6e-05
>prophage 188
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2608571	2609504	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899275.1|2608571_2609504_+	O-acetylserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	53.4	2.4e-83
>prophage 189
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2620307	2622227	4380156		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_003412049.1|2620307_2622227_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	30.3	1.4e-32
>prophage 190
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2633875	2635136	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2633875_2635136_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 191
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2640276	2644072	4380156	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_003412200.1|2640276_2641668_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.4	7.7e-49
WP_003412205.1|2641849_2642257_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003899290.1|2642253_2642646_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003412208.1|2642753_2643182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003412212.1|2643181_2644072_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	38.3	1.0e-17
>prophage 192
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2649519	2654591	4380156		Pseudomonas_phage(50.0%)	6	NA	NA
WP_003412235.1|2649519_2650578_-	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.1e-47
WP_003902257.1|2650549_2650852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899293.1|2650848_2652162_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003901386.1|2652254_2652542_+	PE family protein	NA	NA	NA	NA	NA
WP_003900509.1|2652640_2653429_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003899294.1|2653442_2654591_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	1.0e-22
>prophage 193
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2658303	2667866	4380156		Tupanvirus(100.0%)	2	NA	NA
WP_003412267.1|2658303_2662689_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	1.8e-51
WP_003899297.1|2662670_2667866_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-82
>prophage 194
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2672196	2676441	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003902259.1|2672196_2676441_-	phenyloxazoline synthase MbtB	NA	A0A2K9KZV5	Tupanvirus	26.1	2.3e-43
>prophage 195
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2683851	2684316	4380156		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003412293.1|2683851_2684316_-	resuscitation-promoting factor RpfD	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-83
>prophage 196
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2694511	2695567	4380156		Bacillus_virus(100.0%)	1	NA	NA
WP_003412325.1|2694511_2695567_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	1.3e-29
>prophage 197
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2701889	2703851	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003900516.1|2701889_2703851_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	8.6e-22
>prophage 198
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2724832	2726080	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412516.1|2724832_2726080_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	3.3e-91
>prophage 199
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2737504	2738635	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412568.1|2737504_2738635_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.8e-51
>prophage 200
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2745701	2752568	4380156	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003412592.1|2745701_2746112_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	2.6e-29
WP_003412596.1|2746154_2746526_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003899324.1|2746522_2747986_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003899325.1|2747982_2750613_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	7.0e-144
WP_003412609.1|2750700_2751960_-	enoyl reductase	NA	NA	NA	NA	NA
WP_003905853.1|2752049_2752568_-	resuscitation-promoting factor rpfE	NA	A0A1J0GVU2	Streptomyces_phage	82.9	2.5e-29
>prophage 201
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2758595	2759876	4380156	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_003412634.1|2758595_2759876_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	4.2e-142
>prophage 202
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2762918	2764162	4380156	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003412648.1|2762918_2763563_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	31.4	5.2e-08
WP_003412650.1|2763559_2764162_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	1.2e-38
>prophage 203
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2767246	2773423	4380156		Bacillus_phage(33.33%)	7	NA	NA
WP_003412657.1|2767246_2768053_-	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	28.9	6.5e-08
WP_003899332.1|2768058_2768547_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_003412664.1|2768648_2769272_-	Rv2466c family mycothiol-dependent reductase	NA	NA	NA	NA	NA
WP_003412666.1|2769373_2771959_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.2	3.6e-44
WP_003412669.1|2772031_2772535_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003412671.1|2772485_2772719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899334.1|2772754_2773423_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.2	1.2e-18
>prophage 204
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2782753	2785017	4380156		Tupanvirus(50.0%)	2	NA	NA
WP_003412708.1|2782753_2784430_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.4e-44
WP_003900529.1|2784510_2785017_-	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	31.2	1.4e-08
>prophage 205
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2791752	2793018	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003902276.1|2791752_2793018_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	38.8	2.0e-35
>prophage 206
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2815913	2820625	4380156		Pike_perch_iridovirus(50.0%)	4	NA	NA
WP_003905871.1|2815913_2817503_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
WP_003412782.1|2817499_2818156_-	succinyl-CoA--3-ketoacid CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003412786.1|2818152_2818899_-	succinyl-CoA--3-ketoacid CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003899357.1|2818981_2820625_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	2.1e-29
>prophage 207
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2824516	2828832	4380156	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2824516_2826118_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2826185_2826833_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2827584_2828832_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 208
