The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	0	18795	4431885	transposase	Burkholderia_virus(14.29%)	16	NA	NA
WP_087902221.1|1612_2873_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003400271.1|3376_4585_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	38.9	1.5e-64
WP_003899768.1|4604_5762_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003899769.1|5758_6322_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_003917863.1|6564_8592_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.4e-131
WP_003400286.1|8626_11143_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	1.5e-87
WP_031709324.1|11238_12153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400294.1|12549_12741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400297.1|12879_13017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400307.1|13198_13636_-	cell wall synthesis protein CwsA	NA	NA	NA	NA	NA
WP_003400321.1|13792_14341_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.5e-24
WP_003899772.1|14457_14883_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003400344.1|15038_15320_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003901765.1|15413_16202_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_003400352.1|16238_16937_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.0e-42
WP_003902584.1|16914_18795_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	35.1	8.0e-17
>prophage 2
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	29654	30512	4431885		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003901769.1|29654_30512_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	54.3	1.4e-21
>prophage 3
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	35599	37915	4431885		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003901773.1|35599_37915_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.5	5.2e-34
>prophage 4
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	45034	47944	4431885	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902585.1|45034_47944_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.6	2.1e-210
>prophage 5
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	51491	52595	4431885		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003400492.1|51491_52595_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.4	1.4e-74
>prophage 6
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	60065	69863	4431885		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_003400534.1|60065_60560_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	73.8	1.4e-58
WP_003400540.1|60601_60856_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003400543.1|60888_61347_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003900797.1|61375_61897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400547.1|61875_64500_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	47.5	4.9e-20
WP_003400548.1|64679_65372_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003400551.1|65388_66447_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	38.5	2.1e-22
WP_003400562.1|67031_68174_+	cellulase CelA	NA	NA	NA	NA	NA
WP_003902591.1|68402_69863_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.6	1.2e-20
>prophage 7
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	79127	80405	4431885		Aeromonas_phage(100.0%)	1	NA	NA
WP_003899799.1|79127_80405_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.2	2.5e-86
>prophage 8
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	98634	100920	4431885		uncultured_virus(100.0%)	1	NA	NA
WP_003899808.1|98634_100920_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	1.9e-84
>prophage 9
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	106211	120229	4431885		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003400792.1|106211_107834_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	3.2e-14
WP_003400793.1|107838_108075_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003400794.1|108056_115595_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	2.2e-81
WP_003900808.1|115769_117755_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003400797.1|117970_120229_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	3.5e-83
>prophage 10
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	123720	128598	4431885		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003899815.1|123720_128598_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	30.1	5.4e-41
>prophage 11
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	132007	141934	4431885		Synechococcus_phage(40.0%)	9	NA	NA
WP_003900811.1|132007_134065_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.6	2.3e-41
WP_003910039.1|134346_135303_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	31.0	1.3e-36
WP_003400839.1|135376_135967_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.1	6.4e-13
WP_003400840.1|135998_136571_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003902603.1|136570_137731_+	D-alpha-D-heptose-7-phosphate kinase hddA	NA	A0A222YW25	Synechococcus_phage	37.4	2.1e-55
WP_003400850.1|138013_138202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400856.1|138324_139080_-	L,D-transpeptidase LdtMt1	NA	NA	NA	NA	NA
WP_003906284.1|139257_140202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003400858.1|140185_141934_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.7	1.2e-27
>prophage 12
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	154797	155820	4431885		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003400908.1|154797_155820_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	70.3	1.9e-129
>prophage 13
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	159088	162910	4431885		Human_cytomegalovirus(50.0%)	3	NA	NA
WP_003400924.1|159088_159694_+	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	32.5	1.6e-19
WP_003400935.1|160862_161468_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003906289.1|161584_162910_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.2	4.6e-19
>prophage 14
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	175761	177528	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400998.1|175761_177528_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	39.0	1.0e-21
>prophage 15
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	185651	187058	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401047.1|185651_187058_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.5	2.0e-20
>prophage 16
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	190202	194878	4431885		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_003401058.1|190202_191354_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	7.8e-31
WP_003401060.1|191335_191791_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003401063.1|191844_192330_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003401065.1|192343_193036_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899837.1|193213_194878_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.7e-34
>prophage 17
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	223046	223709	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|223046_223709_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 18
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	231219	234804	4431885		Bacillus_phage(100.0%)	1	NA	NA
WP_003902618.1|231219_234804_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-44
>prophage 19
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	238860	240852	4431885	protease	Klosneuvirus(100.0%)	1	NA	NA
WP_003401172.1|238860_240852_-|protease	zinc metalloprotease	protease	A0A1V0SHG2	Klosneuvirus	38.5	3.2e-80
>prophage 20
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	258013	258985	4431885		Serratia_phage(100.0%)	1	NA	NA
WP_003401213.1|258013_258985_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A1S6UB31	Serratia_phage	28.9	7.8e-24
>prophage 21
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	264267	268368	4431885		Mycobacterium_phage(100.0%)	4	NA	NA
WP_003900831.1|264267_265176_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	31.4	1.2e-05
WP_003901829.1|265268_266597_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003401230.1|266598_267147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899863.1|267156_268368_+	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	42.4	8.7e-49
>prophage 22
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	303208	305149	4431885		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003401322.1|303208_305149_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.4	9.1e-24
>prophage 23
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	327109	330595	4431885		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003401383.1|327109_327619_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1C9M039	Mycobacterium_phage	74.4	5.9e-23
WP_003401386.1|327683_328877_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_003899884.1|328912_330595_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.6e-24
>prophage 24
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	346567	354065	4431885		Mycobacterium_phage(100.0%)	3	NA	NA
WP_003401463.1|346567_348463_+	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	40.6	3.1e-101
WP_003401472.1|348459_350076_+	type VII secretion system ESX-3 subunit EccB3	NA	V5UN45	Mycobacterium_phage	35.0	5.6e-59
WP_003401478.1|350072_354065_+	type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3	NA	V5UPA0	Mycobacterium_phage	26.3	8.0e-91
>prophage 25
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	358935	360321	4431885	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401528.1|358935_360321_+|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	39.8	6.6e-69
>prophage 26
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	389585	398458	4431885		Acanthocystis_turfacea_Chlorella_virus(20.0%)	10	NA	NA
WP_003401625.1|389585_390356_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-13
WP_003401627.1|390717_391512_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_003401632.1|391560_392229_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003401636.1|392300_392963_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	42.5	2.4e-24
WP_003898399.1|392994_393567_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	74.7	5.0e-79
WP_003898400.1|393672_395004_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	2.7e-67
WP_003401643.1|394992_395664_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_003401648.1|395764_396445_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003902651.1|396451_397141_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003401650.1|397108_398458_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.8	5.0e-13
>prophage 27
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	403070	403937	4431885		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003401670.1|403070_403937_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.6	4.3e-90
>prophage 28
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	424247	428052	4431885		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_003401814.1|424247_426125_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	2.3e-141
WP_003401817.1|426121_426829_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003401821.1|426864_428052_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.7	2.1e-15
>prophage 29
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	439712	441011	4431885		Pandoravirus(100.0%)	1	NA	NA
WP_003401829.1|439712_441011_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	34.6	6.4e-66
>prophage 30
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	456041	456521	4431885		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003401867.1|456041_456521_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.1	3.5e-17
>prophage 31
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	462082	466244	4431885		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003401894.1|462082_462622_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	44.9	4.3e-16
WP_003401897.1|462702_463557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003401905.1|463697_466244_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	1.1e-120
>prophage 32
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	481570	482800	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003898432.1|481570_482800_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.0	2.4e-17
>prophage 33
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	488220	494182	4431885		Catovirus(50.0%)	2	NA	NA
WP_003900921.1|488220_489978_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	9.8e-09
WP_016719657.1|490210_494182_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.8	4.9e-32
>prophage 34
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	499304	501557	4431885		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_003402100.1|499304_501557_-	serine/threonine protein kinase	NA	Q85650	Moloney_murine_sarcoma_virus	26.1	3.0e-10
>prophage 35
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	514943	519563	4431885		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003898445.1|514943_519563_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.5	6.7e-41
>prophage 36
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	522974	523283	4431885		Gordonia_phage(100.0%)	1	NA	NA
WP_003402188.1|522974_523283_+	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	43.5	1.6e-07
>prophage 37
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	526588	528775	4431885		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003402206.1|526588_528775_-	AAA family ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	42.6	1.4e-36
>prophage 38
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	532849	534472	4431885		uncultured_virus(100.0%)	1	NA	NA
WP_003402236.1|532849_534472_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	9.3e-155
>prophage 39
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	556855	558250	4431885		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003402301.1|556855_558250_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.1e-47
>prophage 40
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	564129	565953	4431885		Tupanvirus(100.0%)	2	NA	NA
WP_003900153.1|564129_564990_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.1	1.1e-29
WP_003402323.1|565089_565953_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.9	7.1e-29
>prophage 41
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	583590	585710	4431885		Bacillus_phage(100.0%)	2	NA	NA
WP_003402390.1|583590_584823_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-28
WP_003402393.1|585026_585710_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.0e-42
>prophage 42
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	594300	598997	4431885		Streptococcus_phage(33.33%)	6	NA	NA
WP_003900159.1|594300_595188_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.0	2.3e-22
WP_003402437.1|595328_595565_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003402602.1|595692_595794_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_003402607.1|595871_597002_+	SDR family oxidoreductase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	27.3	2.4e-08
WP_003898486.1|597008_598085_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003402621.1|598088_598997_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.8	4.9e-28
>prophage 43
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	612963	614274	4431885		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003402810.1|612963_614274_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	1.1e-12
