The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	0	20087	4444417	transposase	Burkholderia_virus(12.5%)	16	NA	NA
WP_087902221.1|1612_2873_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003400271.1|3376_4585_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	38.9	1.5e-64
WP_003899768.1|4604_5762_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003899769.1|5758_6322_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_003917863.1|6564_8592_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.4e-131
WP_003400286.1|8626_11143_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	1.5e-87
WP_031709324.1|11238_12153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400297.1|12879_13017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400307.1|13198_13636_-	cell wall synthesis protein CwsA	NA	NA	NA	NA	NA
WP_003400321.1|13792_14341_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.5e-24
WP_003899772.1|14457_14883_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003400344.1|15038_15320_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003901765.1|15413_16202_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_003400352.1|16238_16937_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.0e-42
WP_003902584.1|16914_18795_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	35.1	8.0e-17
WP_003906262.1|18791_20087_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	28.8	6.7e-15
>prophage 2
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	29655	30513	4444417		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003901769.1|29655_30513_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	54.3	1.4e-21
>prophage 3
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	35600	37916	4444417		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003901773.1|35600_37916_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.5	5.2e-34
>prophage 4
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	45035	47945	4444417	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902585.1|45035_47945_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.6	2.1e-210
>prophage 5
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	51492	52596	4444417		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003400492.1|51492_52596_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.4	1.4e-74
>prophage 6
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	60066	69864	4444417		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_003400534.1|60066_60561_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	73.8	1.4e-58
WP_003400540.1|60602_60857_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003400543.1|60889_61348_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003900797.1|61376_61898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400547.1|61876_64501_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	47.5	4.9e-20
WP_003400548.1|64680_65373_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003400551.1|65389_66448_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	38.5	2.1e-22
WP_003400562.1|67032_68175_+	cellulase CelA	NA	NA	NA	NA	NA
WP_003902591.1|68403_69864_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.6	1.2e-20
>prophage 7
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	79128	80406	4444417		Aeromonas_phage(100.0%)	1	NA	NA
WP_003899799.1|79128_80406_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.2	2.5e-86
>prophage 8
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	98635	100921	4444417		uncultured_virus(100.0%)	1	NA	NA
WP_003899808.1|98635_100921_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	1.9e-84
>prophage 9
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	106210	120228	4444417		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003400792.1|106210_107833_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	3.2e-14
WP_003400793.1|107837_108074_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003400794.1|108055_115594_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	2.2e-81
WP_003900808.1|115768_117754_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003400797.1|117969_120228_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	3.5e-83
>prophage 10
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	123719	128597	4444417		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003899815.1|123719_128597_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	30.1	5.4e-41
>prophage 11
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	132006	141933	4444417		Synechococcus_phage(40.0%)	9	NA	NA
WP_003900811.1|132006_134064_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.6	2.3e-41
WP_003910039.1|134345_135302_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	31.0	1.3e-36
WP_003400839.1|135375_135966_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.1	6.4e-13
WP_003400840.1|135997_136570_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003902603.1|136569_137730_+	D-alpha-D-heptose-7-phosphate kinase hddA	NA	A0A222YW25	Synechococcus_phage	37.4	2.1e-55
WP_003400850.1|138012_138201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400856.1|138323_139079_-	L,D-transpeptidase LdtMt1	NA	NA	NA	NA	NA
WP_003906284.1|139256_140201_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003400858.1|140184_141933_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.7	1.2e-27
>prophage 12
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	154796	155819	4444417		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003400908.1|154796_155819_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	70.3	1.9e-129
>prophage 13
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	159087	162909	4444417		Human_cytomegalovirus(50.0%)	3	NA	NA
WP_003400924.1|159087_159693_+	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	32.5	1.6e-19
WP_003400935.1|160861_161467_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003906289.1|161583_162909_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.2	4.6e-19
>prophage 14
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	175760	177527	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400998.1|175760_177527_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	39.0	1.0e-21
>prophage 15
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	185650	187057	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401047.1|185650_187057_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.5	2.0e-20
>prophage 16
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	190201	194877	4444417		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_003401058.1|190201_191353_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	7.8e-31
WP_003401060.1|191334_191790_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003401063.1|191843_192329_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003401065.1|192342_193035_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899837.1|193212_194877_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.7e-34
>prophage 17
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	223047	223710	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|223047_223710_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 18
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	249993	250656	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|249993_250656_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 19
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	258166	261751	4444417		Bacillus_phage(100.0%)	1	NA	NA
WP_003902618.1|258166_261751_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-44
>prophage 20
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	265807	267799	4444417	protease	Klosneuvirus(100.0%)	1	NA	NA
WP_003401172.1|265807_267799_-|protease	zinc metalloprotease	protease	A0A1V0SHG2	Klosneuvirus	38.5	3.2e-80
>prophage 21
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	284960	285932	4444417		Serratia_phage(100.0%)	1	NA	NA
WP_003401213.1|284960_285932_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A1S6UB31	Serratia_phage	28.9	7.8e-24
>prophage 22
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	291214	295315	4444417		Mycobacterium_phage(100.0%)	4	NA	NA
WP_003900831.1|291214_292123_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	31.4	1.2e-05
WP_003901829.1|292215_293544_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003401230.1|293545_294094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899863.1|294103_295315_+	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	42.4	8.7e-49
>prophage 23
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	330155	332096	4444417		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003401322.1|330155_332096_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.4	9.1e-24
>prophage 24
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	354056	357542	4444417		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003401383.1|354056_354566_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1C9M039	Mycobacterium_phage	74.4	5.9e-23
WP_003401386.1|354630_355824_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_003899884.1|355859_357542_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.6e-24
>prophage 25
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	373514	381012	4444417		Mycobacterium_phage(100.0%)	3	NA	NA
WP_003401463.1|373514_375410_+	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	40.6	3.1e-101
WP_003401472.1|375406_377023_+	type VII secretion system ESX-3 subunit EccB3	NA	V5UN45	Mycobacterium_phage	35.0	5.6e-59
WP_003401478.1|377019_381012_+	type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3	NA	V5UPA0	Mycobacterium_phage	26.3	8.0e-91
>prophage 26
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	385882	387268	4444417	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401528.1|385882_387268_+|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	39.8	6.6e-69
>prophage 27
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	416532	425405	4444417		Acanthocystis_turfacea_Chlorella_virus(20.0%)	10	NA	NA
WP_003401625.1|416532_417303_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-13
WP_003401627.1|417664_418459_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_003401632.1|418507_419176_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003401636.1|419247_419910_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	42.5	2.4e-24
WP_003898399.1|419941_420514_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	74.7	5.0e-79
WP_003898400.1|420619_421951_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	2.7e-67
WP_003401643.1|421939_422611_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_003401648.1|422711_423392_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003902651.1|423398_424088_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003401650.1|424055_425405_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.8	5.0e-13
>prophage 28
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	430017	430884	4444417		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003401670.1|430017_430884_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.6	4.3e-90
>prophage 29
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	451194	454999	4444417		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_003401814.1|451194_453072_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	2.3e-141
WP_003401817.1|453068_453776_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003401821.1|453811_454999_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.7	2.1e-15
>prophage 30
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	466659	467958	4444417		Pandoravirus(100.0%)	1	NA	NA
WP_003401829.1|466659_467958_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	34.6	6.4e-66
>prophage 31
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	482988	483468	4444417		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003401867.1|482988_483468_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.1	3.5e-17
>prophage 32
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	489029	493191	4444417		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003401894.1|489029_489569_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	44.9	4.3e-16
WP_003401897.1|489649_490504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003401905.1|490644_493191_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	1.1e-120
>prophage 33
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	508517	509747	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003898432.1|508517_509747_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.0	2.4e-17
>prophage 34
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	515167	521129	4444417		Catovirus(50.0%)	2	NA	NA
WP_003900921.1|515167_516925_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	9.8e-09
WP_016719657.1|517157_521129_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.8	4.9e-32
>prophage 35
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	526251	528504	4444417		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_003402100.1|526251_528504_-	serine/threonine protein kinase	NA	Q85650	Moloney_murine_sarcoma_virus	26.1	3.0e-10
>prophage 36
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	541890	546510	4444417		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003898445.1|541890_546510_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.5	6.7e-41
>prophage 37
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	549921	550230	4444417		Gordonia_phage(100.0%)	1	NA	NA
WP_003402188.1|549921_550230_+	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	43.5	1.6e-07
>prophage 38
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	553535	555722	4444417		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003402206.1|553535_555722_-	AAA family ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	42.6	1.4e-36
>prophage 39
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	559796	561419	4444417		uncultured_virus(100.0%)	1	NA	NA
WP_003402236.1|559796_561419_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	9.3e-155
>prophage 40
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	583802	585197	4444417		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003402301.1|583802_585197_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.1e-47
>prophage 41
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	591076	592900	4444417		Tupanvirus(100.0%)	2	NA	NA
WP_003900153.1|591076_591937_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.1	1.1e-29
WP_003402323.1|592036_592900_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.9	7.1e-29
>prophage 42
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	610537	612657	4444417		Bacillus_phage(100.0%)	2	NA	NA
WP_003402390.1|610537_611770_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-28
WP_003402393.1|611973_612657_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.0e-42
>prophage 43
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	621247	625944	4444417		Streptococcus_phage(33.33%)	6	NA	NA
WP_003900159.1|621247_622135_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.0	2.3e-22
WP_003402437.1|622275_622512_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003402602.1|622639_622741_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_003402607.1|622818_623949_+	SDR family oxidoreductase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	27.3	2.4e-08
WP_003898486.1|623955_625032_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003402621.1|625035_625944_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.8	4.9e-28