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2848880	2849603	4380156		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003412957.1|2848880_2849603_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	50.7	4.1e-54
>prophage 209
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2862230	2863436	4380156		Pandoravirus(100.0%)	1	NA	NA
WP_003413027.1|2862230_2863436_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.9	1.6e-47
>prophage 210
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2872794	2878953	4380156	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_003902305.1|2872794_2875509_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.5	4.8e-63
WP_003413208.1|2875599_2875989_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_003899374.1|2876095_2876770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413213.1|2876854_2877565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899376.1|2877594_2878953_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.8e-80
>prophage 211
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2882364	2883357	4380156		Planktothrix_phage(100.0%)	1	NA	NA
WP_003901426.1|2882364_2883357_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	9.4e-33
>prophage 212
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2898361	2899243	4380156		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003899384.1|2898361_2899243_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	48.0	3.2e-53
>prophage 213
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2902661	2923256	4380156	tRNA	Klosneuvirus(22.22%)	14	NA	NA
WP_003413363.1|2902661_2903564_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.0	4.2e-56
WP_003413365.1|2903843_2905115_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	23.1	4.0e-12
WP_003413366.1|2905111_2905786_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.3	6.8e-19
WP_003413367.1|2905836_2906763_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	34.2	2.3e-09
WP_003413368.1|2906848_2909221_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_003413369.1|2909251_2909923_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	32.2	3.1e-11
WP_003413373.1|2910026_2911700_-	lipoprotein	NA	NA	NA	NA	NA
WP_003899387.1|2911705_2913034_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.7	2.9e-21
WP_003413385.1|2913037_2914759_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003413391.1|2914868_2915216_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003413395.1|2915382_2916732_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	5.0e-21
WP_003413409.1|2916893_2920400_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.6	3.9e-17
WP_009940036.1|2920573_2922205_+	PE family protein	NA	NA	NA	NA	NA
WP_003413416.1|2922221_2923256_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	7.0e-07
>prophage 214
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2927410	2928982	4380156		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003899392.1|2927410_2928982_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.2	5.1e-09
>prophage 215
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2940211	2978483	4380156	capsid,terminase,protease,integrase,head,tRNA	Mycobacterium_phage(30.0%)	48	2969012:2969039	2978636:2978663
WP_003413486.1|2940211_2942290_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2942398_2942626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2942622_2944008_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2944352_2944853_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2944869_2945310_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2945456_2946134_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946118_2946472_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2946484_2946910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2946906_2947581_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2947658_2948480_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2948615_2949509_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2949511_2950330_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2950344_2951526_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2951584_2952016_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2952529_2953771_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954080_2954443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2954789_2955914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2955915_2956455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2956594_2957893_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2957931_2958213_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2958357_2958843_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2958869_2959127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959127_2961464_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2961492_2961735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2961735_2962413_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2962608_2963265_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2963427_2963874_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964048_2964381_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2964500_2964860_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2964961_2965420_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2965555_2965936_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2965932_2967429_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2967618_2967855_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2967927_2968101_+	hypothetical protein	NA	NA	NA	NA	NA
2969012:2969039	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969145_2969577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2969573_2970572_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2970585_2971050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2971037_2971289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2971459_2972899_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2972906_2973440_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2973592_2974219_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2974250_2974574_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2974653_2974899_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2974895_2976323_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2976324_2976717_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2976713_2976974_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2976990_2977353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2977355_2978483_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2978636:2978663	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 216
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2981560	2982319	4380156	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003413845.1|2981560_2982319_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
>prophage 217