>prophage 44
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	625124	626342	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003910801.1|625124_626342_+	AAA family ATPase	NA	V5UPR8	Mycobacterium_phage	32.6	5.7e-32
>prophage 45
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	631548	632589	4431885		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003901872.1|631548_632589_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	9.5e-20
>prophage 46
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	645396	647112	4431885		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003402917.1|645396_647112_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	5.4e-28
>prophage 47
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	663750	672695	4431885		Mycobacterium_phage(25.0%)	8	NA	NA
WP_003402992.1|663750_665169_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	24.3	3.1e-13
WP_003402995.1|665303_665570_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_003402998.1|665595_667674_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	Q8V6N4	Halorubrum_phage	33.5	2.7e-90
WP_031709257.1|667787_669119_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003898507.1|669342_669684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403006.1|669734_669902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403007.1|670151_671543_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.5	2.1e-67
WP_003403008.1|671552_672695_-	CapA family protein	NA	S4VS02	Pandoravirus	50.8	2.1e-92
>prophage 48
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	703333	706310	4431885	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_003403148.1|703333_704095_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	1.7e-34
WP_003403164.1|704151_704463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900184.1|704534_705485_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_003403171.1|705725_706310_+|transposase	IS607-like element IS1536 family transposase	transposase	F9VHY9	Thermus_phage	32.4	7.7e-19
>prophage 49
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	724300	729309	4431885		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003901883.1|724300_726028_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	3.8e-21
WP_003905355.1|726024_729309_-	RecBCD enzyme subunit RecB	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.9	1.4e-08
>prophage 50
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	740593	746913	4431885		Tupanvirus(60.0%)	6	NA	NA
WP_003900195.1|740593_741499_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.0	7.7e-26
WP_003403302.1|741563_742445_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.7	3.3e-29
WP_003905358.1|742592_743456_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.4	2.2e-30
WP_003403310.1|743622_744483_-	mycolic acid methyltransferase MmaA1	NA	A0A2K9L4K8	Tupanvirus	29.1	7.4e-26
WP_003403314.1|744529_745435_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003403317.1|745446_746913_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	32.1	4.8e-33
>prophage 51
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	756345	757425	4431885		Planktothrix_phage(100.0%)	1	NA	NA
WP_003403363.1|756345_757425_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-22
>prophage 52
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	764635	775379	4431885		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_003910996.1|764635_768154_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	21.8	3.9e-33
WP_031709258.1|768198_772149_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	5.5e-52
WP_003900994.1|772145_772520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900995.1|772512_774426_-	neutral ceramidase	NA	NA	NA	NA	NA
WP_003403419.1|774620_775379_+	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	7.9e-16
>prophage 53
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	787315	790842	4431885		Streptococcus_phage(50.0%)	2	NA	NA
WP_003898554.1|787315_789421_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.6	1.0e-60
WP_003403463.1|789651_790842_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.6	3.1e-30
>prophage 54
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	801763	803203	4431885		Catovirus(100.0%)	1	NA	NA
WP_003901900.1|801763_803203_+	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	25.6	5.6e-10
>prophage 55
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	813576	814476	4431885		Microcystis_virus(100.0%)	1	NA	NA
WP_003403610.1|813576_814476_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	29.0	5.0e-17
>prophage 56
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	825327	826308	4431885		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003403698.1|825327_826308_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.0	9.6e-22
>prophage 57
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	830953	831499	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003403726.1|830953_831499_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	35.1	1.3e-15
>prophage 58
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	856311	862740	4431885		Bacillus_phage(50.0%)	8	NA	NA
WP_003403867.1|856311_857055_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.9e-34
WP_003898576.1|857099_858557_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	5.4e-21
WP_003403876.1|858528_858930_-	HIT family protein	NA	NA	NA	NA	NA
WP_003403880.1|858969_859389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403885.1|859401_860529_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.8e-27
WP_003403887.1|860627_861173_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003403890.1|861175_861382_-	ferredoxin	NA	NA	NA	NA	NA
WP_003898577.1|861384_862740_-	cytochrome P450	NA	M1PWN0	Moumouvirus	23.1	2.4e-07
>prophage 59
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	878045	878939	4431885		Mollivirus(100.0%)	1	NA	NA
WP_003403962.1|878045_878939_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	3.2e-40
>prophage 60
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	893748	895009	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|893748_895009_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 61
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	900523	902788	4431885		Microbacterium_phage(100.0%)	1	NA	NA
WP_003404114.1|900523_902788_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
>prophage 62
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	906814	909523	4431885		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003901017.1|906814_908398_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|908428_909523_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
>prophage 63
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	915675	918206	4431885		Bacillus_phage(50.0%)	3	NA	NA
WP_003898599.1|915675_916443_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|916439_917387_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|917429_918206_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
>prophage 64
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	953792	955475	4431885		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003900222.1|953792_955475_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	21.2	2.7e-08
>prophage 65
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	962879	964508	4431885		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_003404428.1|962879_964508_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	1.0e-15
>prophage 66
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	968668	972662	4431885		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_003900223.1|968668_969892_-	resuscitation-promoting factor RpfA	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-98
WP_003404559.1|970339_970618_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003404564.1|970621_971704_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003404566.1|971700_972090_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003404570.1|972254_972662_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	1.1e-08
>prophage 67
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	996965	997823	4431885		Pandoravirus(100.0%)	1	NA	NA
WP_031651833.1|996965_997823_-	adenylate/guanylate cyclase domain-containing protein	NA	S4VR00	Pandoravirus	32.6	2.1e-09
>prophage 68
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1016099	1018493	4431885		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003898639.1|1016099_1018493_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.5	7.0e-26
>prophage 69
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1026455	1033706	4431885	transposase	Vibrio_phage(25.0%)	7	NA	NA
WP_003404749.1|1026455_1028237_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	3.8e-24
WP_003404750.1|1028233_1028491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404754.1|1028579_1029056_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003404756.1|1029052_1029553_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404757.1|1029865_1031185_-|transposase	IS256-like element IS1554 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.6	2.9e-29
WP_003404760.1|1031472_1032054_+|transposase	IS607-like element IS1535 family transposase	transposase	F9VHY9	Thermus_phage	33.5	1.4e-23
WP_003905412.1|1032053_1033706_+|transposase	transposase	transposase	M4I0H6	Staphylococcus_phage	23.6	6.0e-08
>prophage 70
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1042285	1052781	4431885		Tupanvirus(20.0%)	8	NA	NA
WP_003404782.1|1042285_1044280_-	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	27.5	1.5e-13
WP_003898652.1|1044301_1045414_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003898653.1|1045629_1046460_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.9	4.5e-12
WP_003900236.1|1046480_1047605_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	27.0	1.2e-20
WP_003404792.1|1047664_1048681_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003404794.1|1048682_1049588_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003404795.1|1049564_1050386_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	51.5	6.1e-70
WP_003898655.1|1050501_1052781_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.8	5.7e-41
>prophage 71
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1061665	1068417	4431885		Bacillus_phage(50.0%)	7	NA	NA
WP_003404833.1|1061665_1061896_-	mycolyltransferase	NA	A0A2I6B0H1	Macacine_betaherpesvirus	60.4	1.0e-06
WP_003404835.1|1061812_1062007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404838.1|1062011_1062329_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003404859.1|1062625_1064941_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.1	2.4e-119
WP_003404862.1|1065021_1066020_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	41.5	8.3e-13
WP_003898659.1|1066329_1067493_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_003900240.1|1067505_1068417_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	29.9	2.0e-13
>prophage 72
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1071926	1074142	4431885		Synechococcus_phage(50.0%)	2	NA	NA
WP_003898661.1|1071926_1072574_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.5	9.5e-18
WP_003404890.1|1072570_1074142_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	41.0	1.5e-53
>prophage 73
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1083108	1085421	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003404941.1|1083108_1085421_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.7e-91
>prophage 74
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1101200	1101887	4431885		Bacillus_phage(100.0%)	1	NA	NA
WP_003916757.1|1101200_1101887_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	8.2e-36
>prophage 75
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1106181	1106928	4431885		Planktothrix_phage(100.0%)	1	NA	NA
WP_003900248.1|1106181_1106928_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-34
>prophage 76
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1113650	1114571	4431885		Bacillus_phage(100.0%)	1	NA	NA
WP_003405145.1|1113650_1114571_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	4.2e-43
>prophage 77
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1120909	1121527	4431885		Pacmanvirus(100.0%)	1	NA	NA
WP_003898684.1|1120909_1121527_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	3.4e-09
>prophage 78
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1126600	1133558	4431885	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_072433503.1|1126600_1128037_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	6.5e-35
WP_003405180.1|1128092_1129796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405183.1|1129822_1131382_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
WP_003405185.1|1131467_1132262_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003405187.1|1132469_1133558_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
>prophage 79
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1139879	1140860	4431885		Hokovirus(100.0%)	1	NA	NA
WP_003405263.1|1139879_1140860_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
>prophage 80
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1148942	1153486	4431885		Streptococcus_phage(50.0%)	5	NA	NA
WP_003901975.1|1148942_1150232_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.6	1.6e-133
WP_003405293.1|1150236_1150923_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003905434.1|1150939_1151407_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_003405299.1|1151397_1152357_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003905437.1|1152805_1153486_-	response regulator	NA	W8CYM9	Bacillus_phage	30.2	2.1e-23
>prophage 81
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1158102	1163115	4431885		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003405320.1|1158102_1160232_+	potassium-transporting ATPase subunit KdpB	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
WP_003405322.1|1160231_1160801_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003405324.1|1160804_1162334_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003405328.1|1162341_1163115_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
>prophage 82
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1173802	1175050	4431885	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1173802_1175050_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 83
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1181307	1181753	4431885	integrase	Mycobacterium_phage(50.0%)	2	1179598:1179613	1187513:1187528
1179598:1179613	attL	GTGTCCTCGACCAGCG	NA	NA	NA	NA
WP_003905442.1|1181307_1181622_+	hypothetical protein	NA	Q854H9	Mycobacterium_phage	53.6	1.0e-09
WP_072139304.1|1181558_1181753_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1187513:1187528	attR	CGCTGGTCGAGGACAC	NA	NA	NA	NA
>prophage 84
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1185063	1186695	4431885		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003405625.1|1185063_1186695_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.6	8.8e-28
>prophage 85
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1205682	1209199	4431885		Streptococcus_phage(50.0%)	3	NA	NA
WP_003405730.1|1205682_1207077_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.6e-57
WP_003901991.1|1207278_1208001_+	RDD family protein	NA	NA	NA	NA	NA