>prophage 44
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	639910	641221	4444417		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003402810.1|639910_641221_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	1.1e-12
>prophage 45
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	652071	653289	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003910801.1|652071_653289_+	AAA family ATPase	NA	V5UPR8	Mycobacterium_phage	32.6	5.7e-32
>prophage 46
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	658496	659537	4444417		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003901872.1|658496_659537_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	9.5e-20
>prophage 47
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	672344	674060	4444417		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003402917.1|672344_674060_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	5.4e-28
>prophage 48
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	690698	699643	4444417		Mycobacterium_phage(25.0%)	8	NA	NA
WP_003402992.1|690698_692117_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	24.3	3.1e-13
WP_003402995.1|692251_692518_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_003402998.1|692543_694622_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	Q8V6N4	Halorubrum_phage	33.5	2.7e-90
WP_031709257.1|694735_696067_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003898507.1|696290_696632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403006.1|696682_696850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403007.1|697099_698491_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.5	2.1e-67
WP_003403008.1|698500_699643_-	CapA family protein	NA	S4VS02	Pandoravirus	50.8	2.1e-92
>prophage 49
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	730281	733258	4444417	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_003403148.1|730281_731043_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	1.7e-34
WP_003403164.1|731099_731411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900184.1|731482_732433_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_003403171.1|732673_733258_+|transposase	IS607-like element IS1536 family transposase	transposase	F9VHY9	Thermus_phage	32.4	7.7e-19
>prophage 50
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	751248	756257	4444417		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003901883.1|751248_752976_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	3.8e-21
WP_003905355.1|752972_756257_-	RecBCD enzyme subunit RecB	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.9	1.4e-08
>prophage 51
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	767541	773861	4444417		Tupanvirus(60.0%)	6	NA	NA
WP_003900195.1|767541_768447_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.0	7.7e-26
WP_003403302.1|768511_769393_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.7	3.3e-29
WP_003905358.1|769540_770404_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.4	2.2e-30
WP_003403310.1|770570_771431_-	mycolic acid methyltransferase MmaA1	NA	A0A2K9L4K8	Tupanvirus	29.1	7.4e-26
WP_003403314.1|771477_772383_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003403317.1|772394_773861_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	32.1	4.8e-33
>prophage 52
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	783293	784373	4444417		Planktothrix_phage(100.0%)	1	NA	NA
WP_003403363.1|783293_784373_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-22
>prophage 53
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	791583	802327	4444417		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_003910996.1|791583_795102_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	21.8	3.9e-33
WP_031709258.1|795146_799097_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	5.5e-52
WP_003900994.1|799093_799468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900995.1|799460_801374_-	neutral ceramidase	NA	NA	NA	NA	NA
WP_003403419.1|801568_802327_+	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	7.9e-16
>prophage 54
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	814263	817790	4444417		Streptococcus_phage(50.0%)	2	NA	NA
WP_003898554.1|814263_816369_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.6	1.0e-60
WP_003403463.1|816599_817790_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.6	3.1e-30
>prophage 55
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	828711	830151	4444417		Catovirus(100.0%)	1	NA	NA
WP_003901900.1|828711_830151_+	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	25.6	5.6e-10
>prophage 56
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	840524	841424	4444417		Microcystis_virus(100.0%)	1	NA	NA
WP_003403610.1|840524_841424_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	29.0	5.0e-17
>prophage 57
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	852275	853256	4444417		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003403698.1|852275_853256_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.0	9.6e-22
>prophage 58
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	857901	858447	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003403726.1|857901_858447_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	35.1	1.3e-15
>prophage 59
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	883260	889689	4444417		Bacillus_phage(50.0%)	8	NA	NA
WP_003403867.1|883260_884004_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.9e-34
WP_003898576.1|884048_885506_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	5.4e-21
WP_003403876.1|885477_885879_-	HIT family protein	NA	NA	NA	NA	NA
WP_003403880.1|885918_886338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403885.1|886350_887478_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.8e-27
WP_003403887.1|887576_888122_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003403890.1|888124_888331_-	ferredoxin	NA	NA	NA	NA	NA
WP_003898577.1|888333_889689_-	cytochrome P450	NA	M1PWN0	Moumouvirus	23.1	2.4e-07
>prophage 60
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	904994	905888	4444417		Mollivirus(100.0%)	1	NA	NA
WP_003403962.1|904994_905888_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	3.2e-40
>prophage 61
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	920697	921958	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|920697_921958_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 62
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	927472	929737	4444417		Microbacterium_phage(100.0%)	1	NA	NA
WP_003404114.1|927472_929737_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
>prophage 63
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	933763	936472	4444417		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003901017.1|933763_935347_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|935377_936472_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
>prophage 64
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	942624	945155	4444417		Bacillus_phage(50.0%)	3	NA	NA
WP_003898599.1|942624_943392_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|943388_944336_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|944378_945155_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
>prophage 65
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	980742	982425	4444417		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003900222.1|980742_982425_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	21.2	2.7e-08
>prophage 66
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	989829	991458	4444417		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_003404428.1|989829_991458_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	1.0e-15
>prophage 67
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	995618	999612	4444417		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_003900223.1|995618_996842_-	resuscitation-promoting factor RpfA	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-98
WP_003404559.1|997289_997568_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003404564.1|997571_998654_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003404566.1|998650_999040_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003404570.1|999204_999612_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	1.1e-08
>prophage 68
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1023918	1024776	4444417		Pandoravirus(100.0%)	1	NA	NA
WP_031651833.1|1023918_1024776_-	adenylate/guanylate cyclase domain-containing protein	NA	S4VR00	Pandoravirus	32.6	2.1e-09
>prophage 69
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1043052	1045446	4444417		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003898639.1|1043052_1045446_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.5	7.0e-26
>prophage 70
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1053408	1060659	4444417	transposase	Vibrio_phage(25.0%)	7	NA	NA
WP_003404749.1|1053408_1055190_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	3.8e-24
WP_003404750.1|1055186_1055444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404754.1|1055532_1056009_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003404756.1|1056005_1056506_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404757.1|1056818_1058138_-|transposase	IS256-like element IS1554 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.6	2.9e-29
WP_003404760.1|1058425_1059007_+|transposase	IS607-like element IS1535 family transposase	transposase	F9VHY9	Thermus_phage	33.5	1.4e-23
WP_003905412.1|1059006_1060659_+|transposase	transposase	transposase	M4I0H6	Staphylococcus_phage	23.6	6.0e-08
>prophage 71
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1069238	1079734	4444417		Tupanvirus(20.0%)	8	NA	NA
WP_003404782.1|1069238_1071233_-	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	27.5	1.5e-13
WP_003898652.1|1071254_1072367_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003898653.1|1072582_1073413_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.9	4.5e-12
WP_003900236.1|1073433_1074558_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	27.0	1.2e-20
WP_003404792.1|1074617_1075634_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003404794.1|1075635_1076541_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003404795.1|1076517_1077339_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	51.5	6.1e-70
WP_003898655.1|1077454_1079734_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.8	5.7e-41
>prophage 72
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1088618	1095370	4444417		Bacillus_phage(50.0%)	7	NA	NA
WP_003404833.1|1088618_1088849_-	mycolyltransferase	NA	A0A2I6B0H1	Macacine_betaherpesvirus	60.4	1.0e-06
WP_003404835.1|1088765_1088960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404838.1|1088964_1089282_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003404859.1|1089578_1091894_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.1	2.4e-119
WP_003404862.1|1091974_1092973_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	41.5	8.3e-13
WP_003898659.1|1093282_1094446_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_003900240.1|1094458_1095370_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	29.9	2.0e-13
>prophage 73
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1098879	1101095	4444417		Synechococcus_phage(50.0%)	2	NA	NA
WP_003898661.1|1098879_1099527_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.5	9.5e-18
WP_003404890.1|1099523_1101095_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	41.0	1.5e-53
>prophage 74
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1110061	1112374	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003404941.1|1110061_1112374_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.7e-91
>prophage 75
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1128152	1128839	4444417		Bacillus_phage(100.0%)	1	NA	NA
WP_003916757.1|1128152_1128839_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	8.2e-36
>prophage 76
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1133133	1133880	4444417		Planktothrix_phage(100.0%)	1	NA	NA
WP_003900248.1|1133133_1133880_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-34
>prophage 77
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1140602	1141523	4444417		Bacillus_phage(100.0%)	1	NA	NA
WP_003405145.1|1140602_1141523_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	4.2e-43
>prophage 78
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1147861	1148479	4444417		Pacmanvirus(100.0%)	1	NA	NA
WP_003898684.1|1147861_1148479_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	3.4e-09
>prophage 79
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1153552	1160510	4444417	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_072433503.1|1153552_1154989_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	6.5e-35
WP_003405180.1|1155044_1156748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405183.1|1156774_1158334_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
WP_003405185.1|1158419_1159214_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003405187.1|1159421_1160510_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
>prophage 80
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1166831	1167812	4444417		Hokovirus(100.0%)	1	NA	NA
WP_003405263.1|1166831_1167812_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
>prophage 81
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1175894	1180438	4444417		Streptococcus_phage(50.0%)	5	NA	NA
WP_003901975.1|1175894_1177184_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.6	1.6e-133
WP_003405293.1|1177188_1177875_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003905434.1|1177891_1178359_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_003405299.1|1178349_1179309_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003905437.1|1179757_1180438_-	response regulator	NA	W8CYM9	Bacillus_phage	30.2	2.1e-23
>prophage 82
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1185054	1190067	4444417		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003405320.1|1185054_1187184_+	potassium-transporting ATPase subunit KdpB	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
WP_003405322.1|1187183_1187753_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003405324.1|1187756_1189286_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003405328.1|1189293_1190067_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
>prophage 83
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1200754	1202002	4444417	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1200754_1202002_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 84
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1208259	1208705	4444417	integrase	Mycobacterium_phage(50.0%)	2	1206550:1206565	1214465:1214480
1206550:1206565	attL	GTGTCCTCGACCAGCG	NA	NA	NA	NA
WP_003905442.1|1208259_1208574_+	hypothetical protein	NA	Q854H9	Mycobacterium_phage	53.6	1.0e-09
WP_072139304.1|1208510_1208705_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1214465:1214480	attR	CGCTGGTCGAGGACAC	NA	NA	NA	NA
>prophage 85
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1212015	1213647	4444417		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003405625.1|1212015_1213647_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.6	8.8e-28
>prophage 86
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1232634	1236151	4444417		Streptococcus_phage(50.0%)	3	NA	NA
