The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	0	20087	4427062	transposase	Burkholderia_virus(12.5%)	17	NA	NA
WP_087902221.1|1612_2873_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003400271.1|3376_4585_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	38.9	1.5e-64
WP_003899768.1|4604_5762_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003899769.1|5758_6322_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_003917863.1|6564_8592_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.4e-131
WP_003400286.1|8626_11143_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	1.5e-87
WP_031709324.1|11238_12153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400294.1|12549_12741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400297.1|12879_13017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400307.1|13198_13636_-	cell wall synthesis protein CwsA	NA	NA	NA	NA	NA
WP_003400321.1|13792_14341_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.5e-24
WP_003899772.1|14457_14883_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003400344.1|15038_15320_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003901765.1|15413_16202_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_003400352.1|16238_16937_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.0e-42
WP_003902584.1|16914_18795_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	35.1	8.0e-17
WP_003906262.1|18791_20087_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	28.8	6.7e-15
>prophage 2
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	29655	30513	4427062		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003901769.1|29655_30513_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	54.3	1.4e-21
>prophage 3
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	35600	37916	4427062		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003901773.1|35600_37916_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.5	5.2e-34
>prophage 4
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	45035	47945	4427062	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902585.1|45035_47945_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.6	2.1e-210
>prophage 5
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	51492	52596	4427062		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003400492.1|51492_52596_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.4	1.4e-74
>prophage 6
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	60066	69864	4427062		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_003400534.1|60066_60561_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	73.8	1.4e-58
WP_003400540.1|60602_60857_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003400543.1|60889_61348_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003900797.1|61376_61898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400547.1|61876_64501_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	47.5	4.9e-20
WP_003400548.1|64680_65373_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003400551.1|65389_66448_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	38.5	2.1e-22
WP_003400562.1|67032_68175_+	cellulase CelA	NA	NA	NA	NA	NA
WP_003902591.1|68403_69864_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.6	1.2e-20
>prophage 7
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	79128	80406	4427062		Aeromonas_phage(100.0%)	1	NA	NA
WP_003899799.1|79128_80406_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.2	2.5e-86
>prophage 8
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	98635	100921	4427062		uncultured_virus(100.0%)	1	NA	NA
WP_003899808.1|98635_100921_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	1.9e-84
>prophage 9
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	106211	120229	4427062		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003400792.1|106211_107834_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	3.2e-14
WP_003400793.1|107838_108075_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003400794.1|108056_115595_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	2.2e-81
WP_003900808.1|115769_117755_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003400797.1|117970_120229_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	3.5e-83
>prophage 10
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	123720	128598	4427062		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003899815.1|123720_128598_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	30.1	5.4e-41
>prophage 11
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	132007	141934	4427062		Synechococcus_phage(40.0%)	9	NA	NA
WP_003900811.1|132007_134065_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.6	2.3e-41
WP_003910039.1|134346_135303_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	31.0	1.3e-36
WP_003400839.1|135376_135967_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.1	6.4e-13
WP_003400840.1|135998_136571_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003902603.1|136570_137731_+	D-alpha-D-heptose-7-phosphate kinase hddA	NA	A0A222YW25	Synechococcus_phage	37.4	2.1e-55
WP_003400850.1|138013_138202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400856.1|138324_139080_-	L,D-transpeptidase LdtMt1	NA	NA	NA	NA	NA
WP_003906284.1|139257_140202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003400858.1|140185_141934_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.7	1.2e-27
>prophage 12
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	154797	155820	4427062		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003400908.1|154797_155820_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	70.3	1.9e-129
>prophage 13
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	159088	162910	4427062		Human_cytomegalovirus(50.0%)	3	NA	NA
WP_003400924.1|159088_159694_+	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	32.5	1.6e-19
WP_003400935.1|160862_161468_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003906289.1|161584_162910_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.2	4.6e-19
>prophage 14
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	175761	177528	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400998.1|175761_177528_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	39.0	1.0e-21
>prophage 15
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	185651	187058	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401047.1|185651_187058_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.5	2.0e-20
>prophage 16
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	190202	194878	4427062		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_003401058.1|190202_191354_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	7.8e-31
WP_003401060.1|191335_191791_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003401063.1|191844_192330_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003401065.1|192343_193036_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899837.1|193213_194878_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.7e-34
>prophage 17
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	223048	223711	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|223048_223711_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 18