WP_003405736.1|1208032_1209199_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	34.9	2.5e-24
>prophage 86
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1214560	1215349	4431885		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003903314.1|1214560_1215349_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.0	1.2e-14
>prophage 87
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1224534	1228259	4431885		Aeromonas_phage(50.0%)	3	NA	NA
WP_003405797.1|1224534_1225815_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-86
WP_003405801.1|1225919_1226747_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003405802.1|1226957_1228259_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.2	1.0e-23
>prophage 88
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1236799	1239416	4431885		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_003405840.1|1236799_1237912_-	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	1.9e-29
WP_003405844.1|1237921_1238179_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003405846.1|1238168_1239416_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.3	7.5e-72
>prophage 89
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1244142	1250107	4431885		Mycobacterium_phage(33.33%)	7	NA	NA
WP_003898733.1|1244142_1244841_+	hypothetical protein	NA	A0A0K2FNG4	Mycobacterium_phage	35.7	1.9e-08
WP_003901093.1|1244958_1245144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651777.1|1245070_1245346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003405871.1|1245588_1245912_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003898734.1|1245926_1246787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898735.1|1247662_1249063_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.6	1.2e-62
WP_003405880.1|1249084_1250107_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	53.4	7.0e-92
>prophage 90
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1253887	1255360	4431885		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003898737.1|1253887_1255360_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	1.4e-69
>prophage 91
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1266960	1268222	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1266960_1268222_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 92
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1276468	1277221	4431885		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003405961.1|1276468_1277221_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	3.7e-05
>prophage 93
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1284217	1284931	4431885		Escherichia_phage(100.0%)	1	NA	NA
WP_003406044.1|1284217_1284931_-	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	33.5	4.4e-16
>prophage 94
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1296378	1298055	4431885		Escherichia_phage(100.0%)	1	NA	NA
WP_003406090.1|1296378_1298055_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	1.5e-19
>prophage 95
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1308244	1310815	4431885		Mamastrovirus(100.0%)	1	NA	NA
WP_003406167.1|1308244_1310815_+	FO synthase	NA	A9ZMK9	Mamastrovirus	33.8	3.4e-18
>prophage 96
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1319039	1325297	4431885		Paenibacillus_phage(100.0%)	1	NA	NA
WP_085711711.1|1319039_1325297_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.6	2.6e-27
>prophage 97
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1329846	1330926	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003406195.1|1329846_1330926_-	PE-PPE domain-containing protein	NA	A0A222ZS78	Mycobacterium_phage	36.1	2.4e-18
>prophage 98
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1341108	1342530	4431885		Hepacivirus(100.0%)	1	NA	NA
WP_003905485.1|1341108_1342530_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	31.0	5.8e-28
>prophage 99
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1346672	1347920	4431885	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1346672_1347920_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 100
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1354033	1354597	4431885		Enterococcus_phage(100.0%)	1	NA	NA
WP_003898770.1|1354033_1354597_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	32.1	1.7e-10
>prophage 101
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1367112	1372778	4431885	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003900295.1|1367112_1368048_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.3e-19
WP_003406254.1|1368037_1368676_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911448.1|1368817_1369492_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003406257.1|1369727_1370501_+	ECF RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	9.6e-09
WP_003406258.1|1370658_1371123_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003898779.1|1371191_1372778_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.2	8.6e-12
>prophage 102
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1386001	1387183	4431885		Planktothrix_phage(100.0%)	1	NA	NA
WP_003406299.1|1386001_1387183_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.2	6.6e-25
>prophage 103
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1405182	1408022	4431885		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003898793.1|1405182_1406874_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	4.6e-56
WP_003406347.1|1406870_1408022_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	26.8	3.8e-09
>prophage 104
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1419172	1421053	4431885		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003898799.1|1419172_1421053_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	34.1	6.8e-16
>prophage 105
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1425630	1429271	4431885		Bacillus_phage(100.0%)	2	NA	NA
WP_003406569.1|1425630_1427526_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.4e-55
WP_003406574.1|1427522_1429271_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.7e-42
>prophage 106
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1435282	1440492	4431885		Klosneuvirus(50.0%)	3	NA	NA
WP_003406598.1|1435282_1436869_+	oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	28.0	1.5e-48
WP_003900310.1|1436885_1438661_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_003406602.1|1438653_1440492_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-19
>prophage 107
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1444127	1445972	4431885		Hokovirus(100.0%)	1	NA	NA
WP_003406621.1|1444127_1445972_+	adenylyl-sulfate kinase	NA	A0A1V0SGC3	Hokovirus	25.6	1.1e-34
>prophage 108
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1462720	1463374	4431885		Pandoravirus(100.0%)	1	NA	NA
WP_003898815.1|1462720_1463374_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	2.3e-19
>prophage 109
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1482296	1485987	4431885		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_003406857.1|1482296_1482794_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	5.4e-21
WP_003406860.1|1482790_1484281_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003406864.1|1484361_1485987_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.1	2.5e-14
>prophage 110
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1489350	1491054	4431885		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031709366.1|1489350_1491054_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	2.2e-13
>prophage 111
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1503994	1514987	4431885	protease	Bacillus_phage(20.0%)	13	NA	NA
WP_003901136.1|1503994_1505989_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.2	2.0e-50
WP_003900321.1|1506012_1507359_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	36.3	9.4e-44
WP_003406906.1|1507460_1507766_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003898829.1|1507725_1508382_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003406908.1|1508398_1509433_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_003898830.1|1509440_1509881_+	CysO-cysteine peptidase	NA	NA	NA	NA	NA
WP_003406910.1|1509902_1510184_+	sulfur carrier protein CysO	NA	NA	NA	NA	NA
WP_003406912.1|1510193_1511165_+	O-phosphoserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	37.5	5.9e-48
WP_003898831.1|1511155_1511878_+|protease	rhomboid family intramembrane serine protease	protease	L7RCY0	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-06
WP_003406919.1|1511874_1512690_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003406922.1|1512716_1513538_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003406926.1|1513554_1514334_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003406931.1|1514372_1514987_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	30.5	7.6e-09
>prophage 112
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1519846	1525034	4431885		Bacillus_phage(66.67%)	3	NA	NA
WP_003406958.1|1519846_1522426_+	iron ABC transporter ATP-binding protein/permease IrtA	NA	W8CYL7	Bacillus_phage	26.7	4.8e-28
WP_003900322.1|1522422_1524162_+	iron ABC transporter ATP-binding protein/permease IrtB	NA	W8CYL7	Bacillus_phage	25.3	2.6e-22
WP_003406963.1|1524290_1525034_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	3.6e-05
>prophage 113
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1545189	1546240	4431885		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003407164.1|1545189_1546011_+	GTP pyrophosphokinase family protein	NA	A0A142K822	Mycobacterium_phage	51.1	1.7e-48
WP_003907641.1|1545979_1546240_+	hypothetical protein	NA	A0A142K823	Mycobacterium_phage	60.6	8.7e-15
>prophage 114
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1549456	1550718	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1549456_1550718_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 115
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1571201	1577770	4431885		Abalone_herpesvirus(25.0%)	6	NA	NA
WP_003900331.1|1571201_1571828_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.2	1.1e-15
WP_003407248.1|1571893_1572226_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003898859.1|1572241_1573498_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.7e-37
WP_003900333.1|1573625_1574837_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.4	5.7e-117
WP_003407257.1|1574909_1576388_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003407260.1|1576384_1577770_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.6	2.2e-24
>prophage 116
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1582633	1583596	4431885		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003905554.1|1582633_1583596_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	28.3	2.4e-25
>prophage 117
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1591993	1598953	4431885		Staphylococcus_phage(100.0%)	8	NA	NA
WP_003898867.1|1591993_1593013_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	5.8e-38
WP_003407310.1|1593009_1594566_-	MFS transporter	NA	NA	NA	NA	NA
WP_003407315.1|1594571_1595282_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003407318.1|1595366_1595972_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.1	4.1e-31
WP_071854210.1|1596179_1596701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407330.1|1596690_1597092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407334.1|1597196_1598474_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	5.7e-91
WP_003898872.1|1598470_1598953_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.4	3.6e-14
>prophage 118
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1602778	1604709	4431885		Thermobifida_phage(50.0%)	2	NA	NA
WP_003898873.1|1602778_1603684_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.3e-08
WP_003407352.1|1603680_1604709_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	7.9e-35
>prophage 119
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1607858	1614772	4431885		Mycobacterium_phage(66.67%)	5	NA	NA
WP_003407371.1|1607858_1609121_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	37.4	1.5e-35
WP_003898876.1|1609120_1610728_-	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.6e-27
WP_003407374.1|1610731_1611559_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003407376.1|1611677_1612946_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003407378.1|1613185_1614772_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	40.8	2.9e-28
>prophage 120
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1626593	1628894	4431885		Escherichia_phage(100.0%)	1	NA	NA
WP_003902073.1|1626593_1628894_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	31.6	2.4e-71
>prophage 121
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1632223	1633768	4431885		Synechococcus_phage(100.0%)	1	NA	NA
WP_003407443.1|1632223_1633768_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	35.8	1.5e-74
>prophage 122
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1650511	1660502	4431885		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1650511_1651453_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1651608_1653384_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1653431_1654238_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1654234_1656775_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1656771_1657965_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1657961_1658762_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1658763_1660017_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1660013_1660502_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 123
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1664303	1670888	4431885	transposase	Burkholderia_virus(25.0%)	6	NA	NA
WP_151230898.1|1664303_1665565_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	1.1e-81
WP_003905583.1|1665563_1667540_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1667583_1667958_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1667973_1668345_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1668366_1669224_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1669259_1670888_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 124
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1677022	1677748	4431885		Streptomyces_phage(100.0%)	1	NA	NA
WP_003407525.1|1677022_1677748_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	36.4	6.7e-12
>prophage 125
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1682043	1682787	4431885		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003898892.1|1682043_1682787_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.6e-08
>prophage 126
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1699453	1700482	4431885		Salmonella_phage(100.0%)	1	NA	NA
WP_003407612.1|1699453_1700482_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	32.2	2.6e-33
>prophage 127
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1708468	1714392	4431885		Synechococcus_phage(25.0%)	6	NA	NA
WP_003407628.1|1708468_1708831_+	hypothetical protein	NA	M4QRT5	Synechococcus_phage	60.0	7.2e-07
WP_003407632.1|1708814_1709696_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003901183.1|1709897_1711196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407639.1|1711676_1712699_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.8	4.0e-103
WP_003407642.1|1712695_1713664_+	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	49.7	1.5e-83
WP_003407647.1|1713660_1714392_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	28.0	2.1e-05
>prophage 128