WP_003405730.1|1232634_1234029_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.6e-57
WP_003901991.1|1234230_1234953_+	RDD family protein	NA	NA	NA	NA	NA
WP_003405736.1|1234984_1236151_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	34.9	2.5e-24
>prophage 87
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1241512	1242301	4444417		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003903314.1|1241512_1242301_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.0	1.2e-14
>prophage 88
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1251485	1255210	4444417		Aeromonas_phage(50.0%)	3	NA	NA
WP_003405797.1|1251485_1252766_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-86
WP_003405801.1|1252870_1253698_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003405802.1|1253908_1255210_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.2	1.0e-23
>prophage 89
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1263750	1266367	4444417		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_003405840.1|1263750_1264863_-	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	1.9e-29
WP_003405844.1|1264872_1265130_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003405846.1|1265119_1266367_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.3	7.5e-72
>prophage 90
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1271093	1277058	4444417		Mycobacterium_phage(33.33%)	7	NA	NA
WP_003898733.1|1271093_1271792_+	hypothetical protein	NA	A0A0K2FNG4	Mycobacterium_phage	35.7	1.9e-08
WP_003901093.1|1271909_1272095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651777.1|1272021_1272297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003405871.1|1272539_1272863_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003898734.1|1272877_1273738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898735.1|1274613_1276014_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.6	1.2e-62
WP_003405880.1|1276035_1277058_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	53.4	7.0e-92
>prophage 91
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1280838	1282311	4444417		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003898737.1|1280838_1282311_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	1.4e-69
>prophage 92
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1293911	1295173	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1293911_1295173_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 93
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1303419	1304172	4444417		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003405961.1|1303419_1304172_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	3.7e-05
>prophage 94
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1311168	1311882	4444417		Escherichia_phage(100.0%)	1	NA	NA
WP_003406044.1|1311168_1311882_-	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	33.5	4.4e-16
>prophage 95
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1323329	1325006	4444417		Escherichia_phage(100.0%)	1	NA	NA
WP_003406090.1|1323329_1325006_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	1.5e-19
>prophage 96
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1335195	1337766	4444417		Mamastrovirus(100.0%)	1	NA	NA
WP_003406167.1|1335195_1337766_+	FO synthase	NA	A9ZMK9	Mamastrovirus	33.8	3.4e-18
>prophage 97
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1345990	1352248	4444417		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003406192.1|1345990_1352248_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.6	5.7e-27
>prophage 98
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1356797	1357877	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003406195.1|1356797_1357877_-	PE-PPE domain-containing protein	NA	A0A222ZS78	Mycobacterium_phage	36.1	2.4e-18
>prophage 99
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1368059	1369481	4444417		Hepacivirus(100.0%)	1	NA	NA
WP_003905485.1|1368059_1369481_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	31.0	5.8e-28
>prophage 100
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1373622	1374870	4444417	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1373622_1374870_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 101
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1380983	1381547	4444417		Enterococcus_phage(100.0%)	1	NA	NA
WP_003898770.1|1380983_1381547_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	32.1	1.7e-10
>prophage 102
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1394062	1399728	4444417	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003900295.1|1394062_1394998_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.3e-19
WP_003406254.1|1394987_1395626_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911448.1|1395767_1396442_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003406257.1|1396677_1397451_+	ECF RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	9.6e-09
WP_003406258.1|1397608_1398073_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003898779.1|1398141_1399728_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.2	8.6e-12
>prophage 103
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1412951	1414133	4444417		Planktothrix_phage(100.0%)	1	NA	NA
WP_003406299.1|1412951_1414133_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.2	6.6e-25
>prophage 104
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1432132	1434972	4444417		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003898793.1|1432132_1433824_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	4.6e-56
WP_003406347.1|1433820_1434972_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	26.8	3.8e-09
>prophage 105
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1446122	1448003	4444417		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003898799.1|1446122_1448003_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	34.1	6.8e-16
>prophage 106
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1452580	1456221	4444417		Bacillus_phage(100.0%)	2	NA	NA
WP_003406569.1|1452580_1454476_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.4e-55
WP_003406574.1|1454472_1456221_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.7e-42
>prophage 107
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1462232	1467442	4444417		Klosneuvirus(50.0%)	3	NA	NA
WP_003406598.1|1462232_1463819_+	oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	28.0	1.5e-48
WP_003900310.1|1463835_1465611_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_003406602.1|1465603_1467442_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-19
>prophage 108
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1471077	1472922	4444417		Hokovirus(100.0%)	1	NA	NA
WP_003406621.1|1471077_1472922_+	adenylyl-sulfate kinase	NA	A0A1V0SGC3	Hokovirus	25.6	1.1e-34
>prophage 109
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1489670	1490324	4444417		Pandoravirus(100.0%)	1	NA	NA
WP_003898815.1|1489670_1490324_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	2.3e-19
>prophage 110
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1509246	1512937	4444417		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_003406857.1|1509246_1509744_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	5.4e-21
WP_003406860.1|1509740_1511231_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003406864.1|1511311_1512937_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.1	2.5e-14
>prophage 111
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1516300	1518004	4444417		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031709366.1|1516300_1518004_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	2.2e-13
>prophage 112
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1530944	1541937	4444417	protease	Bacillus_phage(20.0%)	13	NA	NA
WP_003901136.1|1530944_1532939_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.2	2.0e-50
WP_003900321.1|1532962_1534309_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	36.3	9.4e-44
WP_003406906.1|1534410_1534716_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003898829.1|1534675_1535332_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003406908.1|1535348_1536383_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_003898830.1|1536390_1536831_+	CysO-cysteine peptidase	NA	NA	NA	NA	NA
WP_003406910.1|1536852_1537134_+	sulfur carrier protein CysO	NA	NA	NA	NA	NA
WP_003406912.1|1537143_1538115_+	O-phosphoserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	37.5	5.9e-48
WP_003898831.1|1538105_1538828_+|protease	rhomboid family intramembrane serine protease	protease	L7RCY0	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-06
WP_003406919.1|1538824_1539640_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003406922.1|1539666_1540488_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003406926.1|1540504_1541284_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003406931.1|1541322_1541937_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	30.5	7.6e-09
>prophage 113
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1546796	1551984	4444417		Bacillus_phage(66.67%)	3	NA	NA
WP_003406958.1|1546796_1549376_+	iron ABC transporter ATP-binding protein/permease IrtA	NA	W8CYL7	Bacillus_phage	26.7	4.8e-28
WP_003900322.1|1549372_1551112_+	iron ABC transporter ATP-binding protein/permease IrtB	NA	W8CYL7	Bacillus_phage	25.3	2.6e-22
WP_003406963.1|1551240_1551984_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	3.6e-05
>prophage 114
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1572139	1573190	4444417		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003407164.1|1572139_1572961_+	GTP pyrophosphokinase family protein	NA	A0A142K822	Mycobacterium_phage	51.1	1.7e-48
WP_003907641.1|1572929_1573190_+	hypothetical protein	NA	A0A142K823	Mycobacterium_phage	60.6	8.7e-15
>prophage 115
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1576406	1577668	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1576406_1577668_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 116
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1598151	1604720	4444417		Abalone_herpesvirus(25.0%)	6	NA	NA
WP_003900331.1|1598151_1598778_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.2	1.1e-15
WP_003407248.1|1598843_1599176_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003898859.1|1599191_1600448_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.7e-37
WP_003900333.1|1600575_1601787_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.4	5.7e-117
WP_003407257.1|1601859_1603338_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003407260.1|1603334_1604720_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.6	2.2e-24
>prophage 117
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1609584	1610547	4444417		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003905554.1|1609584_1610547_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	28.3	2.4e-25
>prophage 118
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1618944	1625904	4444417		Staphylococcus_phage(100.0%)	8	NA	NA
WP_003898867.1|1618944_1619964_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	5.8e-38
WP_003407310.1|1619960_1621517_-	MFS transporter	NA	NA	NA	NA	NA
WP_003407315.1|1621522_1622233_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003407318.1|1622317_1622923_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.1	4.1e-31
WP_071854210.1|1623130_1623652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407330.1|1623641_1624043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407334.1|1624147_1625425_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	5.7e-91
WP_003898872.1|1625421_1625904_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.4	3.6e-14
>prophage 119
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1629729	1631660	4444417		Thermobifida_phage(50.0%)	2	NA	NA
WP_003898873.1|1629729_1630635_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.3e-08
WP_003407352.1|1630631_1631660_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	7.9e-35
>prophage 120
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1634809	1641723	4444417		Mycobacterium_phage(66.67%)	5	NA	NA
WP_003407371.1|1634809_1636072_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	37.4	1.5e-35
WP_003898876.1|1636071_1637679_-	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.6e-27
WP_003407374.1|1637682_1638510_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003407376.1|1638628_1639897_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003407378.1|1640136_1641723_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	40.8	2.9e-28
>prophage 121
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1653543	1655844	4444417		Escherichia_phage(100.0%)	1	NA	NA
WP_003902073.1|1653543_1655844_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	31.6	2.4e-71
>prophage 122
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1659173	1660718	4444417		Synechococcus_phage(100.0%)	1	NA	NA
WP_003407443.1|1659173_1660718_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	35.8	1.5e-74
>prophage 123
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1677460	1687451	4444417		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1677460_1678402_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1678557_1680333_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1680380_1681187_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1681183_1683724_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1683720_1684914_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1684910_1685711_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1685712_1686966_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1686962_1687451_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 124
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1691251	1697836	4444417	transposase	Burkholderia_virus(25.0%)	6	NA	NA
WP_151230898.1|1691251_1692513_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	1.1e-81
WP_003905583.1|1692511_1694488_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1694531_1694906_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1694921_1695293_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1695314_1696172_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1696207_1697836_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 125
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1703970	1704696	4444417		Streptomyces_phage(100.0%)	1	NA	NA
WP_003407525.1|1703970_1704696_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	36.4	6.7e-12
>prophage 126
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1708991	1709735	4444417		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003898892.1|1708991_1709735_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.6e-08
>prophage 127
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1726401	1727430	4444417		Salmonella_phage(100.0%)	1	NA	NA
WP_003407612.1|1726401_1727430_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	32.2	2.6e-33
>prophage 128
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1735416	1741340	4444417		Synechococcus_phage(25.0%)	6	NA	NA
WP_003407628.1|1735416_1735779_+	hypothetical protein	NA	M4QRT5	Synechococcus_phage	60.0	7.2e-07
WP_003407632.1|1735762_1736644_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003901183.1|1736845_1738144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407639.1|1738624_1739647_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.8	4.0e-103