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	231221	234806	4427062		Bacillus_phage(100.0%)	1	NA	NA
WP_003902618.1|231221_234806_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-44
>prophage 19
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	238862	240854	4427062	protease	Klosneuvirus(100.0%)	1	NA	NA
WP_003401172.1|238862_240854_-|protease	zinc metalloprotease	protease	A0A1V0SHG2	Klosneuvirus	38.5	3.2e-80
>prophage 20
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	258015	258987	4427062		Serratia_phage(100.0%)	1	NA	NA
WP_003401213.1|258015_258987_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A1S6UB31	Serratia_phage	28.9	7.8e-24
>prophage 21
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	264269	268370	4427062		Mycobacterium_phage(100.0%)	4	NA	NA
WP_003900831.1|264269_265178_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	31.4	1.2e-05
WP_003901829.1|265270_266599_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003401230.1|266600_267149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899863.1|267158_268370_+	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	42.4	8.7e-49
>prophage 22
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	303210	305151	4427062		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003401322.1|303210_305151_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.4	9.1e-24
>prophage 23
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	327111	330597	4427062		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003401383.1|327111_327621_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1C9M039	Mycobacterium_phage	74.4	5.9e-23
WP_003401386.1|327685_328879_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_003899884.1|328914_330597_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.6e-24
>prophage 24
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	346567	354065	4427062		Mycobacterium_phage(100.0%)	3	NA	NA
WP_003401463.1|346567_348463_+	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	40.6	3.1e-101
WP_003401472.1|348459_350076_+	type VII secretion system ESX-3 subunit EccB3	NA	V5UN45	Mycobacterium_phage	35.0	5.6e-59
WP_003401478.1|350072_354065_+	type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3	NA	V5UPA0	Mycobacterium_phage	26.3	8.0e-91
>prophage 25
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	358935	360321	4427062	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401528.1|358935_360321_+|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	39.8	6.6e-69
>prophage 26
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	389585	398458	4427062		Acanthocystis_turfacea_Chlorella_virus(20.0%)	10	NA	NA
WP_003401625.1|389585_390356_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-13
WP_003401627.1|390717_391512_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_003401632.1|391560_392229_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003401636.1|392300_392963_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	42.5	2.4e-24
WP_003898399.1|392994_393567_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	74.7	5.0e-79
WP_003898400.1|393672_395004_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	2.7e-67
WP_003401643.1|394992_395664_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_003401648.1|395764_396445_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003902651.1|396451_397141_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003401650.1|397108_398458_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.8	5.0e-13
>prophage 27
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	403070	403937	4427062		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003401670.1|403070_403937_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.6	4.3e-90
>prophage 28
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	424247	428052	4427062		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_003401814.1|424247_426125_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	2.3e-141
WP_003401817.1|426121_426829_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003401821.1|426864_428052_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.7	2.1e-15
>prophage 29
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	439712	441011	4427062		Pandoravirus(100.0%)	1	NA	NA
WP_003401829.1|439712_441011_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	34.6	6.4e-66
>prophage 30
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	456041	456521	4427062		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003401867.1|456041_456521_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.1	3.5e-17
>prophage 31
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	462082	466244	4427062		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003401894.1|462082_462622_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	44.9	4.3e-16
WP_003401897.1|462702_463557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003401905.1|463697_466244_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	1.1e-120
>prophage 32
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	481570	482800	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003898432.1|481570_482800_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.0	2.4e-17
>prophage 33
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	488220	494182	4427062		Catovirus(50.0%)	2	NA	NA
WP_003900921.1|488220_489978_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	9.8e-09
WP_016719657.1|490210_494182_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.8	4.9e-32
>prophage 34
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	499304	501557	4427062		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_003402100.1|499304_501557_-	serine/threonine protein kinase	NA	Q85650	Moloney_murine_sarcoma_virus	26.1	3.0e-10
>prophage 35
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	514943	519563	4427062		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003898445.1|514943_519563_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.5	6.7e-41
>prophage 36
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	522974	523283	4427062		Gordonia_phage(100.0%)	1	NA	NA
WP_003402188.1|522974_523283_+	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	43.5	1.6e-07
>prophage 37
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	526588	528775	4427062		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003402206.1|526588_528775_-	AAA family ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	42.6	1.4e-36
>prophage 38
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	532849	534472	4427062		uncultured_virus(100.0%)	1	NA	NA
WP_003402236.1|532849_534472_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	9.3e-155
>prophage 39
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	556855	558250	4427062		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003402301.1|556855_558250_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.1e-47
>prophage 40
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	564129	565953	4427062		Tupanvirus(100.0%)	2	NA	NA
WP_003900153.1|564129_564990_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.1	1.1e-29
WP_003402323.1|565089_565953_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.9	7.1e-29
>prophage 41
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	583590	585710	4427062		Bacillus_phage(100.0%)	2	NA	NA