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1720904	1722656	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003901187.1|1720904_1722656_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.8	8.3e-08
>prophage 129
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1727328	1730663	4431885		Shahe_endorna-like_virus(100.0%)	3	NA	NA
WP_003407671.1|1727328_1728573_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	37.5	2.5e-06
WP_003407672.1|1728619_1729405_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003407676.1|1729382_1730663_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	7.4e-06
>prophage 130
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1745121	1748247	4431885	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003407714.1|1745121_1748247_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.2	1.0e-162
>prophage 131
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1756296	1764035	4431885		Saccharomonospora_phage(50.0%)	4	NA	NA
WP_003407751.1|1756296_1759851_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	60.2	0.0e+00
WP_003903497.1|1759899_1761936_-	PPE family protein	NA	NA	NA	NA	NA
WP_024742859.1|1762092_1762641_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_003917498.1|1762646_1764035_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.1e-39
>prophage 132
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1780242	1785308	4431885		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003407794.1|1780242_1782432_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.4	2.3e-23
WP_003407798.1|1782530_1783223_-	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	36.5	4.3e-08
WP_003407802.1|1783462_1783747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407803.1|1783994_1785308_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.2e-13
>prophage 133
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1800251	1801394	4431885		Faustovirus(100.0%)	1	NA	NA
WP_003407947.1|1800251_1801394_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.7e-17
>prophage 134
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1809595	1810414	4431885		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003407990.1|1809595_1810414_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.1	8.0e-30
>prophage 135
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1827535	1832735	4431885		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_003408045.1|1827535_1828153_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.0	3.9e-05
WP_003408054.1|1828220_1829429_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003408058.1|1829425_1829917_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_003901211.1|1830020_1832735_+	DNA polymerase I	NA	A0A060AFQ3	Listeria_phage	30.6	2.5e-43
>prophage 136
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1842253	1852234	4431885	tRNA	Mycobacterium_phage(25.0%)	6	NA	NA
WP_078387219.1|1842253_1843048_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	67.4	6.2e-11
WP_003408092.1|1843096_1846015_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	7.0e-294
WP_003408096.1|1846071_1846329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408099.1|1846344_1847814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003905614.1|1847872_1851391_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	35.8	9.6e-72
WP_003901217.1|1851628_1852234_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	35.3	9.5e-12
>prophage 137
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1858088	1859114	4431885	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003901219.1|1858088_1859114_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	5.1e-26
>prophage 138
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1868101	1869304	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003408163.1|1868101_1869304_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	28.2	8.7e-17
>prophage 139
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1874682	1885891	4431885		Paenibacillus_phage(100.0%)	2	NA	NA
WP_003902218.1|1874682_1881063_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	1.9e-25
WP_003902217.1|1881082_1885891_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.6	4.1e-25
>prophage 140
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1892955	1894731	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003408257.1|1892955_1894731_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.1e-39
>prophage 141
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1911541	1914265	4431885	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_003898975.1|1911541_1912309_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.9e-21
WP_003408373.1|1912367_1912979_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003408375.1|1912990_1914265_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.2	8.0e-61
>prophage 142
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1923217	1926526	4431885		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003408396.1|1923217_1924978_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	1.4e-127
WP_003408399.1|1924970_1925594_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003408401.1|1925590_1926526_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.7e-20
>prophage 143
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1935748	1938230	4431885		Natrialba_phage(50.0%)	3	NA	NA
WP_003898982.1|1935748_1936705_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.4	1.9e-22
WP_003408432.1|1936701_1937538_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003408436.1|1937534_1938230_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.2	2.5e-08
>prophage 144
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1951240	1954023	4431885		Pandoravirus(50.0%)	3	NA	NA
WP_003900395.1|1951240_1952626_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1952658_1953228_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1953252_1954023_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
>prophage 145
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1959392	1960025	4431885		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003408506.1|1959392_1960025_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
>prophage 146
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1968541	1975765	4431885		Tupanvirus(33.33%)	5	NA	NA
WP_003898998.1|1968541_1970242_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1970526_1970928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1970917_1971529_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1971675_1973106_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|1973167_1975765_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
>prophage 147
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	1986377	1988449	4431885	integrase,transposase	Burkholderia_virus(100.0%)	2	1977149:1977164	1991165:1991180
1977149:1977164	attL	AACCCGCCGTCGCCGC	NA	NA	NA	NA
WP_087902221.1|1986377_1987639_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|1988209_1988449_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
1991165:1991180	attR	GCGGCGACGGCGGGTT	NA	NA	NA	NA
>prophage 148
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2006806	2012499	4431885		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003899021.1|2006806_2008327_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2008323_2012499_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
>prophage 149
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2022795	2030487	4431885	protease	Mycobacterium_phage(100.0%)	5	NA	NA
WP_003408854.1|2022795_2024553_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
WP_003408859.1|2024549_2025770_+	type VII secretion system ESX-5 subunit EccE5	NA	NA	NA	NA	NA
WP_003408868.1|2025766_2027599_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	31.0	3.1e-66
WP_003899024.1|2028225_2028417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901256.1|2028519_2030487_+	PPE family protein PPE28	NA	A0A222ZKN7	Mycobacterium_phage	31.7	2.2e-17
>prophage 150
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2042509	2043214	4431885		Bacillus_virus(100.0%)	1	NA	NA
WP_003899032.1|2042509_2043214_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	3.8e-12
>prophage 151
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2051883	2053803	4431885		Bacillus_virus(100.0%)	1	NA	NA
WP_031709287.1|2051883_2053803_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.2	1.1e-05
>prophage 152
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2064895	2067721	4431885		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003900418.1|2064895_2067721_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	3.0e-257
>prophage 153
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2081277	2084201	4431885		Klosneuvirus(50.0%)	2	NA	NA
WP_003900420.1|2081277_2082714_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.1	3.1e-45
WP_025234866.1|2082749_2084201_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.6	6.6e-35
>prophage 154
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2095586	2099598	4431885		Planktothrix_phage(50.0%)	4	NA	NA
WP_003899051.1|2095586_2096696_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.0e-19
WP_003409337.1|2096748_2097726_+	alanine and proline-rich secreted protein Apa	NA	NA	NA	NA	NA
WP_003409339.1|2098177_2098483_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003409345.1|2098557_2099598_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.9	1.6e-19
>prophage 155
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2112187	2116981	4431885		Bodo_saltans_virus(50.0%)	6	NA	NA
WP_003409385.1|2112187_2112625_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	39.8	5.6e-14
WP_003904723.1|2112697_2113384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899059.1|2113394_2113838_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003910872.1|2113843_2114056_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003409398.1|2114353_2114833_+	bacterioferritin BfrA	NA	NA	NA	NA	NA
WP_003899060.1|2114917_2116981_+	MFS-type transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	3.2e-19
>prophage 156
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2122759	2124896	4431885		Macacine_betaherpesvirus(100.0%)	3	NA	NA
WP_003409420.1|2122759_2123290_-	resuscitation-promoting factor RpfC	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	2.7e-95
WP_003899064.1|2123301_2123901_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003409456.1|2123918_2124896_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	99.7	1.1e-190
>prophage 157
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2134252	2139358	4431885		Scale_drop_disease_virus(33.33%)	4	NA	NA
WP_003899068.1|2134252_2135329_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	32.5	3.9e-08
WP_003409539.1|2135328_2136717_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_003900426.1|2136745_2138038_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	9.7e-14
WP_031709290.1|2138089_2139358_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	1.8e-12
>prophage 158
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2155887	2157149	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2155887_2157149_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 159
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2165563	2166679	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003409667.1|2165563_2166679_+	lipoprotein	NA	S5Z991	Mycobacterium_phage	29.7	1.9e-18
>prophage 160
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2171946	2172714	4431885		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003409686.1|2171946_2172714_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	1.9e-17
>prophage 161
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2179992	2185164	4431885		Synechococcus_phage(50.0%)	4	NA	NA
WP_003409714.1|2179992_2182512_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	34.9	7.7e-07
WP_003902252.1|2182523_2183594_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003409718.1|2183590_2184106_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003899092.1|2184102_2185164_+	riboflavin biosynthesis protein RibA	NA	A0A2H4PQS2	Staphylococcus_phage	33.9	3.1e-34
>prophage 162
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2220211	2221180	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899116.1|2220211_2221180_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.2	2.2e-127
>prophage 163
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2230982	2233298	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899120.1|2230982_2233298_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
>prophage 164
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2243650	2244433	4431885		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003410047.1|2243650_2244433_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
>prophage 165
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2259660	2262387	4431885	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_087902221.1|2259660_2260922_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003918359.1|2260999_2261350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410103.1|2261346_2262387_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
>prophage 166
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2266688	2272589	4431885		Gordonia_phage(50.0%)	2	NA	NA
WP_003410136.1|2266688_2267585_-	hypothetical protein	NA	A0A1B3AYM4	Gordonia_phage	34.7	1.8e-35
WP_003900451.1|2267768_2272589_-	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	23.0	6.4e-34
>prophage 167
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2278788	2281280	4431885		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003410178.1|2278788_2280834_-	hypothetical protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	26.5	3.7e-07
WP_003410189.1|2280845_2281280_-	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	35.0	3.3e-06
>prophage 168
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2285094	2287144	4431885		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003410214.1|2285094_2286069_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.5	6.6e-15
WP_003410218.1|2286070_2287144_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.5e-23
>prophage 169
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2292032	2293568	4431885		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_003899145.1|2292032_2293568_-	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	31.9	3.6e-15
>prophage 170
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2310478	2313103	4431885		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_003902238.1|2310478_2313103_-	apolipoprotein N-acyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.3	1.0e-25
>prophage 171
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2328233	2329157	4431885		Salmonella_phage(100.0%)	1	NA	NA
WP_003410677.1|2328233_2329157_-	class A beta-lactamase BlaA	NA	A0A1B0VBP7	Salmonella_phage	42.2	2.7e-50
>prophage 172
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2335670	2336642	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899159.1|2335670_2336642_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	34.9	1.3e-15
>prophage 173
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2346770	2354300	4431885		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003905749.1|2346770_2348540_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.4	6.4e-16