WP_003407642.1|1739643_1740612_+	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	49.7	1.5e-83
WP_003407647.1|1740608_1741340_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	28.0	2.1e-05
>prophage 129
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1747852	1749604	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003901187.1|1747852_1749604_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.8	8.3e-08
>prophage 130
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1754276	1757611	4444417		Shahe_endorna-like_virus(100.0%)	3	NA	NA
WP_003407671.1|1754276_1755521_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	37.5	2.5e-06
WP_003407672.1|1755567_1756353_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003407676.1|1756330_1757611_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	7.4e-06
>prophage 131
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1772069	1775195	4444417	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003407714.1|1772069_1775195_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.2	1.0e-162
>prophage 132
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1783244	1790983	4444417		Saccharomonospora_phage(50.0%)	4	NA	NA
WP_003407751.1|1783244_1786799_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	60.2	0.0e+00
WP_003903497.1|1786847_1788884_-	PPE family protein	NA	NA	NA	NA	NA
WP_024742859.1|1789040_1789589_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_003917498.1|1789594_1790983_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.1e-39
>prophage 133
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1807190	1812256	4444417		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003407794.1|1807190_1809380_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.4	2.3e-23
WP_003407798.1|1809478_1810171_-	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	36.5	4.3e-08
WP_003407802.1|1810410_1810695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407803.1|1810942_1812256_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.2e-13
>prophage 134
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1827199	1828342	4444417		Faustovirus(100.0%)	1	NA	NA
WP_003407947.1|1827199_1828342_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.7e-17
>prophage 135
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1836543	1837362	4444417		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003407990.1|1836543_1837362_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.1	8.0e-30
>prophage 136
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1854483	1859683	4444417		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_003408045.1|1854483_1855101_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.0	3.9e-05
WP_003408054.1|1855168_1856377_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003408058.1|1856373_1856865_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_003901211.1|1856968_1859683_+	DNA polymerase I	NA	A0A060AFQ3	Listeria_phage	30.6	2.5e-43
>prophage 137
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1869201	1879182	4444417	tRNA	Mycobacterium_phage(25.0%)	6	NA	NA
WP_078387219.1|1869201_1869996_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	67.4	6.2e-11
WP_003408092.1|1870044_1872963_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	7.0e-294
WP_003408096.1|1873019_1873277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408099.1|1873292_1874762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003905614.1|1874820_1878339_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	35.8	9.6e-72
WP_003901217.1|1878576_1879182_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	35.3	9.5e-12
>prophage 138
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1885036	1886062	4444417	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003901219.1|1885036_1886062_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	5.1e-26
>prophage 139
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1895047	1896250	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003408163.1|1895047_1896250_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	28.2	8.7e-17
>prophage 140
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1901628	1912837	4444417		Paenibacillus_phage(100.0%)	2	NA	NA
WP_003902218.1|1901628_1908009_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	1.9e-25
WP_003902217.1|1908028_1912837_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.6	4.1e-25
>prophage 141
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1919901	1921677	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003408257.1|1919901_1921677_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.1e-39
>prophage 142
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1938487	1941211	4444417	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_003898975.1|1938487_1939255_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.9e-21
WP_003408373.1|1939313_1939925_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003408375.1|1939936_1941211_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.2	8.0e-61
>prophage 143
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1950163	1953472	4444417		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003408396.1|1950163_1951924_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	1.4e-127
WP_003408399.1|1951916_1952540_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003408401.1|1952536_1953472_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.7e-20
>prophage 144
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1962694	1965176	4444417		Natrialba_phage(50.0%)	3	NA	NA
WP_003898982.1|1962694_1963651_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.4	1.9e-22
WP_003408432.1|1963647_1964484_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003408436.1|1964480_1965176_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.2	2.5e-08
>prophage 145
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1978186	1980969	4444417		Pandoravirus(50.0%)	3	NA	NA
WP_003900395.1|1978186_1979572_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1979604_1980174_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1980198_1980969_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
>prophage 146
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1986338	1986971	4444417		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003408506.1|1986338_1986971_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
>prophage 147
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	1995487	2002711	4444417		Tupanvirus(33.33%)	5	NA	NA
WP_003898998.1|1995487_1997188_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1997472_1997874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1997863_1998475_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1998621_2000052_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|2000113_2002711_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
>prophage 148
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2013623	2015695	4444417	integrase,transposase	Burkholderia_virus(100.0%)	2	2004095:2004110	2018411:2018426
2004095:2004110	attL	AACCCGCCGTCGCCGC	NA	NA	NA	NA
WP_087902221.1|2013623_2014885_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|2015455_2015695_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
2018411:2018426	attR	GCGGCGACGGCGGGTT	NA	NA	NA	NA
>prophage 149
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2034052	2039745	4444417		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003899021.1|2034052_2035573_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2035569_2039745_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
>prophage 150
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2050041	2057733	4444417	protease	Mycobacterium_phage(100.0%)	5	NA	NA
WP_003408854.1|2050041_2051799_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
WP_003408859.1|2051795_2053016_+	type VII secretion system ESX-5 subunit EccE5	NA	NA	NA	NA	NA
WP_003408868.1|2053012_2054845_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	31.0	3.1e-66
WP_003899024.1|2055471_2055663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901256.1|2055765_2057733_+	PPE family protein PPE28	NA	A0A222ZKN7	Mycobacterium_phage	31.7	2.2e-17
>prophage 151
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2069755	2070460	4444417		Bacillus_virus(100.0%)	1	NA	NA
WP_003899032.1|2069755_2070460_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	3.8e-12
>prophage 152
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2079130	2081050	4444417		Bacillus_virus(100.0%)	1	NA	NA
WP_031709287.1|2079130_2081050_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.2	1.1e-05
>prophage 153
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2092142	2094968	4444417		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003900418.1|2092142_2094968_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	3.0e-257
>prophage 154
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2108524	2111448	4444417		Klosneuvirus(50.0%)	2	NA	NA
WP_003900420.1|2108524_2109961_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.1	3.1e-45
WP_025234866.1|2109996_2111448_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.6	6.6e-35
>prophage 155
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2122833	2126845	4444417		Planktothrix_phage(50.0%)	4	NA	NA
WP_003899051.1|2122833_2123943_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.0e-19
WP_003409337.1|2123995_2124973_+	alanine and proline-rich secreted protein Apa	NA	NA	NA	NA	NA
WP_003409339.1|2125424_2125730_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003409345.1|2125804_2126845_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.9	1.6e-19
>prophage 156
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2139434	2144228	4444417		Bodo_saltans_virus(50.0%)	6	NA	NA
WP_003409385.1|2139434_2139872_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	39.8	5.6e-14
WP_003904723.1|2139944_2140631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899059.1|2140641_2141085_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003910872.1|2141090_2141303_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003409398.1|2141600_2142080_+	bacterioferritin BfrA	NA	NA	NA	NA	NA
WP_003899060.1|2142164_2144228_+	MFS-type transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	3.2e-19
>prophage 157
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2150006	2152143	4444417		Macacine_betaherpesvirus(100.0%)	3	NA	NA
WP_003409420.1|2150006_2150537_-	resuscitation-promoting factor RpfC	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	2.7e-95
WP_003899064.1|2150548_2151148_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003409456.1|2151165_2152143_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	99.7	1.1e-190
>prophage 158
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2161499	2166605	4444417		Scale_drop_disease_virus(33.33%)	4	NA	NA
WP_003899068.1|2161499_2162576_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	32.5	3.9e-08
WP_003409539.1|2162575_2163964_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_003900426.1|2163992_2165285_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	9.7e-14
WP_031709290.1|2165336_2166605_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	1.8e-12
>prophage 159
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2183134	2184396	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2183134_2184396_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 160
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2192810	2193926	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003409667.1|2192810_2193926_+	lipoprotein	NA	S5Z991	Mycobacterium_phage	29.7	1.9e-18
>prophage 161
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2199193	2199961	4444417		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003409686.1|2199193_2199961_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	1.9e-17
>prophage 162
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2207239	2212411	4444417		Synechococcus_phage(50.0%)	4	NA	NA
WP_003409714.1|2207239_2209759_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	34.9	7.7e-07
WP_003902252.1|2209770_2210841_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003409718.1|2210837_2211353_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003899092.1|2211349_2212411_+	riboflavin biosynthesis protein RibA	NA	A0A2H4PQS2	Staphylococcus_phage	33.9	3.1e-34
>prophage 163
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2247458	2248427	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899116.1|2247458_2248427_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.2	2.2e-127
>prophage 164
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2258229	2260545	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899120.1|2258229_2260545_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
>prophage 165
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2270897	2271680	4444417		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003410047.1|2270897_2271680_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
>prophage 166
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2286907	2289634	4444417	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_087902221.1|2286907_2288169_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003918359.1|2288246_2288597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410103.1|2288593_2289634_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
>prophage 167
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2293935	2299836	4444417		Gordonia_phage(50.0%)	2	NA	NA
WP_003410136.1|2293935_2294832_-	hypothetical protein	NA	A0A1B3AYM4	Gordonia_phage	34.7	1.8e-35
WP_003900451.1|2295015_2299836_-	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	23.0	6.4e-34
>prophage 168
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2306035	2308527	4444417		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003410178.1|2306035_2308081_-	hypothetical protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	26.5	3.7e-07
WP_003410189.1|2308092_2308527_-	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	35.0	3.3e-06
>prophage 169
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2312341	2314391	4444417		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003410214.1|2312341_2313316_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.5	6.6e-15
WP_003410218.1|2313317_2314391_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.5e-23
>prophage 170
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2319281	2320817	4444417		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_003899145.1|2319281_2320817_-	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	31.9	3.6e-15
>prophage 171
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2337727	2340352	4444417		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_003902238.1|2337727_2340352_-	apolipoprotein N-acyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.3	1.0e-25
>prophage 172
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2355482	2356406	4444417		Salmonella_phage(100.0%)	1	NA	NA
WP_003410677.1|2355482_2356406_-	class A beta-lactamase BlaA	NA	A0A1B0VBP7	Salmonella_phage	42.2	2.7e-50
>prophage 173
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2362919	2363891	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899159.1|2362919_2363891_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	34.9	1.3e-15
>prophage 174