WP_003402390.1|583590_584823_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-28
WP_003402393.1|585026_585710_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.0e-42
>prophage 42
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	594300	598997	4427062		Streptococcus_phage(33.33%)	6	NA	NA
WP_003900159.1|594300_595188_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.0	2.3e-22
WP_003402437.1|595328_595565_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003402602.1|595692_595794_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_003402607.1|595871_597002_+	SDR family oxidoreductase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	27.3	2.4e-08
WP_003898486.1|597008_598085_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003402621.1|598088_598997_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.8	4.9e-28
>prophage 43
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	612963	614274	4427062		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003402810.1|612963_614274_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	1.1e-12
>prophage 44
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	625124	626342	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003910801.1|625124_626342_+	AAA family ATPase	NA	V5UPR8	Mycobacterium_phage	32.6	5.7e-32
>prophage 45
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	631549	632590	4427062		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003901872.1|631549_632590_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	9.5e-20
>prophage 46
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	645397	647113	4427062		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003402917.1|645397_647113_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	5.4e-28
>prophage 47
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	663751	672696	4427062		Mycobacterium_phage(25.0%)	8	NA	NA
WP_003402992.1|663751_665170_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	24.3	3.1e-13
WP_003402995.1|665304_665571_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_003402998.1|665596_667675_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	Q8V6N4	Halorubrum_phage	33.5	2.7e-90
WP_031709257.1|667788_669120_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003898507.1|669343_669685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403006.1|669735_669903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403007.1|670152_671544_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.5	2.1e-67
WP_003403008.1|671553_672696_-	CapA family protein	NA	S4VS02	Pandoravirus	50.8	2.1e-92
>prophage 48
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	703334	706311	4427062	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_003403148.1|703334_704096_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	1.7e-34
WP_003403164.1|704152_704464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900184.1|704535_705486_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_003403171.1|705726_706311_+|transposase	IS607-like element IS1536 family transposase	transposase	F9VHY9	Thermus_phage	32.4	7.7e-19
>prophage 49
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	724301	729310	4427062		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003901883.1|724301_726029_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	3.8e-21
WP_003905355.1|726025_729310_-	RecBCD enzyme subunit RecB	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.9	1.4e-08
>prophage 50
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	740594	746914	4427062		Tupanvirus(60.0%)	6	NA	NA
WP_003900195.1|740594_741500_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.0	7.7e-26
WP_003403302.1|741564_742446_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.7	3.3e-29
WP_003905358.1|742593_743457_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.4	2.2e-30
WP_003403310.1|743623_744484_-	mycolic acid methyltransferase MmaA1	NA	A0A2K9L4K8	Tupanvirus	29.1	7.4e-26
WP_003403314.1|744530_745436_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003403317.1|745447_746914_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	32.1	4.8e-33
>prophage 51
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	756346	757426	4427062		Planktothrix_phage(100.0%)	1	NA	NA
WP_003403363.1|756346_757426_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-22
>prophage 52
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	764636	775380	4427062		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_003910996.1|764636_768155_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	21.8	3.9e-33
WP_085701462.1|768199_772150_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	1.5e-52
WP_003900994.1|772146_772521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900995.1|772513_774427_-	neutral ceramidase	NA	NA	NA	NA	NA
WP_003403419.1|774621_775380_+	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	7.9e-16
>prophage 53
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	787316	790843	4427062		Streptococcus_phage(50.0%)	2	NA	NA
WP_003898554.1|787316_789422_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.6	1.0e-60
WP_003403463.1|789652_790843_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.6	3.1e-30
>prophage 54
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	801764	803204	4427062		Catovirus(100.0%)	1	NA	NA
WP_003901900.1|801764_803204_+	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	25.6	5.6e-10
>prophage 55
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	813577	814477	4427062		Microcystis_virus(100.0%)	1	NA	NA
WP_003403610.1|813577_814477_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	29.0	5.0e-17
>prophage 56
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	825328	826309	4427062		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003403698.1|825328_826309_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.0	9.6e-22
>prophage 57
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	830954	831500	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003403726.1|830954_831500_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	35.1	1.3e-15
>prophage 58
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	865993	872422	4427062		Bacillus_phage(50.0%)	8	NA	NA
WP_003403867.1|865993_866737_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.9e-34
WP_003898576.1|866781_868239_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	5.4e-21
WP_003403876.1|868210_868612_-	HIT family protein	NA	NA	NA	NA	NA
WP_003403880.1|868651_869071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403885.1|869083_870211_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.8e-27
WP_003403887.1|870309_870855_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003403890.1|870857_871064_-	ferredoxin	NA	NA	NA	NA	NA
WP_003898577.1|871066_872422_-	cytochrome P450	NA	M1PWN0	Moumouvirus	23.1	2.4e-07
>prophage 59
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	887727	888621	4427062		Mollivirus(100.0%)	1	NA	NA
WP_003403962.1|887727_888621_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	3.2e-40
>prophage 60
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	903430	904691	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|903430_904691_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 61