WP_003905750.1|2348556_2349684_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011799244.1|2349732_2350800_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.8	6.1e-14
WP_003410762.1|2350803_2351538_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_003899167.1|2351579_2354300_-	RNA helicase	NA	M1HCW4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.3e-71
>prophage 174
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2362550	2369159	4431885	transposase	Yellowstone_lake_phycodnavirus(50.0%)	6	NA	NA
WP_003899171.1|2362550_2365592_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.3	1.0e-37
WP_003899172.1|2365584_2366418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003905754.1|2366396_2366831_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003410814.1|2366837_2367092_-	antitoxin	NA	NA	NA	NA	NA
WP_003410816.1|2367107_2367365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2367898_2369159_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 175
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2376827	2378657	4431885		Lymphocystis_disease_virus(100.0%)	1	NA	NA
WP_003411035.1|2376827_2378657_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	39.1	3.5e-33
>prophage 176
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2393580	2394825	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003411091.1|2393580_2394825_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	35.5	1.1e-30
>prophage 177
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2439067	2443444	4431885	transposase	Pandoravirus(50.0%)	5	NA	NA
WP_003899202.1|2439067_2440267_+	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	30.0	8.7e-17
WP_003899203.1|2440408_2441074_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_151896144.1|2441007_2441190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411323.1|2441458_2442847_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_003411331.1|2442937_2443444_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A142UMD2	Mycobacterium_phage	44.0	1.9e-26
>prophage 178
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2449286	2457870	4431885		Catovirus(25.0%)	7	NA	NA
WP_003901348.1|2449286_2451089_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.1e-50
WP_003411369.1|2451119_2452277_-	GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase	NA	NA	NA	NA	NA
WP_003411371.1|2452373_2453147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411373.1|2453241_2454399_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.6	2.0e-18
WP_003411376.1|2454584_2454836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901350.1|2454945_2456883_+	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	33.9	9.4e-13
WP_003411387.1|2456757_2457870_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	8.6e-43
>prophage 179
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2466066	2468025	4431885		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003411413.1|2466066_2468025_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	28.2	7.3e-21
>prophage 180
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2479407	2482771	4431885		Mycoplasma_phage(50.0%)	2	NA	NA
WP_003899220.1|2479407_2480955_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	8.6e-33
WP_003411445.1|2480992_2482771_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	25.9	1.4e-07
>prophage 181
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2502713	2503808	4431885		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003899226.1|2502713_2503808_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	33.3	1.1e-05
>prophage 182
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2533263	2534349	4431885		Synechococcus_phage(100.0%)	1	NA	NA
WP_003899236.1|2533263_2534349_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.2	2.5e-31
>prophage 183
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2547190	2548060	4431885	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003411681.1|2547190_2548060_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	26.1	2.4e-08
>prophage 184
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2552122	2553781	4431885		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_045245504.1|2552122_2553781_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
>prophage 185
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2569010	2570954	4431885		Catovirus(100.0%)	1	NA	NA
WP_003411855.1|2569010_2570954_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.2	1.0e-107
>prophage 186
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2578455	2582731	4431885	integrase	Mycobacterium_phage(66.67%)	7	2572841:2572854	2584160:2584173
2572841:2572854	attL	TCGAGGTGCGCTCC	NA	NA	NA	NA
WP_003899265.1|2578455_2578887_-	hypothetical protein	NA	A0A076GDT8	Mycobacterium_phage	47.1	2.0e-16
WP_003902166.1|2578979_2579162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902167.1|2579370_2580087_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_003411888.1|2580096_2580429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899267.1|2580794_2581250_-|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	47.2	3.6e-24
WP_003902168.1|2581996_2582284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411901.1|2582386_2582731_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.3	7.3e-09
2584160:2584173	attR	GGAGCGCACCTCGA	NA	NA	NA	NA
>prophage 187
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2597757	2599851	4431885		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003411969.1|2597757_2599851_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	1.6e-05
>prophage 188
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2608699	2609632	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899275.1|2608699_2609632_+	O-acetylserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	53.4	2.4e-83
>prophage 189
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2620435	2622355	4431885		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_003412049.1|2620435_2622355_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	30.3	1.4e-32
>prophage 190
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2634003	2635264	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2634003_2635264_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 191
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2640404	2644200	4431885	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_003412200.1|2640404_2641796_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.4	7.7e-49
WP_003412205.1|2641977_2642385_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003899290.1|2642381_2642774_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003412208.1|2642881_2643310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003412212.1|2643309_2644200_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	38.3	1.0e-17
>prophage 192
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2649647	2654719	4431885		Pseudomonas_phage(50.0%)	6	NA	NA
WP_003412235.1|2649647_2650706_-	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.1e-47
WP_003902257.1|2650677_2650980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899293.1|2650976_2652290_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003901386.1|2652382_2652670_+	PE family protein	NA	NA	NA	NA	NA
WP_003900509.1|2652768_2653557_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003899294.1|2653570_2654719_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	1.0e-22
>prophage 193
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2658431	2667994	4431885		Tupanvirus(100.0%)	2	NA	NA
WP_003412267.1|2658431_2662817_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	1.8e-51
WP_003899297.1|2662798_2667994_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-82
>prophage 194
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2672324	2676569	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003902259.1|2672324_2676569_-	phenyloxazoline synthase MbtB	NA	A0A2K9KZV5	Tupanvirus	26.1	2.3e-43
>prophage 195
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2683979	2684444	4431885		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003412293.1|2683979_2684444_-	resuscitation-promoting factor RpfD	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-83
>prophage 196
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2694640	2695696	4431885		Bacillus_virus(100.0%)	1	NA	NA
WP_003412325.1|2694640_2695696_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	1.3e-29
>prophage 197
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2702018	2703980	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003900516.1|2702018_2703980_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	8.6e-22
>prophage 198
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2724961	2726209	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412516.1|2724961_2726209_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	3.3e-91
>prophage 199
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2737633	2738764	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412568.1|2737633_2738764_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.8e-51
>prophage 200
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2745830	2752697	4431885	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003412592.1|2745830_2746241_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	2.6e-29
WP_003412596.1|2746283_2746655_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003899324.1|2746651_2748115_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003899325.1|2748111_2750742_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	7.0e-144
WP_003412609.1|2750829_2752089_-	enoyl reductase	NA	NA	NA	NA	NA
WP_003905853.1|2752178_2752697_-	resuscitation-promoting factor rpfE	NA	A0A1J0GVU2	Streptomyces_phage	82.9	2.5e-29
>prophage 201
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2758724	2760005	4431885	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_003412634.1|2758724_2760005_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	4.2e-142
>prophage 202
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2763047	2764291	4431885	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003412648.1|2763047_2763692_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	31.4	5.2e-08
WP_003412650.1|2763688_2764291_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	1.2e-38
>prophage 203
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2767375	2773552	4431885		Bacillus_phage(33.33%)	7	NA	NA
WP_003412657.1|2767375_2768182_-	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	28.9	6.5e-08
WP_003899332.1|2768187_2768676_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_003412664.1|2768777_2769401_-	Rv2466c family mycothiol-dependent reductase	NA	NA	NA	NA	NA
WP_003412666.1|2769502_2772088_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.2	3.6e-44
WP_003412669.1|2772160_2772664_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003412671.1|2772614_2772848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899334.1|2772883_2773552_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.2	1.2e-18
>prophage 204
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2782882	2785146	4431885		Tupanvirus(50.0%)	2	NA	NA
WP_003412708.1|2782882_2784559_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.4e-44
WP_003900529.1|2784639_2785146_-	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	31.2	1.4e-08
>prophage 205
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2791881	2793147	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003902276.1|2791881_2793147_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	38.8	2.0e-35
>prophage 206
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2816043	2820755	4431885		Pike_perch_iridovirus(50.0%)	4	NA	NA
WP_003905871.1|2816043_2817633_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
WP_003412782.1|2817629_2818286_-	succinyl-CoA--3-ketoacid CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003412786.1|2818282_2819029_-	succinyl-CoA--3-ketoacid CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003899357.1|2819111_2820755_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	2.1e-29
>prophage 207
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2824646	2828962	4431885	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2824646_2826248_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2826315_2826963_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2827714_2828962_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 208
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2837279	2841594	4431885	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2837279_2838881_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2838948_2839596_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2840346_2841594_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 209
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2861642	2862365	4431885		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003412957.1|2861642_2862365_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	50.7	4.1e-54
>prophage 210
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2874992	2876198	4431885		Pandoravirus(100.0%)	1	NA	NA
WP_003413027.1|2874992_2876198_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.9	1.6e-47
>prophage 211
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2885556	2891715	4431885	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_003902305.1|2885556_2888271_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.5	4.8e-63
WP_003413208.1|2888361_2888751_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_003899374.1|2888857_2889532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413213.1|2889616_2890327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899376.1|2890356_2891715_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.8e-80
>prophage 212
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2895126	2896119	4431885		Planktothrix_phage(100.0%)	1	NA	NA
WP_003901426.1|2895126_2896119_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	9.4e-33
>prophage 213
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2911123	2912005	4431885		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003899384.1|2911123_2912005_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	48.0	3.2e-53
>prophage 214
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2915423	2936018	4431885	tRNA	Klosneuvirus(22.22%)	14	NA	NA
WP_003413363.1|2915423_2916326_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.0	4.2e-56
WP_003413365.1|2916605_2917877_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	23.1	4.0e-12
WP_003413366.1|2917873_2918548_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.3	6.8e-19
WP_003413367.1|2918598_2919525_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	34.2	2.3e-09
WP_003413368.1|2919610_2921983_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_003413369.1|2922013_2922685_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	32.2	3.1e-11
WP_003413373.1|2922788_2924462_-	lipoprotein	NA	NA	NA	NA	NA
WP_003899387.1|2924467_2925796_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.7	2.9e-21
WP_003413385.1|2925799_2927521_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003413391.1|2927630_2927978_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003413395.1|2928144_2929494_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	5.0e-21
WP_003413409.1|2929655_2933162_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.6	3.9e-17