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2374020	2381550	4444417		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003905749.1|2374020_2375790_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.4	6.4e-16
WP_003905750.1|2375806_2376934_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011799244.1|2376982_2378050_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.8	6.1e-14
WP_003410762.1|2378053_2378788_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_003899167.1|2378829_2381550_-	RNA helicase	NA	M1HCW4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.3e-71
>prophage 175
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2389801	2396410	4444417	transposase	Yellowstone_lake_phycodnavirus(50.0%)	6	NA	NA
WP_003899171.1|2389801_2392843_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.3	1.0e-37
WP_003899172.1|2392835_2393669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003905754.1|2393647_2394082_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003410814.1|2394088_2394343_-	antitoxin	NA	NA	NA	NA	NA
WP_003410816.1|2394358_2394616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2395149_2396410_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 176
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2404078	2405908	4444417		Lymphocystis_disease_virus(100.0%)	1	NA	NA
WP_003411035.1|2404078_2405908_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	39.1	3.5e-33
>prophage 177
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2420831	2422076	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003411091.1|2420831_2422076_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	35.5	1.1e-30
>prophage 178
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2466202	2470579	4444417	transposase	Pandoravirus(50.0%)	5	NA	NA
WP_003899202.1|2466202_2467402_+	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	30.0	8.7e-17
WP_003899203.1|2467543_2468209_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003905774.1|2468142_2468325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411323.1|2468593_2469982_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_003411331.1|2470072_2470579_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A142UMD2	Mycobacterium_phage	44.0	1.9e-26
>prophage 179
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2476421	2485005	4444417		Catovirus(25.0%)	7	NA	NA
WP_003901348.1|2476421_2478224_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.1e-50
WP_003411369.1|2478254_2479412_-	GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase	NA	NA	NA	NA	NA
WP_003411371.1|2479508_2480282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411373.1|2480376_2481534_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.6	2.0e-18
WP_003411376.1|2481719_2481971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901350.1|2482080_2484018_+	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	33.9	9.4e-13
WP_003411387.1|2483892_2485005_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	8.6e-43
>prophage 180
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2493201	2495160	4444417		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003411413.1|2493201_2495160_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	28.2	7.3e-21
>prophage 181
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2506542	2509906	4444417		Mycoplasma_phage(50.0%)	2	NA	NA
WP_003899220.1|2506542_2508090_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	8.6e-33
WP_003411445.1|2508127_2509906_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	25.9	1.4e-07
>prophage 182
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2529848	2530943	4444417		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003899226.1|2529848_2530943_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	33.3	1.1e-05
>prophage 183
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2560398	2561484	4444417		Synechococcus_phage(100.0%)	1	NA	NA
WP_003899236.1|2560398_2561484_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.2	2.5e-31
>prophage 184
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2574325	2575195	4444417	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003411681.1|2574325_2575195_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	26.1	2.4e-08
>prophage 185
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2579257	2580916	4444417		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_045245504.1|2579257_2580916_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
>prophage 186
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2596145	2598089	4444417		Catovirus(100.0%)	1	NA	NA
WP_003411855.1|2596145_2598089_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.2	1.0e-107
>prophage 187
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2605590	2609866	4444417	integrase	Mycobacterium_phage(66.67%)	7	2599976:2599989	2611295:2611308
2599976:2599989	attL	TCGAGGTGCGCTCC	NA	NA	NA	NA
WP_003899265.1|2605590_2606022_-	hypothetical protein	NA	A0A076GDT8	Mycobacterium_phage	47.1	2.0e-16
WP_003902166.1|2606114_2606297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902167.1|2606505_2607222_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_003411888.1|2607231_2607564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899267.1|2607929_2608385_-|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	47.2	3.6e-24
WP_003902168.1|2609131_2609419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411901.1|2609521_2609866_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.3	7.3e-09
2611295:2611308	attR	GGAGCGCACCTCGA	NA	NA	NA	NA
>prophage 188
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2624892	2626986	4444417		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003411969.1|2624892_2626986_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	1.6e-05
>prophage 189
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2635834	2636767	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899275.1|2635834_2636767_+	O-acetylserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	53.4	2.4e-83
>prophage 190
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2647570	2649490	4444417		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_003412049.1|2647570_2649490_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	30.3	1.4e-32
>prophage 191
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2661138	2662399	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2661138_2662399_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 192
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2667539	2671335	4444417	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_003412200.1|2667539_2668931_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.4	7.7e-49
WP_003412205.1|2669112_2669520_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003899290.1|2669516_2669909_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003412208.1|2670016_2670445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003412212.1|2670444_2671335_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	38.3	1.0e-17
>prophage 193
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2676782	2681854	4444417		Pseudomonas_phage(50.0%)	6	NA	NA
WP_003412235.1|2676782_2677841_-	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.1e-47
WP_003902257.1|2677812_2678115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899293.1|2678111_2679425_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003901386.1|2679517_2679805_+	PE family protein	NA	NA	NA	NA	NA
WP_003900509.1|2679903_2680692_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003899294.1|2680705_2681854_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	1.0e-22
>prophage 194
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2685566	2695129	4444417		Tupanvirus(100.0%)	2	NA	NA
WP_003412267.1|2685566_2689952_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	1.8e-51
WP_003899297.1|2689933_2695129_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-82
>prophage 195
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2699459	2703704	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003902259.1|2699459_2703704_-	phenyloxazoline synthase MbtB	NA	A0A2K9KZV5	Tupanvirus	26.1	2.3e-43
>prophage 196
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2711114	2711579	4444417		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003412293.1|2711114_2711579_-	resuscitation-promoting factor RpfD	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-83
>prophage 197
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2721775	2722831	4444417		Bacillus_virus(100.0%)	1	NA	NA
WP_003412325.1|2721775_2722831_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	1.3e-29
>prophage 198
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2729153	2731115	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003900516.1|2729153_2731115_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	8.6e-22
>prophage 199
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2752096	2753344	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412516.1|2752096_2753344_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	3.3e-91
>prophage 200
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2764768	2765899	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412568.1|2764768_2765899_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.8e-51
>prophage 201
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2772965	2779832	4444417	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003412592.1|2772965_2773376_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	2.6e-29
WP_003412596.1|2773418_2773790_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003899324.1|2773786_2775250_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003899325.1|2775246_2777877_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	7.0e-144
WP_003412609.1|2777964_2779224_-	enoyl reductase	NA	NA	NA	NA	NA
WP_003905853.1|2779313_2779832_-	resuscitation-promoting factor rpfE	NA	A0A1J0GVU2	Streptomyces_phage	82.9	2.5e-29
>prophage 202
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2785859	2787140	4444417	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_003412634.1|2785859_2787140_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	4.2e-142
>prophage 203
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2790182	2791426	4444417	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003412648.1|2790182_2790827_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	31.4	5.2e-08
WP_003412650.1|2790823_2791426_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	1.2e-38
>prophage 204
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2794510	2800687	4444417		Bacillus_phage(33.33%)	7	NA	NA
WP_003412657.1|2794510_2795317_-	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	28.9	6.5e-08
WP_003899332.1|2795322_2795811_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_003412664.1|2795912_2796536_-	Rv2466c family mycothiol-dependent reductase	NA	NA	NA	NA	NA
WP_003412666.1|2796637_2799223_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.2	3.6e-44
WP_003412669.1|2799295_2799799_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003412671.1|2799749_2799983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899334.1|2800018_2800687_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.2	1.2e-18
>prophage 205
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2810017	2812281	4444417		Tupanvirus(50.0%)	2	NA	NA
WP_003412708.1|2810017_2811694_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.4e-44
WP_003900529.1|2811774_2812281_-	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	31.2	1.4e-08
>prophage 206
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2819016	2820282	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003902276.1|2819016_2820282_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	38.8	2.0e-35
>prophage 207
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2843177	2847889	4444417		Pike_perch_iridovirus(50.0%)	4	NA	NA
WP_003905871.1|2843177_2844767_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
WP_003412782.1|2844763_2845420_-	succinyl-CoA--3-ketoacid CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003412786.1|2845416_2846163_-	succinyl-CoA--3-ketoacid CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003899357.1|2846245_2847889_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	2.1e-29
>prophage 208
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2851780	2856096	4444417	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2851780_2853382_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2853449_2854097_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2854848_2856096_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 209
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2876144	2876867	4444417		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003412957.1|2876144_2876867_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	50.7	4.1e-54
>prophage 210
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2889494	2890700	4444417		Pandoravirus(100.0%)	1	NA	NA
WP_003413027.1|2889494_2890700_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.9	1.6e-47
>prophage 211
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2900058	2906217	4444417	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_003902305.1|2900058_2902773_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.5	4.8e-63
WP_003413208.1|2902863_2903253_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_003899374.1|2903359_2904034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413213.1|2904118_2904829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899376.1|2904858_2906217_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.8e-80
>prophage 212
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2909628	2910621	4444417		Planktothrix_phage(100.0%)	1	NA	NA
WP_003901426.1|2909628_2910621_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	9.4e-33
>prophage 213
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2925625	2926507	4444417		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003899384.1|2925625_2926507_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	48.0	3.2e-53
>prophage 214
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2929925	2950520	4444417	tRNA	Klosneuvirus(22.22%)	14	NA	NA
WP_003413363.1|2929925_2930828_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.0	4.2e-56
WP_003413365.1|2931107_2932379_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	23.1	4.0e-12
WP_003413366.1|2932375_2933050_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.3	6.8e-19
WP_003413367.1|2933100_2934027_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	34.2	2.3e-09
WP_003413368.1|2934112_2936485_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_003413369.1|2936515_2937187_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	32.2	3.1e-11
WP_003413373.1|2937290_2938964_-	lipoprotein	NA	NA	NA	NA	NA
WP_003899387.1|2938969_2940298_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.7	2.9e-21
WP_003413385.1|2940301_2942023_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003413391.1|2942132_2942480_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003413395.1|2942646_2943996_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	5.0e-21
WP_003413409.1|2944157_2947664_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.6	3.9e-17
WP_009940036.1|2947837_2949469_+	PE family protein	NA	NA	NA	NA	NA
WP_003413416.1|2949485_2950520_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	7.0e-07