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	2990353	2991712	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003413871.1|2990353_2991712_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	37.4	2.4e-07
>prophage 218
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3002668	3003574	4380156		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003413913.1|3002668_3003574_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.2e-13
>prophage 219
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3011496	3011961	4380156		Streptomyces_phage(100.0%)	1	NA	NA
WP_003413930.1|3011496_3011961_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	47.6	9.4e-28
>prophage 220
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3015648	3033907	4380156		Cyanophage(28.57%)	21	NA	NA
WP_003413944.1|3015648_3017235_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	4.6e-42
WP_003899440.1|3017271_3017700_+	RidA family protein	NA	NA	NA	NA	NA
WP_003413947.1|3017627_3018017_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003902340.1|3018013_3018271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413953.1|3018386_3019361_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003899441.1|3019361_3019610_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	47.5	8.3e-15
WP_003910933.1|3019652_3020090_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_003413958.1|3020265_3021237_+	RNA polymerase sigma factor SigB	NA	M4SMP8	Cyanophage	35.7	6.6e-39
WP_003413962.1|3021369_3022062_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003905914.1|3022074_3023133_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003900556.1|3023245_3024652_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.4e-42
WP_003901455.1|3024869_3025844_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003900558.1|3025902_3026928_+	alpha/beta hydrolase	NA	G1DAB1	Mycobacterium_virus	30.0	9.7e-17
WP_003413971.1|3026976_3027663_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003900559.1|3027671_3028166_-	FABP family protein	NA	NA	NA	NA	NA
WP_003413973.1|3028217_3028682_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003413974.1|3028844_3029342_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899448.1|3029592_3030303_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	8.0e-10
WP_003900560.1|3030324_3032424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902343.1|3032439_3032688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413979.1|3032713_3033907_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	33.3	8.4e-28
>prophage 221
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3044625	3049229	4380156		Mycobacterium_phage(66.67%)	4	NA	NA
WP_003899455.1|3044625_3045480_+	DUF5131 family protein	NA	A0A088F7U1	Mycobacterium_phage	48.6	1.8e-64
WP_003899456.1|3045364_3046357_-	three-Cys-motif partner protein TcmP	NA	A0A142KCL9	Gordonia_phage	60.3	3.0e-108
WP_003905919.1|3046366_3046891_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003414006.1|3046856_3049229_-	intein-containing recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	50.0	5.2e-21
>prophage 222
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3057659	3060311	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414040.1|3057659_3060311_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	57.9	4.2e-112
>prophage 223
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3064997	3067888	4380156		Rhodococcus_phage(50.0%)	3	NA	NA
WP_003899465.1|3064997_3065750_-	FAD-dependent thymidylate synthase	NA	M9MU99	Rhodococcus_phage	47.4	4.9e-50
WP_003414055.1|3065993_3066269_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003414057.1|3066265_3067888_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	5.9e-08
>prophage 224
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3070934	3072285	4380156		Ralstonia_phage(50.0%)	2	NA	NA
WP_003414073.1|3070934_3071414_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	38.6	6.8e-21
WP_003911953.1|3071484_3072285_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	70.5	2.2e-109
>prophage 225
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3086849	3088166	4380156		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_003414119.1|3086849_3088166_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	24.4	5.4e-28
>prophage 226
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3098006	3099967	4380156	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003899482.1|3098006_3099386_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3099385_3099967_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
>prophage 227
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3118094	3119355	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3118094_3119355_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 228
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3129574	3130657	4380156		Bacillus_virus(100.0%)	1	NA	NA
WP_003414499.1|3129574_3130657_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
>prophage 229
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3136646	3139349	4380156		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003899505.1|3136646_3139349_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
>prophage 230
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3144514	3146107	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414532.1|3144514_3146107_-	multidrug efflux MFS transporter EfpA	NA	A0A0M3UL24	Mycobacterium_phage	33.0	7.7e-45
>prophage 231
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3156680	3163122	4380156		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_003414557.1|3156680_3158060_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.1e-34
WP_003414559.1|3158159_3159278_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003414562.1|3159343_3159676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414566.1|3159687_3159903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099171521.1|3159823_3160006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414570.1|3160058_3160835_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.0e-15
WP_003900585.1|3160831_3162199_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003900586.1|3162195_3163122_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	32.5	4.2e-11
>prophage 232
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3185756	3187960	4380156	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003901487.1|3185756_3187076_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	29.4	4.1e-28
WP_003899526.1|3187072_3187960_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	27.3	2.6e-10
>prophage 233
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3194921	3195818	4380156		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003414689.1|3194921_3195818_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.9	3.1e-19
>prophage 234
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3203689	3204484	4380156		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003414713.1|3203689_3204484_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	26.9	7.1e-07