WP_009940036.1|2933335_2934967_+	PE family protein	NA	NA	NA	NA	NA
WP_003413416.1|2934983_2936018_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	7.0e-07
>prophage 215
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2940172	2941744	4431885		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003899392.1|2940172_2941744_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.2	5.1e-09
>prophage 216
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2952973	2991245	4431885	protease,capsid,tRNA,integrase,head,terminase	Mycobacterium_phage(30.0%)	48	2981774:2981801	2991398:2991425
WP_003413486.1|2952973_2955052_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2955160_2955388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2955384_2956770_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2957114_2957615_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2957631_2958072_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2958218_2958896_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2958880_2959234_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2959246_2959672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2959668_2960343_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2960420_2961242_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2961377_2962271_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2962273_2963092_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2963106_2964288_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2964346_2964778_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2965291_2966533_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2966842_2967205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2967551_2968676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2968677_2969217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2969356_2970655_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2970693_2970975_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2971119_2971605_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2971631_2971889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2971889_2974226_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2974254_2974497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2974497_2975175_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2975370_2976027_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2976189_2976636_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2976810_2977143_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2977262_2977622_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2977723_2978182_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2978317_2978698_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2978694_2980191_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2980380_2980617_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2980689_2980863_+	hypothetical protein	NA	NA	NA	NA	NA
2981774:2981801	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2981907_2982339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2982335_2983334_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2983347_2983812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2983799_2984051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2984221_2985661_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2985668_2986202_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2986354_2986981_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2987012_2987336_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2987415_2987661_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2987657_2989085_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2989086_2989479_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2989475_2989736_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2989752_2990115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2990117_2991245_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2991398:2991425	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 217
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	2994322	2995081	4431885	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003413845.1|2994322_2995081_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
>prophage 218
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3003115	3004474	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003413871.1|3003115_3004474_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	37.4	2.4e-07
>prophage 219
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3015430	3016336	4431885		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003413913.1|3015430_3016336_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.2e-13
>prophage 220
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3024258	3024723	4431885		Streptomyces_phage(100.0%)	1	NA	NA
WP_003413930.1|3024258_3024723_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	47.6	9.4e-28
>prophage 221
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3028410	3046669	4431885		Cyanophage(28.57%)	21	NA	NA
WP_003413944.1|3028410_3029997_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	4.6e-42
WP_003899440.1|3030033_3030462_+	RidA family protein	NA	NA	NA	NA	NA
WP_003413947.1|3030389_3030779_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003902340.1|3030775_3031033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413953.1|3031148_3032123_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003899441.1|3032123_3032372_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	47.5	8.3e-15
WP_003910933.1|3032414_3032852_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_003413958.1|3033027_3033999_+	RNA polymerase sigma factor SigB	NA	M4SMP8	Cyanophage	35.7	6.6e-39
WP_003413962.1|3034131_3034824_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003905914.1|3034836_3035895_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003900556.1|3036007_3037414_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.4e-42
WP_003901455.1|3037631_3038606_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003900558.1|3038664_3039690_+	alpha/beta hydrolase	NA	G1DAB1	Mycobacterium_virus	30.0	9.7e-17
WP_003413971.1|3039738_3040425_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003900559.1|3040433_3040928_-	FABP family protein	NA	NA	NA	NA	NA
WP_003413973.1|3040979_3041444_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003413974.1|3041606_3042104_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899448.1|3042354_3043065_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	8.0e-10
WP_003900560.1|3043086_3045186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902343.1|3045201_3045450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413979.1|3045475_3046669_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	33.3	8.4e-28
>prophage 222
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3057387	3061991	4431885		Mycobacterium_phage(66.67%)	4	NA	NA
WP_003899455.1|3057387_3058242_+	DUF5131 family protein	NA	A0A088F7U1	Mycobacterium_phage	48.6	1.8e-64
WP_003899456.1|3058126_3059119_-	three-Cys-motif partner protein TcmP	NA	A0A142KCL9	Gordonia_phage	60.3	3.0e-108
WP_003905919.1|3059128_3059653_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003414006.1|3059618_3061991_-	intein-containing recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	50.0	5.2e-21
>prophage 223
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3070421	3073073	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414040.1|3070421_3073073_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	57.9	4.2e-112
>prophage 224
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3077759	3080650	4431885		Rhodococcus_phage(50.0%)	3	NA	NA
WP_003899465.1|3077759_3078512_-	FAD-dependent thymidylate synthase	NA	M9MU99	Rhodococcus_phage	47.4	4.9e-50
WP_003414055.1|3078755_3079031_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003414057.1|3079027_3080650_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	5.9e-08
>prophage 225
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3083696	3085047	4431885		Ralstonia_phage(50.0%)	2	NA	NA
WP_003414073.1|3083696_3084176_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	38.6	6.8e-21
WP_003911953.1|3084246_3085047_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	70.5	2.2e-109
>prophage 226
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3099611	3100928	4431885		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_003414119.1|3099611_3100928_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	24.4	5.4e-28
>prophage 227
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3110768	3112729	4431885	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003899482.1|3110768_3112148_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3112147_3112729_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
>prophage 228
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3130856	3132117	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3130856_3132117_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 229
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3142336	3143419	4431885		Bacillus_virus(100.0%)	1	NA	NA
WP_003414499.1|3142336_3143419_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
>prophage 230
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3149408	3152111	4431885		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003899505.1|3149408_3152111_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
>prophage 231
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3157276	3158869	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414532.1|3157276_3158869_-	multidrug efflux MFS transporter EfpA	NA	A0A0M3UL24	Mycobacterium_phage	33.0	7.7e-45
>prophage 232
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3169443	3175885	4431885		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_003414557.1|3169443_3170823_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.1e-34
WP_003414559.1|3170922_3172041_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003414562.1|3172106_3172439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414566.1|3172450_3172666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099171521.1|3172586_3172769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414570.1|3172821_3173598_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.0e-15
WP_003900585.1|3173594_3174962_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003900586.1|3174958_3175885_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	32.5	4.2e-11
>prophage 233
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3198519	3200723	4431885	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003901487.1|3198519_3199839_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	29.4	4.1e-28
WP_003899526.1|3199835_3200723_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	27.3	2.6e-10
>prophage 234
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3207684	3208581	4431885		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003414689.1|3207684_3208581_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.9	3.1e-19
>prophage 235
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3216452	3217247	4431885		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003414713.1|3216452_3217247_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	26.9	7.1e-07
>prophage 236
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3222628	3239101	4431885		Erythrobacter_phage(20.0%)	11	NA	NA
WP_023644660.1|3222628_3223504_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	4.4e-10
WP_003414739.1|3223563_3224151_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899536.1|3224152_3225988_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003900593.1|3226056_3227814_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	23.4	1.3e-05
WP_003899537.1|3227857_3228970_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003414748.1|3228997_3230575_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003414750.1|3230652_3232533_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	41.0	3.9e-88
WP_003899539.1|3232543_3234970_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003414756.1|3235027_3235366_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003899540.1|3235362_3236796_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.8	1.4e-40
WP_003899541.1|3237832_3239101_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.5	1.5e-11
>prophage 237
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3243559	3245510	4431885		Bacillus_phage(50.0%)	2	NA	NA
WP_003414814.1|3243559_3244429_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	25.1	1.1e-13
WP_003414820.1|3244787_3245510_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.4	1.9e-22
>prophage 238
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3250403	3272690	4431885		Paenibacillus_phage(100.0%)	4	NA	NA
WP_003902374.1|3250403_3256034_+	phthiocerol type I polyketide synthase PpsA	NA	D0R7J2	Paenibacillus_phage	29.8	2.7e-28
WP_003899547.1|3256030_3260647_+	phthiocerol type I polyketide synthase PpsB	NA	D0R7J2	Paenibacillus_phage	36.3	1.1e-32
WP_003414837.1|3260643_3267210_+	phthiocerol type I polyketide synthase PpsC	NA	D0R7J2	Paenibacillus_phage	34.6	1.6e-32
WP_003899549.1|3267206_3272690_+	phthiocerol type I polyketide synthase PpsD	NA	D0R7J2	Paenibacillus_phage	31.6	3.7e-30
>prophage 239
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3277172	3278168	4431885		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003901496.1|3277172_3278168_+	daunorubicin ABC transporter permease DrrB	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	1.5e-22
>prophage 240
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3281338	3287674	4431885		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003901497.1|3281338_3287674_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.3	9.9e-27
>prophage 241
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3312545	3314365	4431885		uncultured_virus(50.0%)	2	NA	NA
WP_003414906.1|3312545_3313511_-	[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha- L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L- rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase	NA	A0A218MM68	uncultured_virus	25.5	1.5e-06
WP_003899556.1|3313633_3314365_+	[alpha-L-fucopyranosyl-(1->3)-alpha-L- rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase	NA	Q58M88	Prochlorococcus_phage	33.3	1.3e-07
>prophage 242
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3321494	3323781	4431885		Synechococcus_phage(50.0%)	3	NA	NA
WP_003901503.1|3321494_3322427_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	2.1e-10
WP_003414994.1|3323066_3323252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414998.1|3323295_3323781_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	9.3e-18
>prophage 243
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3329538	3331915	4431885		Moumouvirus(50.0%)	2	NA	NA
WP_003415015.1|3329538_3330669_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	5.0e-30
WP_003415022.1|3331066_3331915_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	1.0e-56
>prophage 244
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3337034	3340712	4431885	transposase	Pandoravirus(33.33%)	4	NA	NA
WP_003899565.1|3337034_3337718_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	40.7	3.8e-33
WP_003415034.1|3337750_3338752_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_003415037.1|3338748_3340128_-	resolvase	NA	I4AZM3	Saccharomonospora_phage	32.9	2.3e-21