>prophage 215
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2954674	2956246	4444417		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003899392.1|2954674_2956246_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.2	5.1e-09
>prophage 216
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	2967475	3005747	4444417	head,tRNA,integrase,capsid,terminase,protease	Mycobacterium_phage(30.0%)	48	2996276:2996303	3005900:3005927
WP_003413486.1|2967475_2969554_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2969662_2969890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2969886_2971272_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2971616_2972117_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2972133_2972574_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2972720_2973398_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2973382_2973736_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2973748_2974174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2974170_2974845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2974922_2975744_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2975879_2976773_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2976775_2977594_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2977608_2978790_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2978848_2979280_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2979793_2981035_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2981344_2981707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2982053_2983178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2983179_2983719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2983858_2985157_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2985195_2985477_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2985621_2986107_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2986133_2986391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2986391_2988728_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2988756_2988999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2988999_2989677_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2989872_2990529_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2990691_2991138_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2991312_2991645_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2991764_2992124_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2992225_2992684_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2992819_2993200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2993196_2994693_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2994882_2995119_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2995191_2995365_+	hypothetical protein	NA	NA	NA	NA	NA
2996276:2996303	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2996409_2996841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2996837_2997836_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2997849_2998314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2998301_2998553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2998723_3000163_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|3000170_3000704_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|3000856_3001483_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|3001514_3001838_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|3001917_3002163_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|3002159_3003587_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|3003588_3003981_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|3003977_3004238_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|3004254_3004617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|3004619_3005747_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
3005900:3005927	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 217
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3008824	3009583	4444417	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003413845.1|3008824_3009583_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
>prophage 218
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3017617	3018976	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003413871.1|3017617_3018976_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	37.4	2.4e-07
>prophage 219
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3029932	3030838	4444417		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003413913.1|3029932_3030838_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.2e-13
>prophage 220
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3038760	3039225	4444417		Streptomyces_phage(100.0%)	1	NA	NA
WP_003413930.1|3038760_3039225_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	47.6	9.4e-28
>prophage 221
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3042912	3061171	4444417		Cyanophage(28.57%)	21	NA	NA
WP_003413944.1|3042912_3044499_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	4.6e-42
WP_003899440.1|3044535_3044964_+	RidA family protein	NA	NA	NA	NA	NA
WP_003413947.1|3044891_3045281_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003902340.1|3045277_3045535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413953.1|3045650_3046625_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003899441.1|3046625_3046874_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	47.5	8.3e-15
WP_003910933.1|3046916_3047354_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_003413958.1|3047529_3048501_+	RNA polymerase sigma factor SigB	NA	M4SMP8	Cyanophage	35.7	6.6e-39
WP_003413962.1|3048633_3049326_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003905914.1|3049338_3050397_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003900556.1|3050509_3051916_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.4e-42
WP_003901455.1|3052133_3053108_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003900558.1|3053166_3054192_+	alpha/beta hydrolase	NA	G1DAB1	Mycobacterium_virus	30.0	9.7e-17
WP_003413971.1|3054240_3054927_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003900559.1|3054935_3055430_-	FABP family protein	NA	NA	NA	NA	NA
WP_003413973.1|3055481_3055946_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003413974.1|3056108_3056606_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899448.1|3056856_3057567_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	8.0e-10
WP_003900560.1|3057588_3059688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902343.1|3059703_3059952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413979.1|3059977_3061171_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	33.3	8.4e-28
>prophage 222
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3071889	3076493	4444417		Mycobacterium_phage(66.67%)	4	NA	NA
WP_003899455.1|3071889_3072744_+	DUF5131 family protein	NA	A0A088F7U1	Mycobacterium_phage	48.6	1.8e-64
WP_003899456.1|3072628_3073621_-	three-Cys-motif partner protein TcmP	NA	A0A142KCL9	Gordonia_phage	60.3	3.0e-108
WP_003905919.1|3073630_3074155_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003414006.1|3074120_3076493_-	intein-containing recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	50.0	5.2e-21
>prophage 223
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3084923	3087575	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414040.1|3084923_3087575_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	57.9	4.2e-112
>prophage 224
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3092261	3095152	4444417		Rhodococcus_phage(50.0%)	3	NA	NA
WP_003899465.1|3092261_3093014_-	FAD-dependent thymidylate synthase	NA	M9MU99	Rhodococcus_phage	47.4	4.9e-50
WP_003414055.1|3093257_3093533_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003414057.1|3093529_3095152_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	5.9e-08
>prophage 225
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3098198	3099549	4444417		Ralstonia_phage(50.0%)	2	NA	NA
WP_003414073.1|3098198_3098678_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	38.6	6.8e-21
WP_003911953.1|3098748_3099549_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	70.5	2.2e-109
>prophage 226
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3114113	3115430	4444417		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_003414119.1|3114113_3115430_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	24.4	5.4e-28
>prophage 227
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3125270	3127231	4444417	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003899482.1|3125270_3126650_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3126649_3127231_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
>prophage 228
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3145358	3146619	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3145358_3146619_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 229
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3156838	3157921	4444417		Bacillus_virus(100.0%)	1	NA	NA
WP_003414499.1|3156838_3157921_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
>prophage 230
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3163910	3166613	4444417		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003899505.1|3163910_3166613_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
>prophage 231
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3171778	3173371	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414532.1|3171778_3173371_-	multidrug efflux MFS transporter EfpA	NA	A0A0M3UL24	Mycobacterium_phage	33.0	7.7e-45
>prophage 232
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3183945	3190387	4444417		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_003414557.1|3183945_3185325_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.1e-34
WP_003414559.1|3185424_3186543_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003414562.1|3186608_3186941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414566.1|3186952_3187168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099171521.1|3187088_3187271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414570.1|3187323_3188100_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.0e-15
WP_003900585.1|3188096_3189464_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003900586.1|3189460_3190387_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	32.5	4.2e-11
>prophage 233
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3213021	3215225	4444417	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003901487.1|3213021_3214341_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	29.4	4.1e-28
WP_003899526.1|3214337_3215225_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	27.3	2.6e-10
>prophage 234
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3222186	3223083	4444417		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003414689.1|3222186_3223083_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.9	3.1e-19
>prophage 235
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3230954	3231749	4444417		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003414713.1|3230954_3231749_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	26.9	7.1e-07
>prophage 236
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3237130	3253379	4444417		Erythrobacter_phage(20.0%)	11	NA	NA
WP_023644660.1|3237130_3238006_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	4.4e-10
WP_003414739.1|3238065_3238653_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899536.1|3238654_3240490_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003900593.1|3240558_3242316_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	23.4	1.3e-05
WP_003899537.1|3242359_3243472_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003414748.1|3243499_3245077_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003414750.1|3245154_3247035_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	41.0	3.9e-88
WP_003899539.1|3247045_3249472_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003414756.1|3249529_3249868_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003899540.1|3249864_3251298_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.8	1.4e-40
WP_003899541.1|3252110_3253379_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.5	1.5e-11
>prophage 237
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3257837	3259788	4444417		Bacillus_phage(50.0%)	2	NA	NA
WP_003414814.1|3257837_3258707_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	25.1	1.1e-13
WP_003414820.1|3259065_3259788_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.4	1.9e-22
>prophage 238
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3264681	3286967	4444417		Paenibacillus_phage(100.0%)	5	NA	NA
WP_141768914.1|3264681_3267897_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	29.8	1.6e-28
WP_072496070.1|3267779_3270311_+	KR domain-containing protein	NA	NA	NA	NA	NA
WP_003899547.1|3270307_3274924_+	phthiocerol type I polyketide synthase PpsB	NA	D0R7J2	Paenibacillus_phage	36.3	1.1e-32
WP_003414837.1|3274920_3281487_+	phthiocerol type I polyketide synthase PpsC	NA	D0R7J2	Paenibacillus_phage	34.6	1.6e-32
WP_003899549.1|3281483_3286967_+	phthiocerol type I polyketide synthase PpsD	NA	D0R7J2	Paenibacillus_phage	31.6	3.7e-30
>prophage 239
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3291449	3292445	4444417		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003901496.1|3291449_3292445_+	daunorubicin ABC transporter permease DrrB	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	1.5e-22
>prophage 240
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3295615	3301951	4444417		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003901497.1|3295615_3301951_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.3	9.9e-27
>prophage 241
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3326822	3328642	4444417		uncultured_virus(50.0%)	2	NA	NA
WP_003414906.1|3326822_3327788_-	[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha- L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L- rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase	NA	A0A218MM68	uncultured_virus	25.5	1.5e-06
WP_003899556.1|3327910_3328642_+	[alpha-L-fucopyranosyl-(1->3)-alpha-L- rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase	NA	Q58M88	Prochlorococcus_phage	33.3	1.3e-07
>prophage 242
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3335771	3338058	4444417		Synechococcus_phage(50.0%)	3	NA	NA
WP_003901503.1|3335771_3336704_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	2.1e-10
WP_003414994.1|3337343_3337529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414998.1|3337572_3338058_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	9.3e-18
>prophage 243
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3343815	3346192	4444417		Moumouvirus(50.0%)	2	NA	NA
WP_003415015.1|3343815_3344946_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	5.0e-30
WP_003415022.1|3345343_3346192_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	1.0e-56
>prophage 244
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3351311	3354989	4444417	transposase	Pandoravirus(33.33%)	4	NA	NA
WP_003899565.1|3351311_3351995_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	40.7	3.8e-33
WP_003415034.1|3352027_3353029_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_003415037.1|3353025_3354405_-	resolvase	NA	I4AZM3	Saccharomonospora_phage	32.9	2.3e-21
WP_003415039.1|3354404_3354989_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	29.9	1.1e-17