>prophage 235
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3209865	3226114	4380156		Erythrobacter_phage(20.0%)	11	NA	NA
WP_023644660.1|3209865_3210741_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	4.4e-10
WP_003414739.1|3210800_3211388_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899536.1|3211389_3213225_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003900593.1|3213293_3215051_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	23.4	1.3e-05
WP_003899537.1|3215094_3216207_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003414748.1|3216234_3217812_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003414750.1|3217889_3219770_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	41.0	3.9e-88
WP_003899539.1|3219780_3222207_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003414756.1|3222264_3222603_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003899540.1|3222599_3224033_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.8	1.4e-40
WP_003899541.1|3224845_3226114_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.5	1.5e-11
>prophage 236
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3230572	3232523	4380156		Bacillus_phage(50.0%)	2	NA	NA
WP_003414814.1|3230572_3231442_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	25.1	1.1e-13
WP_003414820.1|3231800_3232523_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.4	1.9e-22
>prophage 237
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3237416	3247657	4380156		Paenibacillus_phage(100.0%)	2	NA	NA
WP_055371320.1|3237416_3243044_+	phthiocerol type I polyketide synthase PpsA	NA	D0R7J2	Paenibacillus_phage	29.8	2.7e-28
WP_003899547.1|3243040_3247657_+	phthiocerol type I polyketide synthase PpsB	NA	D0R7J2	Paenibacillus_phage	36.3	1.1e-32
>prophage 238
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3254215	3259699	4380156		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003899549.1|3254215_3259699_+	phthiocerol type I polyketide synthase PpsD	NA	D0R7J2	Paenibacillus_phage	31.6	3.7e-30
>prophage 239
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3264181	3265177	4380156		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003901496.1|3264181_3265177_+	daunorubicin ABC transporter permease DrrB	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	1.5e-22
>prophage 240
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3268347	3274683	4380156		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003901497.1|3268347_3274683_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.3	9.9e-27
>prophage 241
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3299554	3301374	4380156		uncultured_virus(50.0%)	2	NA	NA
WP_003414906.1|3299554_3300520_-	[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha- L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L- rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase	NA	A0A218MM68	uncultured_virus	25.5	1.5e-06
WP_003899556.1|3300642_3301374_+	[alpha-L-fucopyranosyl-(1->3)-alpha-L- rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase	NA	Q58M88	Prochlorococcus_phage	33.3	1.3e-07
>prophage 242
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3308503	3310790	4380156		Synechococcus_phage(50.0%)	3	NA	NA
WP_003901503.1|3308503_3309436_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	2.1e-10
WP_003414994.1|3310075_3310261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414998.1|3310304_3310790_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	9.3e-18
>prophage 243
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3316547	3318924	4380156		Moumouvirus(50.0%)	2	NA	NA
WP_003415015.1|3316547_3317678_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	5.0e-30
WP_003415022.1|3318075_3318924_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	1.0e-56
>prophage 244
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3324043	3327721	4380156	transposase	Pandoravirus(33.33%)	4	NA	NA
WP_003899565.1|3324043_3324727_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	40.7	3.8e-33
WP_003415034.1|3324759_3325761_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_003415037.1|3325757_3327137_-	resolvase	NA	I4AZM3	Saccharomonospora_phage	32.9	2.3e-21
WP_003415039.1|3327136_3327721_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	29.9	1.1e-17
>prophage 245
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3335263	3335908	4380156		Streptomyces_phage(100.0%)	1	NA	NA
WP_003415107.1|3335263_3335908_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	2.8e-14
>prophage 246
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3345570	3347157	4380156		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003899578.1|3345570_3347157_-	D-3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.5	1.2e-34
>prophage 247
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3350699	3355074	4380156		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003415160.1|3350699_3351359_+	ABC transporter permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.2	6.9e-08
WP_003899581.1|3351672_3352674_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003415167.1|3352711_3353218_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003415168.1|3353217_3355074_-	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.3	9.6e-55
>prophage 248
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3360910	3366708	4380156	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003415251.1|3360910_3361942_-	ATP-dependent 6-phosphofructokinase	NA	E5EQL4	Micromonas_sp._RCC1109_virus	24.2	2.3e-13
WP_003900613.1|3362037_3363522_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003415256.1|3363518_3363818_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003901515.1|3363902_3364559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003415263.1|3364632_3366708_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	8.3e-108
>prophage 249
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3370692	3378039	4380156	transposase,tRNA	Burkholderia_virus(33.33%)	7	NA	NA
WP_087902221.1|3370692_3371953_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003415342.1|3372007_3372301_-	type VII secretion system protein EsxS	NA	NA	NA	NA	NA
WP_003910692.1|3372347_3373655_-	PPE family protein	NA	NA	NA	NA	NA
WP_003415766.1|3373651_3373966_-	PE family protein	NA	NA	NA	NA	NA
WP_003901078.1|3374347_3375595_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003415909.1|3375757_3376861_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003415911.1|3376857_3378039_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.6	1.4e-30
>prophage 250
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3394027	3394891	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003415944.1|3394027_3394891_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.7e-07
>prophage 251
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3399257	3411621	4380156		Mycobacterium_phage(28.57%)	13	NA	NA