WP_003415039.1|3340127_3340712_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	29.9	1.1e-17
>prophage 245
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3348254	3348899	4431885		Streptomyces_phage(100.0%)	1	NA	NA
WP_003415107.1|3348254_3348899_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	2.8e-14
>prophage 246
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3358561	3360148	4431885		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003899578.1|3358561_3360148_-	D-3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.5	1.2e-34
>prophage 247
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3363690	3368065	4431885		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003415160.1|3363690_3364350_+	ABC transporter permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.2	6.9e-08
WP_003899581.1|3364663_3365665_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003415167.1|3365702_3366209_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003415168.1|3366208_3368065_-	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.3	9.6e-55
>prophage 248
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3373901	3379699	4431885	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003415251.1|3373901_3374933_-	ATP-dependent 6-phosphofructokinase	NA	E5EQL4	Micromonas_sp._RCC1109_virus	24.2	2.3e-13
WP_003900613.1|3375028_3376513_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003415256.1|3376509_3376809_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003901515.1|3376893_3377550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003415263.1|3377623_3379699_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	8.3e-108
>prophage 249
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3383683	3391030	4431885	tRNA,transposase	Burkholderia_virus(33.33%)	7	NA	NA
WP_087902221.1|3383683_3384944_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003415342.1|3384998_3385292_-	type VII secretion system protein EsxS	NA	NA	NA	NA	NA
WP_003910692.1|3385338_3386646_-	PPE family protein	NA	NA	NA	NA	NA
WP_003415766.1|3386642_3386957_-	PE family protein	NA	NA	NA	NA	NA
WP_003901078.1|3387338_3388586_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003415909.1|3388748_3389852_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003415911.1|3389848_3391030_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.6	1.4e-30
>prophage 250
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3407018	3407882	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003415944.1|3407018_3407882_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.7e-07
>prophage 251
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3412248	3424612	4431885		Mycobacterium_phage(28.57%)	13	NA	NA
WP_003415965.1|3412248_3413289_+	NADP-dependent alcohol dehydrogenase C	NA	A0A2K9L7I1	Tupanvirus	41.2	3.7e-72
WP_003415968.1|3413277_3413652_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003902400.1|3413985_3414270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003415973.1|3414367_3415342_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	85.3	8.0e-154
WP_003899895.1|3415472_3417047_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003415979.1|3417180_3417921_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078387223.1|3418048_3420226_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.8e-209
WP_003415981.1|3420195_3420648_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003415982.1|3420682_3420922_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	68.0	3.4e-21
WP_003415983.1|3421384_3421939_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	4.0e-09
WP_003415984.1|3422030_3422645_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899898.1|3422654_3423695_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	31.8	7.1e-15
WP_003415986.1|3423748_3424612_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	2.2e-06
>prophage 252
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3445558	3452006	4431885		Tupanvirus(50.0%)	4	NA	NA
WP_003901535.1|3445558_3447370_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	34.8	9.6e-84
WP_003416059.1|3447370_3447772_+	hydrogenase	NA	NA	NA	NA	NA
WP_003416061.1|3447787_3448615_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003899905.1|3448673_3452006_-	serine/threonine-protein kinase PknK	NA	A0A1M7XTW9	Cedratvirus	28.0	3.0e-14
>prophage 253
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3457798	3465116	4431885		Synechococcus_phage(33.33%)	5	NA	NA
WP_003416075.1|3457798_3458905_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-27
WP_003416076.1|3458942_3460361_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416079.1|3460357_3461782_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416081.1|3461778_3463290_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	5.6e-45
WP_003416086.1|3464228_3465116_+	SPFH domain-containing protein	NA	A0A0M4RAA7	Mycobacterium_phage	50.5	2.8e-68
>prophage 254
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3475318	3477387	4431885		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003416113.1|3475318_3475801_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	1.5e-31
WP_003416117.1|3475803_3476697_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003416120.1|3476697_3477387_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.7	2.5e-32
>prophage 255
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3486777	3489964	4431885	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_003901545.1|3486777_3487308_+	nucleoside deaminase	NA	A0A2I7QX61	Vibrio_phage	39.0	5.8e-05
WP_003904994.1|3487326_3487470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901078.1|3487469_3488717_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003899922.1|3488794_3489964_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.1	1.6e-10
>prophage 256
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3499971	3501233	4431885	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3499971_3501233_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 257
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3549758	3550658	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003416610.1|3549758_3550658_-	alpha/beta hydrolase	NA	A0A1C9LZ53	Mycobacterium_phage	31.1	9.8e-05
>prophage 258
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3555359	3560416	4431885	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_003416628.1|3555359_3556220_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	28.6	7.4e-10
WP_071854247.1|3556314_3556710_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003416635.1|3556949_3557243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416640.1|3557530_3558820_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087902221.1|3559154_3560416_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 259
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3565865	3566900	4431885	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003416786.1|3565865_3566900_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.3	7.0e-31
>prophage 260
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3577663	3585591	4431885		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_003416822.1|3577663_3579766_-	ATP-dependent DNA helicase UvrD2	NA	A0A2H4UW05	Bodo_saltans_virus	24.2	4.9e-15
WP_003416827.1|3579889_3580144_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_003906027.1|3580156_3581098_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003899966.1|3581156_3582224_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003910809.1|3582285_3585591_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	1.8e-08
>prophage 261
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3596351	3600047	4431885		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_003416875.1|3596351_3597935_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.9e-46
WP_003416876.1|3597947_3599171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901572.1|3599246_3600047_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.8	1.3e-16
>prophage 262
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3604267	3608106	4431885		Mycobacterium_phage(50.0%)	7	NA	NA
WP_003416884.1|3604267_3604522_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	8.8e-12
WP_003901574.1|3604583_3606089_-	ATPase	NA	NA	NA	NA	NA
WP_003416887.1|3606105_3606321_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_003416889.1|3606521_3606596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416891.1|3606605_3606911_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_003899976.1|3606907_3607459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003416897.1|3607455_3608106_-	ECF RNA polymerase sigma factor SigH	NA	A0A076YQ50	Rhizobium_phage	26.5	6.8e-08
>prophage 263
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3611118	3611877	4431885		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003416907.1|3611118_3611877_-	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	37.6	1.5e-27
>prophage 264
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3633465	3638203	4431885		Bacillus_phage(66.67%)	4	NA	NA
WP_003906038.1|3633465_3635169_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.3e-18
WP_003899985.1|3635218_3635905_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.6e-39
WP_003417036.1|3635974_3636619_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003417039.1|3636715_3638203_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.2	1.4e-43
>prophage 265
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3648427	3648697	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003417079.1|3648427_3648697_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	81.2	6.4e-29
>prophage 266
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3653453	3661238	4431885		Sphingomonas_phage(33.33%)	7	NA	NA
WP_003417097.1|3653453_3654533_-	NDP-sugar synthase	NA	H9NC64	Sphingomonas_phage	32.6	2.1e-17
WP_003901582.1|3654534_3655440_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003899993.1|3655450_3656365_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	8.4e-28
WP_003417107.1|3656440_3657937_+	LCP family protein	NA	NA	NA	NA	NA
WP_003417112.1|3657975_3658665_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_003417115.1|3658789_3659071_+	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003899995.1|3659081_3661238_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	33.5	6.2e-82
>prophage 267
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3666669	3667194	4431885		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003899997.1|3666669_3667194_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	1.1e-21
>prophage 268
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3676589	3680215	4431885		Bacillus_phage(50.0%)	5	NA	NA
WP_003417158.1|3676589_3677375_-	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	33.2	3.6e-19
WP_003417160.1|3677371_3677809_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_003417162.1|3678006_3678420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417165.1|3678454_3678832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900004.1|3678865_3680215_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	45.5	1.1e-111
>prophage 269
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3685195	3689737	4431885		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003901592.1|3685195_3689737_+	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	37.5	2.6e-05
>prophage 270
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3703342	3704947	4431885		Streptococcus_phage(100.0%)	1	NA	NA
WP_003900011.1|3703342_3704947_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.1	3.4e-48
>prophage 271
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3710662	3711946	4431885		Geobacillus_virus(100.0%)	1	NA	NA
WP_003900016.1|3710662_3711946_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.3	3.8e-79
>prophage 272
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3722474	3813716	4431885	tRNA,transposase	Burkholderia_virus(28.57%)	55	NA	NA
WP_087902221.1|3722474_3723736_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3724029_3724191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3724212_3725742_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3725674_3726613_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3726621_3727989_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3728057_3729275_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3729370_3730879_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3730875_3732027_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3732217_3733063_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3733537_3733978_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3734011_3734881_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3734901_3735912_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3736196_3736829_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3736895_3738125_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3738407_3739757_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3739768_3740908_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3740904_3741636_+	methyltransferase	NA	NA	NA	NA	NA
WP_003417619.1|3759128_3759386_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3759641_3769115_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3769740_3770187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3770223_3771042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3771258_3771546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3783275_3784070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3784151_3784523_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3784420_3784831_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3784665_3784926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3785040_3785430_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3785443_3785737_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3785733_3786579_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3786702_3786978_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3786974_3787232_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3787273_3788464_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3788580_3788949_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3788945_3789497_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3789503_3790085_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3790065_3790434_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3790411_3790804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3790800_3793431_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3793666_3794131_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3794497_3796273_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3796273_3796918_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3796916_3797351_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3797439_3800679_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_031709368.1|3800870_3802205_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3802246_3803422_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3803475_3803580_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3803658_3804300_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3804300_3804549_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3804553_3805981_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3806088_3806742_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3806780_3808286_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3808290_3809181_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003918607.1|3809189_3811028_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417912.1|3811024_3812014_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_087902221.1|3812455_3813716_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 273