>prophage 245
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3362531	3363176	4444417		Streptomyces_phage(100.0%)	1	NA	NA
WP_003415107.1|3362531_3363176_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	2.8e-14
>prophage 246
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3372838	3374425	4444417		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003899578.1|3372838_3374425_-	D-3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.5	1.2e-34
>prophage 247
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3377967	3382342	4444417		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003415160.1|3377967_3378627_+	ABC transporter permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.2	6.9e-08
WP_003899581.1|3378940_3379942_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003415167.1|3379979_3380486_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003415168.1|3380485_3382342_-	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.3	9.6e-55
>prophage 248
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3388178	3393976	4444417	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003415251.1|3388178_3389210_-	ATP-dependent 6-phosphofructokinase	NA	E5EQL4	Micromonas_sp._RCC1109_virus	24.2	2.3e-13
WP_003900613.1|3389305_3390790_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003415256.1|3390786_3391086_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003901515.1|3391170_3391827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003415263.1|3391900_3393976_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	8.3e-108
>prophage 249
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3397960	3405307	4444417	transposase,tRNA	Burkholderia_virus(33.33%)	7	NA	NA
WP_087902221.1|3397960_3399221_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003415342.1|3399275_3399569_-	type VII secretion system protein EsxS	NA	NA	NA	NA	NA
WP_003910692.1|3399615_3400923_-	PPE family protein	NA	NA	NA	NA	NA
WP_003415766.1|3400919_3401234_-	PE family protein	NA	NA	NA	NA	NA
WP_003901078.1|3401615_3402863_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003415909.1|3403025_3404129_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003415911.1|3404125_3405307_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.6	1.4e-30
>prophage 250
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3421295	3422159	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003415944.1|3421295_3422159_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.7e-07
>prophage 251
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3426525	3438889	4444417		Mycobacterium_phage(28.57%)	13	NA	NA
WP_003415965.1|3426525_3427566_+	NADP-dependent alcohol dehydrogenase C	NA	A0A2K9L7I1	Tupanvirus	41.2	3.7e-72
WP_003415968.1|3427554_3427929_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003902400.1|3428262_3428547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003415973.1|3428644_3429619_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	85.3	8.0e-154
WP_003899895.1|3429749_3431324_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003415979.1|3431457_3432198_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078387223.1|3432325_3434503_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.8e-209
WP_003415981.1|3434472_3434925_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003415982.1|3434959_3435199_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	68.0	3.4e-21
WP_003415983.1|3435661_3436216_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	4.0e-09
WP_003415984.1|3436307_3436922_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899898.1|3436931_3437972_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	31.8	7.1e-15
WP_003415986.1|3438025_3438889_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	2.2e-06
>prophage 252
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3459835	3466283	4444417		Tupanvirus(50.0%)	4	NA	NA
WP_003901535.1|3459835_3461647_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	34.8	9.6e-84
WP_003416059.1|3461647_3462049_+	hydrogenase	NA	NA	NA	NA	NA
WP_003416061.1|3462064_3462892_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003899905.1|3462950_3466283_-	serine/threonine-protein kinase PknK	NA	A0A1M7XTW9	Cedratvirus	28.0	3.0e-14
>prophage 253
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3472075	3479393	4444417		Synechococcus_phage(33.33%)	5	NA	NA
WP_003416075.1|3472075_3473182_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-27
WP_003416076.1|3473219_3474638_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416079.1|3474634_3476059_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416081.1|3476055_3477567_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	5.6e-45
WP_003416086.1|3478505_3479393_+	SPFH domain-containing protein	NA	A0A0M4RAA7	Mycobacterium_phage	50.5	2.8e-68
>prophage 254
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3489595	3491664	4444417		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003416113.1|3489595_3490078_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	1.5e-31
WP_003416117.1|3490080_3490974_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003416120.1|3490974_3491664_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.7	2.5e-32
>prophage 255
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3501054	3504241	4444417	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_003901545.1|3501054_3501585_+	nucleoside deaminase	NA	A0A2I7QX61	Vibrio_phage	39.0	5.8e-05
WP_003904994.1|3501603_3501747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901078.1|3501746_3502994_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003899922.1|3503071_3504241_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.1	1.6e-10
>prophage 256
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3514248	3515510	4444417	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3514248_3515510_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 257
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3564035	3564935	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003416610.1|3564035_3564935_-	alpha/beta hydrolase	NA	A0A1C9LZ53	Mycobacterium_phage	31.1	9.8e-05
>prophage 258
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3569636	3574693	4444417	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_003416628.1|3569636_3570497_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	28.6	7.4e-10
WP_071854247.1|3570591_3570987_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003416635.1|3571226_3571520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416640.1|3571807_3573097_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087902221.1|3573431_3574693_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 259
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3580142	3581177	4444417	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003416786.1|3580142_3581177_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.3	7.0e-31
>prophage 260
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3591940	3599868	4444417		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_003416822.1|3591940_3594043_-	ATP-dependent DNA helicase UvrD2	NA	A0A2H4UW05	Bodo_saltans_virus	24.2	4.9e-15
WP_003416827.1|3594166_3594421_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_003906027.1|3594433_3595375_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003899966.1|3595433_3596501_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003910809.1|3596562_3599868_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	1.8e-08
>prophage 261
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3610628	3614324	4444417		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_003416875.1|3610628_3612212_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.9e-46
WP_003416876.1|3612224_3613448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901572.1|3613523_3614324_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.8	1.3e-16
>prophage 262
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3618544	3622383	4444417		Mycobacterium_phage(50.0%)	7	NA	NA
WP_003416884.1|3618544_3618799_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	8.8e-12
WP_003901574.1|3618860_3620366_-	ATPase	NA	NA	NA	NA	NA
WP_003416887.1|3620382_3620598_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_003416889.1|3620798_3620873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416891.1|3620882_3621188_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_003899976.1|3621184_3621736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003416897.1|3621732_3622383_-	ECF RNA polymerase sigma factor SigH	NA	A0A076YQ50	Rhizobium_phage	26.5	6.8e-08
>prophage 263
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3625395	3626154	4444417		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003416907.1|3625395_3626154_-	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	37.6	1.5e-27
>prophage 264
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3647742	3652480	4444417		Bacillus_phage(66.67%)	4	NA	NA
WP_003906038.1|3647742_3649446_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.3e-18
WP_003899985.1|3649495_3650182_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.6e-39
WP_003417036.1|3650251_3650896_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003417039.1|3650992_3652480_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.2	1.4e-43
>prophage 265
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3662704	3662974	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003417079.1|3662704_3662974_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	81.2	6.4e-29
>prophage 266
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3667730	3675515	4444417		Sphingomonas_phage(33.33%)	7	NA	NA
WP_003417097.1|3667730_3668810_-	NDP-sugar synthase	NA	H9NC64	Sphingomonas_phage	32.6	2.1e-17
WP_003901582.1|3668811_3669717_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003899993.1|3669727_3670642_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	8.4e-28
WP_003417107.1|3670717_3672214_+	LCP family protein	NA	NA	NA	NA	NA
WP_003417112.1|3672252_3672942_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_003417115.1|3673066_3673348_+	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003899995.1|3673358_3675515_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	33.5	6.2e-82
>prophage 267
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3680946	3681471	4444417		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003899997.1|3680946_3681471_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	1.1e-21
>prophage 268
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3690866	3694492	4444417		Bacillus_phage(50.0%)	5	NA	NA
WP_003417158.1|3690866_3691652_-	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	33.2	3.6e-19
WP_003417160.1|3691648_3692086_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_003417162.1|3692283_3692697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417165.1|3692731_3693109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900004.1|3693142_3694492_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	45.5	1.1e-111
>prophage 269
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3699472	3704014	4444417		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003901592.1|3699472_3704014_+	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	37.5	2.6e-05
>prophage 270
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3717619	3719224	4444417		Streptococcus_phage(100.0%)	1	NA	NA
WP_003900011.1|3717619_3719224_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.1	3.4e-48
>prophage 271
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3724939	3726223	4444417		Geobacillus_virus(100.0%)	1	NA	NA
WP_003900016.1|3724939_3726223_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.3	3.8e-79
>prophage 272
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3736751	3827995	4444417	transposase,tRNA	Burkholderia_virus(28.57%)	56	NA	NA
WP_087902221.1|3736751_3738013_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3738306_3738468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3738489_3740019_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3739951_3740890_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3740898_3742266_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3742334_3743552_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3743647_3745156_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3745152_3746304_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3746494_3747340_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3747814_3748255_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3748288_3749158_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3749178_3750189_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3750473_3751106_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3751172_3752402_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3752684_3754034_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3754045_3755185_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3755181_3755913_+	methyltransferase	NA	NA	NA	NA	NA
WP_085649412.1|3755921_3766991_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3773407_3773665_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3773920_3783394_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3784019_3784466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3784502_3785321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3785537_3785825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3797554_3798349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3798430_3798802_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3798699_3799110_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3798944_3799205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3799319_3799709_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3799722_3800016_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3800012_3800858_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3800981_3801257_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3801253_3801511_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3801552_3802743_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3802859_3803228_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3803224_3803776_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3803782_3804364_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3804344_3804713_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3804690_3805083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3805079_3807710_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3807945_3808410_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3808776_3810552_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3810552_3811197_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3811195_3811630_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3811718_3814958_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_031709368.1|3815149_3816484_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3816525_3817701_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3817754_3817859_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3817937_3818579_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3818579_3818828_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3818832_3820260_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3820367_3821021_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3821059_3822565_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3822569_3823460_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003918607.1|3823468_3825307_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417912.1|3825303_3826293_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_087902221.1|3826734_3827995_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 273