WP_003415965.1|3399257_3400298_+	NADP-dependent alcohol dehydrogenase C	NA	A0A2K9L7I1	Tupanvirus	41.2	3.7e-72
WP_003415968.1|3400286_3400661_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003902400.1|3400994_3401279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003415973.1|3401376_3402351_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	85.3	8.0e-154
WP_003899895.1|3402481_3404056_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003415979.1|3404189_3404930_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078387223.1|3405057_3407235_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.8e-209
WP_003415981.1|3407204_3407657_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003415982.1|3407691_3407931_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	68.0	3.4e-21
WP_003415983.1|3408393_3408948_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	4.0e-09
WP_003415984.1|3409039_3409654_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899898.1|3409663_3410704_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	31.8	7.1e-15
WP_003415986.1|3410757_3411621_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	2.2e-06
>prophage 252
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3432567	3439015	4380156		Tupanvirus(50.0%)	4	NA	NA
WP_003901535.1|3432567_3434379_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	34.8	9.6e-84
WP_003416059.1|3434379_3434781_+	hydrogenase	NA	NA	NA	NA	NA
WP_003416061.1|3434796_3435624_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003899905.1|3435682_3439015_-	serine/threonine-protein kinase PknK	NA	A0A1M7XTW9	Cedratvirus	28.0	3.0e-14
>prophage 253
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3444807	3452125	4380156		Synechococcus_phage(33.33%)	5	NA	NA
WP_003416075.1|3444807_3445914_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-27
WP_003416076.1|3445951_3447370_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416079.1|3447366_3448791_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416081.1|3448787_3450299_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	5.6e-45
WP_003416086.1|3451237_3452125_+	SPFH domain-containing protein	NA	A0A0M4RAA7	Mycobacterium_phage	50.5	2.8e-68
>prophage 254
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3462327	3464396	4380156		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003416113.1|3462327_3462810_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	1.5e-31
WP_003416117.1|3462812_3463706_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003416120.1|3463706_3464396_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.7	2.5e-32
>prophage 255
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3473786	3476973	4380156	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_003901545.1|3473786_3474317_+	nucleoside deaminase	NA	A0A2I7QX61	Vibrio_phage	39.0	5.8e-05
WP_003904994.1|3474335_3474479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901078.1|3474478_3475726_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003899922.1|3475803_3476973_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.1	1.6e-10
>prophage 256
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3486980	3488242	4380156	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3486980_3488242_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 257
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3536767	3537667	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003416610.1|3536767_3537667_-	alpha/beta hydrolase	NA	A0A1C9LZ53	Mycobacterium_phage	31.1	9.8e-05
>prophage 258
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3542368	3547425	4380156	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_003416628.1|3542368_3543229_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	28.6	7.4e-10
WP_071854247.1|3543323_3543719_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003416635.1|3543958_3544252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416640.1|3544539_3545829_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087902221.1|3546163_3547425_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 259
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3552874	3553909	4380156	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003416786.1|3552874_3553909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.3	7.0e-31
>prophage 260
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3564672	3572600	4380156		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_003416822.1|3564672_3566775_-	ATP-dependent DNA helicase UvrD2	NA	A0A2H4UW05	Bodo_saltans_virus	24.2	4.9e-15
WP_003416827.1|3566898_3567153_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_003906027.1|3567165_3568107_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003899966.1|3568165_3569233_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003910809.1|3569294_3572600_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	1.8e-08
>prophage 261
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3583360	3587056	4380156		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_003416875.1|3583360_3584944_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.9e-46
WP_003416876.1|3584956_3586180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901572.1|3586255_3587056_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.8	1.3e-16
>prophage 262
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3591276	3595115	4380156		Mycobacterium_phage(50.0%)	7	NA	NA
WP_003416884.1|3591276_3591531_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	8.8e-12
WP_003901574.1|3591592_3593098_-	ATPase	NA	NA	NA	NA	NA
WP_003416887.1|3593114_3593330_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_003416889.1|3593530_3593605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416891.1|3593614_3593920_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_003899976.1|3593916_3594468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003416897.1|3594464_3595115_-	ECF RNA polymerase sigma factor SigH	NA	A0A076YQ50	Rhizobium_phage	26.5	6.8e-08
>prophage 263
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3598127	3598886	4380156		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003416907.1|3598127_3598886_-	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	37.6	1.5e-27
>prophage 264
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3620474	3625212	4380156		Bacillus_phage(66.67%)	4	NA	NA
WP_003906038.1|3620474_3622178_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.3e-18
WP_003899985.1|3622227_3622914_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.6e-39
WP_003417036.1|3622983_3623628_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003417039.1|3623724_3625212_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.2	1.4e-43
>prophage 265
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3635436	3635706	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003417079.1|3635436_3635706_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	81.2	6.4e-29
>prophage 266