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3823490	3824354	4431885		Tupanvirus(100.0%)	1	NA	NA
WP_003900041.1|3823490_3824354_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
>prophage 274
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3837265	3838504	4431885		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003902474.1|3837265_3838504_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
>prophage 275
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3842864	3843164	4431885		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003911013.1|3842864_3843164_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	99.0	1.6e-44
>prophage 276
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3846542	3848132	4431885		Klosneuvirus(100.0%)	1	NA	NA
WP_003901630.1|3846542_3848132_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	6.2e-87
>prophage 277
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3851504	3855202	4431885	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_003418017.1|3851504_3851813_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
WP_003418021.1|3851884_3853504_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
WP_003418028.1|3853598_3853901_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
WP_003900052.1|3854167_3855202_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
>prophage 278
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3860495	3862345	4431885	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003418125.1|3860495_3861251_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	1.5e-22
WP_104591446.1|3861334_3862345_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	7.7e-83
>prophage 279
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3875405	3877280	4431885		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003418289.1|3875405_3877280_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
>prophage 280
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3884917	3888628	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418326.1|3884917_3888628_-	type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
>prophage 281
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3902284	3907534	4431885		Enterobacteria_phage(50.0%)	5	NA	NA
WP_003418607.1|3902284_3903280_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	3.1e-76
WP_003906113.1|3903281_3903890_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	37.8	7.5e-25
WP_003911061.1|3904411_3905368_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003900066.1|3905425_3906520_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	28.0	1.8e-05
WP_003900067.1|3906523_3907534_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.6e-27
>prophage 282
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3920416	3921199	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418925.1|3920416_3921199_-	DUF2510 domain-containing protein	NA	A0A088F7R2	Mycobacterium_phage	63.2	7.0e-07
>prophage 283
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3955129	3956677	4431885		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003900872.1|3955129_3956677_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	33.3	3.9e-09
>prophage 284
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3964510	3965167	4431885		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902513.1|3964510_3965167_-	fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	1.6e-09
>prophage 285
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3970463	3972110	4431885		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003911024.1|3970463_3972110_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.6	2.0e-16
>prophage 286
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3993228	3994140	4431885		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003419251.1|3993228_3994140_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	1.7e-36
>prophage 287
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	3997698	3999138	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003900090.1|3997698_3999138_+	PPE family protein	NA	A0A222ZKN7	Mycobacterium_phage	31.4	1.5e-23
>prophage 288
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4007020	4007935	4431885		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003900711.1|4007020_4007935_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.4e-11
>prophage 289
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4012323	4014381	4431885		Synechococcus_phage(100.0%)	1	NA	NA
WP_003901670.1|4012323_4014381_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	36.8	6.3e-07
>prophage 290
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4021275	4022799	4431885		Hepacivirus(100.0%)	1	NA	NA
WP_003900098.1|4021275_4022799_+	3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase	NA	Q75ZG1	Hepacivirus	27.4	3.9e-38
>prophage 291
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4042032	4043442	4431885	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003900108.1|4042032_4043442_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	7.8e-41
>prophage 292
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4055495	4062578	4431885	tRNA,protease	Mycobacterium_virus(25.0%)	4	NA	NA
WP_003419504.1|4055495_4056323_+	hypothetical protein	NA	G8I9P6	Mycobacterium_virus	63.9	2.9e-96
WP_003419511.1|4057795_4060342_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	1.8e-128
WP_003419513.1|4060618_4060957_-	nucleoid-associated protein	NA	A0A2D1GPL8	Mycobacterium_phage	42.4	4.6e-16
WP_003901683.1|4061060_4062578_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	34.5	1.1e-69
>prophage 294
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4138037	4138493	4431885		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003419733.1|4138037_4138493_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.6	4.9e-21
>prophage 295
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4141518	4141875	4431885		Tsukamurella_phage(100.0%)	1	NA	NA
WP_003419743.1|4141518_4141875_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	1.8e-10
>prophage 296
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4147613	4149044	4431885		Mollivirus(100.0%)	1	NA	NA
WP_003419754.1|4147613_4149044_-	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	31.6	2.6e-23
>prophage 297
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4170348	4171359	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003419818.1|4170348_4171359_-	DUF4185 domain-containing protein	NA	B5LJL4	Mycobacterium_phage	31.5	7.9e-11
>prophage 298
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4184054	4187050	4431885		Tupanvirus(50.0%)	2	NA	NA
WP_003420415.1|4184054_4185317_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.0	1.4e-36
WP_003420417.1|4185313_4187050_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	1.7e-42
>prophage 299
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4190532	4191534	4431885		Vaccinia_virus(100.0%)	1	NA	NA
WP_003911033.1|4190532_4191534_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q1M1E9	Vaccinia_virus	34.4	1.2e-08
>prophage 300
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4202077	4203154	4431885		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003420435.1|4202077_4203154_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	28.2	2.7e-17
>prophage 301
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4213710	4220025	4431885	integrase	Acidithiobacillus_phage(40.0%)	10	4213727:4213741	4219599:4219613
WP_003899665.1|4213710_4215693_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	8.8e-91
4213727:4213741	attL	CCAGCGGCGCGGCGC	NA	NA	NA	NA
WP_003901716.1|4215759_4216122_+	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR	NA	NA	NA	NA	NA
WP_003899668.1|4216205_4216418_-	DUF2237 family protein	NA	NA	NA	NA	NA
WP_003899670.1|4216490_4216826_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003899671.1|4217043_4217427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899672.1|4217556_4217916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899673.1|4217948_4218458_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	42.6	4.0e-11
WP_003420504.1|4218525_4218918_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	47.0	4.8e-17
WP_071854238.1|4219181_4219409_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	72.4	1.5e-15
WP_003420508.1|4219566_4220025_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.2e-05
4219599:4219613	attR	CCAGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 302
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4223606	4233299	4431885		Planktothrix_phage(20.0%)	9	NA	NA
WP_003906205.1|4223606_4224737_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.9e-20
WP_003901718.1|4224745_4225693_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003420534.1|4225857_4226160_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003420539.1|4226181_4227237_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003900750.1|4227315_4229196_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	7.5e-140
WP_003420544.1|4229366_4229846_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_003906207.1|4229901_4231329_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.3e-06
WP_003420552.1|4231399_4232104_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.9e-35
WP_003901719.1|4232612_4233299_+	hypothetical protein	NA	A0A2P1CG82	Mycobacterium_phage	54.1	4.6e-55
>prophage 303
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4237450	4238512	4431885		Pacmanvirus(100.0%)	1	NA	NA
WP_003420576.1|4237450_4238512_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	4.7e-14
>prophage 304
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4247844	4253824	4431885		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003420603.1|4247844_4248666_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	5.4e-10
WP_003906213.1|4248662_4249577_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003420610.1|4249573_4250416_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003420612.1|4250571_4251552_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.5	1.2e-32
WP_003420618.1|4252600_4253824_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	31.4	3.4e-08
>prophage 305
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4283581	4286886	4431885		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_003420779.1|4283581_4284592_-	cutinase family protein	NA	A0A2K9VEH2	Gordonia_phage	28.6	6.9e-07
WP_003420783.1|4284790_4285690_-	MPT51/MPB51 antigen	NA	A0A2I6AZH7	Macacine_betaherpesvirus	38.4	5.1e-46
WP_003900759.1|4285869_4286886_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	1.3e-178
>prophage 306
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4292503	4296645	4431885		Streptococcus_phage(50.0%)	3	NA	NA
WP_003420798.1|4292503_4293703_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.5	8.8e-86
WP_003420801.1|4293966_4294821_+	exported repetitive protein	NA	NA	NA	NA	NA
WP_003420805.1|4295025_4296645_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	39.4	1.1e-06
>prophage 307
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4306948	4308163	4431885		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899709.1|4306948_4308163_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	35.6	3.7e-23
>prophage 308
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4313452	4319833	4431885		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003900763.1|4313452_4319833_-	phthioceranic/hydroxyphthioceranic acid synthase	NA	D0R7J2	Paenibacillus_phage	30.1	4.6e-24
>prophage 309
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4327884	4329144	4431885	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003420889.1|4327884_4329144_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	33.8	7.7e-56
>prophage 310
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4340933	4341557	4431885		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003399735.1|4340933_4341557_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	1.2e-33
>prophage 311
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4363541	4375291	4431885		Mycobacterium_phage(40.0%)	9	NA	NA
WP_003399850.1|4363541_4365263_+	type VII secretion system ESX-1 AAA family ATPase EccA1	NA	V5UQM2	Mycobacterium_phage	33.2	8.6e-58
WP_003399854.1|4365266_4366709_+	type VII secretion system ESX-1 subunit EccB1	NA	NA	NA	NA	NA
WP_003899738.1|4366708_4368952_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1	NA	A0A142F150	Bacillus_phage	28.6	7.6e-14
WP_003399865.1|4369107_4370883_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1	NA	A0A1P8DJB2	Virus_Rctr71	26.7	1.4e-07
WP_003399870.1|4371025_4371322_+	type VII secretion system ESX-1 target PE35	NA	NA	NA	NA	NA
WP_003399879.1|4371355_4372462_+	type VII secretion system ESX-1 target PPE68	NA	NA	NA	NA	NA
WP_003399940.1|4372554_4372857_+	type VII secretion system ESX-1 WXG100 family target CFP-10	NA	NA	NA	NA	NA
WP_003399963.1|4372889_4373177_+	type VII secretion system ESX-1 WXG100 family target ESAT-6	NA	A0A2I6AZH7	Macacine_betaherpesvirus	100.0	1.4e-45
WP_003909105.1|4373290_4375291_+	type VII secretion system ESX-1 associated protein EspI	NA	V5UPR8	Mycobacterium_phage	28.8	4.4e-21
>prophage 312
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4383733	4390487	4431885	protease	Mycobacterium_phage(100.0%)	4	NA	NA
WP_003400004.1|4383733_4385074_-|protease	type VII secretion system ESX-1 serine protease mycosin MycP1	protease	V5UPA7	Mycobacterium_phage	41.0	1.4e-79
WP_003400005.1|4385295_4387155_-	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	29.3	2.5e-47
WP_031709332.1|4387224_4388838_-	type VII secretion system ESX-2 subunit EccE2	NA	NA	NA	NA	NA
WP_003400012.1|4388834_4390487_-|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	V5UPA7	Mycobacterium_phage	36.6	1.1e-67
>prophage 313
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4400768	4403167	4431885		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031709335.1|4400768_4402256_-	type VII secretion system ESX-2 subunit EccB2	NA	V5UN45	Mycobacterium_phage	37.2	7.6e-71
WP_003899753.1|4402258_4403167_-	transglycosylase	NA	A0A2H4PIU8	Corynebacterium_phage	46.1	2.4e-11
>prophage 314
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4411951	4413394	4431885	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400120.1|4411951_4413394_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	37.3	7.7e-60
>prophage 315
NZ_CP017595	Mycobacterium tuberculosis strain Beijing-like/38774 chromosome, complete genome	4431885	4422047	4427851	4431885		Orpheovirus(25.0%)	6	NA	NA
WP_003900782.1|4422047_4423055_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.2	1.1e-68
WP_003400164.1|4423051_4423402_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.8	3.9e-26
WP_003400168.1|4423511_4424732_+	hydrolase	NA	Q0H257	Geobacillus_phage	29.2	2.6e-08
WP_003400171.1|4424752_4425487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400175.1|4425776_4426811_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_078387225.1|4426807_4427851_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	1.4e-23