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3837769	3838633	4444417		Tupanvirus(100.0%)	1	NA	NA
WP_003900041.1|3837769_3838633_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
>prophage 274
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3851544	3852783	4444417		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003902474.1|3851544_3852783_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
>prophage 275
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3857143	3857443	4444417		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003911013.1|3857143_3857443_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	99.0	1.6e-44
>prophage 276
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3860821	3862411	4444417		Klosneuvirus(100.0%)	1	NA	NA
WP_003901630.1|3860821_3862411_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	6.2e-87
>prophage 277
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3865783	3869481	4444417	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_003418017.1|3865783_3866092_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
WP_003418021.1|3866163_3867783_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
WP_003418028.1|3867877_3868180_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
WP_003900052.1|3868446_3869481_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
>prophage 278
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3874774	3876624	4444417	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003418125.1|3874774_3875530_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	1.5e-22
WP_104591446.1|3875613_3876624_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	7.7e-83
>prophage 279
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3889684	3891559	4444417		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003418289.1|3889684_3891559_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
>prophage 280
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3899196	3902907	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418326.1|3899196_3902907_-	type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
>prophage 281
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3916563	3921813	4444417		Enterobacteria_phage(50.0%)	5	NA	NA
WP_003418607.1|3916563_3917559_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	3.1e-76
WP_003906113.1|3917560_3918169_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	37.8	7.5e-25
WP_003911061.1|3918690_3919647_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003900066.1|3919704_3920799_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	28.0	1.8e-05
WP_003900067.1|3920802_3921813_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.6e-27
>prophage 282
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3934695	3935478	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418925.1|3934695_3935478_-	DUF2510 domain-containing protein	NA	A0A088F7R2	Mycobacterium_phage	63.2	7.0e-07
>prophage 283
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3969411	3970959	4444417		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003900872.1|3969411_3970959_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	33.3	3.9e-09
>prophage 284
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3977768	3978425	4444417		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902513.1|3977768_3978425_-	fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	1.6e-09
>prophage 285
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	3983720	3985367	4444417		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003911024.1|3983720_3985367_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.6	2.0e-16
>prophage 286
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4006485	4007397	4444417		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003419251.1|4006485_4007397_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	1.7e-36
>prophage 287
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4010955	4012395	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003900090.1|4010955_4012395_+	PPE family protein	NA	A0A222ZKN7	Mycobacterium_phage	31.4	1.5e-23
>prophage 288
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4020277	4021192	4444417		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003900711.1|4020277_4021192_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.4e-11
>prophage 289
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4025580	4027638	4444417		Synechococcus_phage(100.0%)	1	NA	NA
WP_003901670.1|4025580_4027638_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	36.8	6.3e-07
>prophage 290
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4034532	4036056	4444417		Hepacivirus(100.0%)	1	NA	NA
WP_003900098.1|4034532_4036056_+	3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase	NA	Q75ZG1	Hepacivirus	27.4	3.9e-38
>prophage 291
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4055289	4056699	4444417	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003900108.1|4055289_4056699_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	7.8e-41
>prophage 292
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4068752	4075836	4444417	tRNA,protease	Mycobacterium_virus(25.0%)	5	NA	NA
WP_003419504.1|4068752_4069580_+	hypothetical protein	NA	G8I9P6	Mycobacterium_virus	63.9	2.9e-96
WP_003911027.1|4069626_4070946_-	PE family protein	NA	NA	NA	NA	NA
WP_003419511.1|4071053_4073600_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	1.8e-128
WP_003419513.1|4073876_4074215_-	nucleoid-associated protein	NA	A0A2D1GPL8	Mycobacterium_phage	42.4	4.6e-16
WP_003901683.1|4074318_4075836_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	34.5	1.1e-69
>prophage 294
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4150517	4150973	4444417		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003419733.1|4150517_4150973_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.6	4.9e-21
>prophage 295
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4153998	4154355	4444417		Tsukamurella_phage(100.0%)	1	NA	NA
WP_003419743.1|4153998_4154355_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	1.8e-10
>prophage 296
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4160093	4161524	4444417		Mollivirus(100.0%)	1	NA	NA
WP_003419754.1|4160093_4161524_-	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	31.6	2.6e-23
>prophage 297
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4182828	4183839	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003419818.1|4182828_4183839_-	DUF4185 domain-containing protein	NA	B5LJL4	Mycobacterium_phage	31.5	7.9e-11
>prophage 298
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4196534	4199530	4444417		Tupanvirus(50.0%)	2	NA	NA
WP_003420415.1|4196534_4197797_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.0	1.4e-36
WP_003420417.1|4197793_4199530_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	1.7e-42
>prophage 299
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4203012	4204014	4444417		Vaccinia_virus(100.0%)	1	NA	NA
WP_003911033.1|4203012_4204014_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q1M1E9	Vaccinia_virus	34.4	1.2e-08
>prophage 300
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4214557	4215634	4444417		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003420435.1|4214557_4215634_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	28.2	2.7e-17
>prophage 301
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4226190	4232505	4444417	integrase	Acidithiobacillus_phage(40.0%)	10	4226207:4226221	4232079:4232093
WP_003899665.1|4226190_4228173_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	8.8e-91
4226207:4226221	attL	CCAGCGGCGCGGCGC	NA	NA	NA	NA
WP_003901716.1|4228239_4228602_+	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR	NA	NA	NA	NA	NA
WP_003899668.1|4228685_4228898_-	DUF2237 family protein	NA	NA	NA	NA	NA
WP_003899670.1|4228970_4229306_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003899671.1|4229523_4229907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899672.1|4230036_4230396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899673.1|4230428_4230938_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	42.6	4.0e-11
WP_003420504.1|4231005_4231398_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	47.0	4.8e-17
WP_071854238.1|4231661_4231889_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	72.4	1.5e-15
WP_003420508.1|4232046_4232505_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.2e-05
4232079:4232093	attR	CCAGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 302
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4236086	4245779	4444417		Planktothrix_phage(20.0%)	9	NA	NA
WP_003906205.1|4236086_4237217_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.9e-20
WP_003901718.1|4237225_4238173_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003420534.1|4238337_4238640_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003420539.1|4238661_4239717_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003900750.1|4239795_4241676_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	7.5e-140
WP_003420544.1|4241846_4242326_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_003906207.1|4242381_4243809_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.3e-06
WP_003420552.1|4243879_4244584_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.9e-35
WP_003901719.1|4245092_4245779_+	hypothetical protein	NA	A0A2P1CG82	Mycobacterium_phage	54.1	4.6e-55
>prophage 303
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4249930	4250992	4444417		Pacmanvirus(100.0%)	1	NA	NA
WP_003420576.1|4249930_4250992_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	4.7e-14
>prophage 304
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4260324	4266304	4444417		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003420603.1|4260324_4261146_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	5.4e-10
WP_003906213.1|4261142_4262057_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003420610.1|4262053_4262896_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003420612.1|4263051_4264032_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.5	1.2e-32
WP_003420618.1|4265080_4266304_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	31.4	3.4e-08
>prophage 305
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4296061	4299366	4444417		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_003420779.1|4296061_4297072_-	cutinase family protein	NA	A0A2K9VEH2	Gordonia_phage	28.6	6.9e-07
WP_003420783.1|4297270_4298170_-	MPT51/MPB51 antigen	NA	A0A2I6AZH7	Macacine_betaherpesvirus	38.4	5.1e-46
WP_003900759.1|4298349_4299366_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	1.3e-178
>prophage 306
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4304983	4309125	4444417		Streptococcus_phage(50.0%)	3	NA	NA
WP_003420798.1|4304983_4306183_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.5	8.8e-86
WP_003420801.1|4306446_4307301_+	exported repetitive protein	NA	NA	NA	NA	NA
WP_003420805.1|4307505_4309125_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	39.4	1.1e-06
>prophage 307
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4319428	4320643	4444417		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899709.1|4319428_4320643_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	35.6	3.7e-23
>prophage 308
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4325932	4332313	4444417		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003900763.1|4325932_4332313_-	phthioceranic/hydroxyphthioceranic acid synthase	NA	D0R7J2	Paenibacillus_phage	30.1	4.6e-24
>prophage 309
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4340364	4341624	4444417	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003420889.1|4340364_4341624_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	33.8	7.7e-56
>prophage 310
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4353413	4354037	4444417		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003399735.1|4353413_4354037_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	1.2e-33
>prophage 311
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4376020	4387823	4444417		Mycobacterium_phage(40.0%)	9	NA	NA
WP_003399850.1|4376020_4377742_+	type VII secretion system ESX-1 AAA family ATPase EccA1	NA	V5UQM2	Mycobacterium_phage	33.2	8.6e-58
WP_003399854.1|4377745_4379188_+	type VII secretion system ESX-1 subunit EccB1	NA	NA	NA	NA	NA
WP_003899738.1|4379187_4381431_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1	NA	A0A142F150	Bacillus_phage	28.6	7.6e-14
WP_003399865.1|4381639_4383415_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1	NA	A0A1P8DJB2	Virus_Rctr71	26.7	1.4e-07
WP_003399870.1|4383557_4383854_+	type VII secretion system ESX-1 target PE35	NA	NA	NA	NA	NA
WP_003399879.1|4383887_4384994_+	type VII secretion system ESX-1 target PPE68	NA	NA	NA	NA	NA
WP_003399940.1|4385086_4385389_+	type VII secretion system ESX-1 WXG100 family target CFP-10	NA	NA	NA	NA	NA
WP_003399963.1|4385421_4385709_+	type VII secretion system ESX-1 WXG100 family target ESAT-6	NA	A0A2I6AZH7	Macacine_betaherpesvirus	100.0	1.4e-45
WP_003909105.1|4385822_4387823_+	type VII secretion system ESX-1 associated protein EspI	NA	V5UPR8	Mycobacterium_phage	28.8	4.4e-21
>prophage 312
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4396265	4403019	4444417	protease	Mycobacterium_phage(100.0%)	4	NA	NA
WP_003400004.1|4396265_4397606_-|protease	type VII secretion system ESX-1 serine protease mycosin MycP1	protease	V5UPA7	Mycobacterium_phage	41.0	1.4e-79
WP_003400005.1|4397827_4399687_-	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	29.3	2.5e-47
WP_031709332.1|4399756_4401370_-	type VII secretion system ESX-2 subunit EccE2	NA	NA	NA	NA	NA
WP_003400012.1|4401366_4403019_-|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	V5UPA7	Mycobacterium_phage	36.6	1.1e-67
>prophage 313
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4413300	4415699	4444417		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031709335.1|4413300_4414788_-	type VII secretion system ESX-2 subunit EccB2	NA	V5UN45	Mycobacterium_phage	37.2	7.6e-71
WP_003899753.1|4414790_4415699_-	transglycosylase	NA	A0A2H4PIU8	Corynebacterium_phage	46.1	2.4e-11
>prophage 314
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4424483	4425926	4444417	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400120.1|4424483_4425926_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	37.3	7.7e-60
>prophage 315
NZ_CP017597	Mycobacterium tuberculosis strain Beijing-like/50148 chromosome, complete genome	4444417	4434579	4440383	4444417		Orpheovirus(25.0%)	6	NA	NA
WP_003900782.1|4434579_4435587_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.2	1.1e-68
WP_003400164.1|4435583_4435934_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.8	3.9e-26
WP_003400168.1|4436043_4437264_+	hydrolase	NA	Q0H257	Geobacillus_phage	29.2	2.6e-08
WP_003400171.1|4437284_4438019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400175.1|4438308_4439343_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_078387225.1|4439339_4440383_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	1.4e-23