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3640462	3648247	4380156		Sphingomonas_phage(33.33%)	7	NA	NA
WP_003417097.1|3640462_3641542_-	NDP-sugar synthase	NA	H9NC64	Sphingomonas_phage	32.6	2.1e-17
WP_003901582.1|3641543_3642449_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003899993.1|3642459_3643374_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	8.4e-28
WP_003417107.1|3643449_3644946_+	LCP family protein	NA	NA	NA	NA	NA
WP_003417112.1|3644984_3645674_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_003417115.1|3645798_3646080_+	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003899995.1|3646090_3648247_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	33.5	6.2e-82
>prophage 267
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3653678	3654203	4380156		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003899997.1|3653678_3654203_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	1.1e-21
>prophage 268
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3663598	3667224	4380156		Bacillus_phage(50.0%)	5	NA	NA
WP_003417158.1|3663598_3664384_-	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	33.2	3.6e-19
WP_003417160.1|3664380_3664818_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_003417162.1|3665015_3665429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417165.1|3665463_3665841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900004.1|3665874_3667224_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	45.5	1.1e-111
>prophage 269
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3672204	3676746	4380156		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003901592.1|3672204_3676746_+	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	37.5	2.6e-05
>prophage 270
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3690351	3691956	4380156		Streptococcus_phage(100.0%)	1	NA	NA
WP_003900011.1|3690351_3691956_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.1	3.4e-48
>prophage 271
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3697671	3698955	4380156		Geobacillus_virus(100.0%)	1	NA	NA
WP_003900016.1|3697671_3698955_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.3	3.8e-79
>prophage 272
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3709483	3800728	4380156	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
WP_087902221.1|3709483_3710745_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3711038_3711200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3711221_3712751_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3712683_3713622_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3713630_3714998_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3715066_3716284_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3716379_3717888_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3717884_3719036_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3719226_3720072_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3720546_3720987_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3721020_3721890_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3721910_3722921_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3723205_3723838_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3723904_3725134_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3725416_3726766_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3726777_3727917_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3727913_3728645_+	methyltransferase	NA	NA	NA	NA	NA
WP_085701496.1|3728653_3739723_-	PPE family protein	NA	NA	NA	NA	NA
WP_031648820.1|3739771_3745711_-	PE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3746140_3746398_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3746653_3756127_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3756752_3757199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3757235_3758054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3758270_3758558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3770287_3771082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3771163_3771535_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3771432_3771843_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3771677_3771938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3772052_3772442_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3772455_3772749_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3772745_3773591_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3773714_3773990_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3773986_3774244_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3774285_3775476_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3775592_3775961_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3775957_3776509_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3776515_3777097_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3777077_3777446_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3777423_3777816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3777812_3780443_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3780678_3781143_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3781509_3783285_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3783285_3783930_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3783928_3784363_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3784451_3787691_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_031709368.1|3787882_3789217_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3789258_3790434_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3790487_3790592_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3790670_3791312_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3791312_3791561_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3791565_3792993_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3793100_3793754_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3793792_3795298_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3795302_3796193_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003918607.1|3796201_3798040_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417912.1|3798036_3799026_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_087902221.1|3799467_3800728_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 273
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3810502	3811366	4380156		Tupanvirus(100.0%)	1	NA	NA
WP_003900041.1|3810502_3811366_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
>prophage 274
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3824277	3825516	4380156		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003902474.1|3824277_3825516_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
>prophage 275
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3829876	3830176	4380156		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003911013.1|3829876_3830176_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	99.0	1.6e-44
>prophage 276
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3833554	3835144	4380156		Klosneuvirus(100.0%)	1	NA	NA
WP_003901630.1|3833554_3835144_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	6.2e-87
>prophage 277
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3838516	3842214	4380156	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_003418017.1|3838516_3838825_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
WP_003418021.1|3838896_3840516_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
WP_003418028.1|3840610_3840913_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
WP_003900052.1|3841179_3842214_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
>prophage 278
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3847507	3849357	4380156	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003418125.1|3847507_3848263_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	1.5e-22
WP_104591446.1|3848346_3849357_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	7.7e-83
>prophage 279
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3862417	3864292	4380156		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003418289.1|3862417_3864292_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
>prophage 280
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3871929	3875640	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418326.1|3871929_3875640_-	type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
>prophage 281
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3889294	3894544	4380156		Enterobacteria_phage(50.0%)	5	NA	NA
WP_003418607.1|3889294_3890290_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	3.1e-76
WP_003906113.1|3890291_3890900_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	37.8	7.5e-25
WP_003911061.1|3891421_3892378_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003900066.1|3892435_3893530_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	28.0	1.8e-05
WP_003900067.1|3893533_3894544_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.6e-27
>prophage 282
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3907426	3908209	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418925.1|3907426_3908209_-	DUF2510 domain-containing protein	NA	A0A088F7R2	Mycobacterium_phage	63.2	7.0e-07
>prophage 283
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3919510	3921157	4380156		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003911024.1|3919510_3921157_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.6	2.0e-16
>prophage 284
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3942275	3943187	4380156		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003419251.1|3942275_3943187_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	1.7e-36
>prophage 285
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3946745	3948185	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003900090.1|3946745_3948185_+	PPE family protein	NA	A0A222ZKN7	Mycobacterium_phage	31.4	1.5e-23
>prophage 286
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3956067	3956982	4380156		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003900711.1|3956067_3956982_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.4e-11
>prophage 287
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3961370	3963428	4380156		Synechococcus_phage(100.0%)	1	NA	NA
WP_003901670.1|3961370_3963428_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	36.8	6.3e-07
>prophage 288
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3970322	3971846	4380156		Hepacivirus(100.0%)	1	NA	NA
WP_003900098.1|3970322_3971846_+	3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase	NA	Q75ZG1	Hepacivirus	27.4	3.9e-38
>prophage 289
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	3991079	3992489	4380156	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003900108.1|3991079_3992489_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	7.8e-41
>prophage 290
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4004542	4011626	4380156	protease,tRNA	Mycobacterium_virus(25.0%)	5	NA	NA
WP_003419504.1|4004542_4005370_+	hypothetical protein	NA	G8I9P6	Mycobacterium_virus	63.9	2.9e-96
WP_003911027.1|4005416_4006736_-	PE family protein	NA	NA	NA	NA	NA
WP_003419511.1|4006843_4009390_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	1.8e-128
WP_003419513.1|4009666_4010005_-	nucleoid-associated protein	NA	A0A2D1GPL8	Mycobacterium_phage	42.4	4.6e-16
WP_003901683.1|4010108_4011626_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	34.5	1.1e-69
>prophage 292
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4086308	4086764	4380156		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003419733.1|4086308_4086764_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.6	4.9e-21
>prophage 293
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4089789	4090146	4380156		Tsukamurella_phage(100.0%)	1	NA	NA
WP_003419743.1|4089789_4090146_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	1.8e-10
>prophage 294
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4095884	4097315	4380156		Mollivirus(100.0%)	1	NA	NA
WP_003419754.1|4095884_4097315_-	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	31.6	2.6e-23
>prophage 295
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4118619	4119630	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003419818.1|4118619_4119630_-	DUF4185 domain-containing protein	NA	B5LJL4	Mycobacterium_phage	31.5	7.9e-11
>prophage 296
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4132325	4135321	4380156		Tupanvirus(50.0%)	2	NA	NA
WP_003420415.1|4132325_4133588_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.0	1.4e-36
WP_003420417.1|4133584_4135321_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	1.7e-42
>prophage 297
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4138803	4139805	4380156		Vaccinia_virus(100.0%)	1	NA	NA
WP_003911033.1|4138803_4139805_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q1M1E9	Vaccinia_virus	34.4	1.2e-08
>prophage 298
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4150348	4151425	4380156		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003420435.1|4150348_4151425_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	28.2	2.7e-17
>prophage 299
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4161981	4168296	4380156	integrase	Acidithiobacillus_phage(40.0%)	10	4161998:4162012	4167870:4167884
WP_003899665.1|4161981_4163964_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	8.8e-91
4161998:4162012	attL	CCAGCGGCGCGGCGC	NA	NA	NA	NA
WP_003901716.1|4164030_4164393_+	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR	NA	NA	NA	NA	NA
WP_003899668.1|4164476_4164689_-	DUF2237 family protein	NA	NA	NA	NA	NA
WP_003899670.1|4164761_4165097_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003899671.1|4165314_4165698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899672.1|4165827_4166187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899673.1|4166219_4166729_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	42.6	4.0e-11
WP_003420504.1|4166796_4167189_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	47.0	4.8e-17
WP_071854238.1|4167452_4167680_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	72.4	1.5e-15
WP_003420508.1|4167837_4168296_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.2e-05
4167870:4167884	attR	CCAGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 300
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4171877	4181570	4380156		Planktothrix_phage(20.0%)	9	NA	NA
WP_003906205.1|4171877_4173008_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.9e-20
WP_003901718.1|4173016_4173964_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003420534.1|4174128_4174431_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003420539.1|4174452_4175508_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003900750.1|4175586_4177467_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	7.5e-140
WP_003420544.1|4177637_4178117_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_003906207.1|4178172_4179600_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.3e-06
WP_003420552.1|4179670_4180375_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.9e-35
WP_003901719.1|4180883_4181570_+	hypothetical protein	NA	A0A2P1CG82	Mycobacterium_phage	54.1	4.6e-55
>prophage 301
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4185721	4186783	4380156		Pacmanvirus(100.0%)	1	NA	NA
WP_003420576.1|4185721_4186783_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	4.7e-14
>prophage 302
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4196115	4202095	4380156		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003420603.1|4196115_4196937_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	5.4e-10
WP_003906213.1|4196933_4197848_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003420610.1|4197844_4198687_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003420612.1|4198842_4199823_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.5	1.2e-32
WP_003420618.1|4200871_4202095_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	31.4	3.4e-08
>prophage 303
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4231852	4235157	4380156		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_003420779.1|4231852_4232863_-	cutinase family protein	NA	A0A2K9VEH2	Gordonia_phage	28.6	6.9e-07
WP_003420783.1|4233061_4233961_-	MPT51/MPB51 antigen	NA	A0A2I6AZH7	Macacine_betaherpesvirus	38.4	5.1e-46
WP_003900759.1|4234140_4235157_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	1.3e-178
>prophage 304
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4240774	4244916	4380156		Streptococcus_phage(50.0%)	3	NA	NA
WP_003420798.1|4240774_4241974_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.5	8.8e-86
WP_003420801.1|4242237_4243092_+	exported repetitive protein	NA	NA	NA	NA	NA
WP_003420805.1|4243296_4244916_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	39.4	1.1e-06
>prophage 305
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4255219	4256434	4380156		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899709.1|4255219_4256434_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	35.6	3.7e-23
>prophage 306
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4261723	4268104	4380156		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003900763.1|4261723_4268104_-	phthioceranic/hydroxyphthioceranic acid synthase	NA	D0R7J2	Paenibacillus_phage	30.1	4.6e-24
>prophage 307
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4276155	4277415	4380156	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003420889.1|4276155_4277415_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	33.8	7.7e-56
>prophage 308
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4289204	4289828	4380156		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003399735.1|4289204_4289828_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	1.2e-33
>prophage 309
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4311812	4323562	4380156		Mycobacterium_phage(40.0%)	9	NA	NA
WP_003399850.1|4311812_4313534_+	type VII secretion system ESX-1 AAA family ATPase EccA1	NA	V5UQM2	Mycobacterium_phage	33.2	8.6e-58
WP_003399854.1|4313537_4314980_+	type VII secretion system ESX-1 subunit EccB1	NA	NA	NA	NA	NA
WP_003899738.1|4314979_4317223_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1	NA	A0A142F150	Bacillus_phage	28.6	7.6e-14
WP_003399865.1|4317378_4319154_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1	NA	A0A1P8DJB2	Virus_Rctr71	26.7	1.4e-07
WP_003399870.1|4319296_4319593_+	type VII secretion system ESX-1 target PE35	NA	NA	NA	NA	NA
WP_003399879.1|4319626_4320733_+	type VII secretion system ESX-1 target PPE68	NA	NA	NA	NA	NA
WP_003399940.1|4320825_4321128_+	type VII secretion system ESX-1 WXG100 family target CFP-10	NA	NA	NA	NA	NA
WP_003399963.1|4321160_4321448_+	type VII secretion system ESX-1 WXG100 family target ESAT-6	NA	A0A2I6AZH7	Macacine_betaherpesvirus	100.0	1.4e-45
WP_003909105.1|4321561_4323562_+	type VII secretion system ESX-1 associated protein EspI	NA	V5UPR8	Mycobacterium_phage	28.8	4.4e-21
>prophage 310
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4332004	4338758	4380156	protease	Mycobacterium_phage(100.0%)	4	NA	NA
WP_003400004.1|4332004_4333345_-|protease	type VII secretion system ESX-1 serine protease mycosin MycP1	protease	V5UPA7	Mycobacterium_phage	41.0	1.4e-79
WP_003400005.1|4333566_4335426_-	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	29.3	2.5e-47
WP_031709332.1|4335495_4337109_-	type VII secretion system ESX-2 subunit EccE2	NA	NA	NA	NA	NA
WP_003400012.1|4337105_4338758_-|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	V5UPA7	Mycobacterium_phage	36.6	1.1e-67
>prophage 311
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4349039	4351438	4380156		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031709335.1|4349039_4350527_-	type VII secretion system ESX-2 subunit EccB2	NA	V5UN45	Mycobacterium_phage	37.2	7.6e-71
WP_003899753.1|4350529_4351438_-	transglycosylase	NA	A0A2H4PIU8	Corynebacterium_phage	46.1	2.4e-11
>prophage 312
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4360222	4361665	4380156	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400120.1|4360222_4361665_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	37.3	7.7e-60
>prophage 313
NZ_CP017598	Mycobacterium tuberculosis strain Beijing-like/1104 chromosome, complete genome	4380156	4370318	4376122	4380156		Orpheovirus(25.0%)	6	NA	NA
WP_003900782.1|4370318_4371326_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.2	1.1e-68
WP_003400164.1|4371322_4371673_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.8	3.9e-26
WP_003400168.1|4371782_4373003_+	hydrolase	NA	Q0H257	Geobacillus_phage	29.2	2.6e-08
WP_003400171.1|4373023_4373758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400175.1|4374047_4375082_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_078387225.1|4375078_4376122_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	1.4e-23