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	910205	912470	4427062		Microbacterium_phage(100.0%)	1	NA	NA
WP_003404114.1|910205_912470_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
>prophage 62
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	916496	919205	4427062		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003901017.1|916496_918080_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|918110_919205_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
>prophage 63
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	925357	927888	4427062		Bacillus_phage(50.0%)	3	NA	NA
WP_003898599.1|925357_926125_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|926121_927069_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|927111_927888_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
>prophage 64
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	963473	965156	4427062		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003900222.1|963473_965156_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	21.2	2.7e-08
>prophage 65
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	972560	974189	4427062		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_003404428.1|972560_974189_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	1.0e-15
>prophage 66
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	978349	982343	4427062		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_003900223.1|978349_979573_-	resuscitation-promoting factor RpfA	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-98
WP_003404559.1|980020_980299_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003404564.1|980302_981385_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003404566.1|981381_981771_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003404570.1|981935_982343_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	1.1e-08
>prophage 67
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1006660	1007518	4427062		Pandoravirus(100.0%)	1	NA	NA
WP_031651833.1|1006660_1007518_-	adenylate/guanylate cyclase domain-containing protein	NA	S4VR00	Pandoravirus	32.6	2.1e-09
>prophage 68
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1025794	1028188	4427062		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003898639.1|1025794_1028188_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.5	7.0e-26
>prophage 69
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1036150	1043401	4427062	transposase	Vibrio_phage(25.0%)	7	NA	NA
WP_003404749.1|1036150_1037932_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	3.8e-24
WP_003404750.1|1037928_1038186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404754.1|1038274_1038751_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003404756.1|1038747_1039248_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404757.1|1039560_1040880_-|transposase	IS256-like element IS1554 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.6	2.9e-29
WP_003404760.1|1041167_1041749_+|transposase	IS607-like element IS1535 family transposase	transposase	F9VHY9	Thermus_phage	33.5	1.4e-23
WP_003905412.1|1041748_1043401_+|transposase	transposase	transposase	M4I0H6	Staphylococcus_phage	23.6	6.0e-08
>prophage 70
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1051980	1062476	4427062		Tupanvirus(20.0%)	8	NA	NA
WP_003404782.1|1051980_1053975_-	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	27.5	1.5e-13
WP_003898652.1|1053996_1055109_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003898653.1|1055324_1056155_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.9	4.5e-12
WP_003900236.1|1056175_1057300_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	27.0	1.2e-20
WP_003404792.1|1057359_1058376_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003404794.1|1058377_1059283_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003404795.1|1059259_1060081_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	51.5	6.1e-70
WP_003898655.1|1060196_1062476_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.8	5.7e-41
>prophage 71
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1071360	1078112	4427062		Bacillus_phage(50.0%)	7	NA	NA
WP_003404833.1|1071360_1071591_-	mycolyltransferase	NA	A0A2I6B0H1	Macacine_betaherpesvirus	60.4	1.0e-06
WP_003404835.1|1071507_1071702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404838.1|1071706_1072024_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003404859.1|1072320_1074636_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.1	2.4e-119
WP_003404862.1|1074716_1075715_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	41.5	8.3e-13
WP_003898659.1|1076024_1077188_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_003900240.1|1077200_1078112_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	29.9	2.0e-13
>prophage 72
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1081621	1083837	4427062		Synechococcus_phage(50.0%)	2	NA	NA
WP_003898661.1|1081621_1082269_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.5	9.5e-18
WP_003404890.1|1082265_1083837_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	41.0	1.5e-53
>prophage 73
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1092803	1095116	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003404941.1|1092803_1095116_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.7e-91
>prophage 74
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1110894	1111581	4427062		Bacillus_phage(100.0%)	1	NA	NA
WP_003916757.1|1110894_1111581_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	8.2e-36
>prophage 75
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1115875	1116622	4427062		Planktothrix_phage(100.0%)	1	NA	NA
WP_003900248.1|1115875_1116622_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-34
>prophage 76
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1123344	1124265	4427062		Bacillus_phage(100.0%)	1	NA	NA
WP_003405145.1|1123344_1124265_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	4.2e-43
>prophage 77
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1130603	1131221	4427062		Pacmanvirus(100.0%)	1	NA	NA
WP_003898684.1|1130603_1131221_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	3.4e-09
>prophage 78
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1136294	1143252	4427062	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_072433503.1|1136294_1137731_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	6.5e-35
WP_003405180.1|1137786_1139490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405183.1|1139516_1141076_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
WP_003405185.1|1141161_1141956_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003405187.1|1142163_1143252_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
>prophage 79
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1149573	1150554	4427062		Hokovirus(100.0%)	1	NA	NA
WP_003405263.1|1149573_1150554_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
>prophage 80
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1158636	1163180	4427062		Streptococcus_phage(50.0%)	5	NA	NA
WP_003901975.1|1158636_1159926_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.6	1.6e-133
WP_003405293.1|1159930_1160617_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003905434.1|1160633_1161101_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_003405299.1|1161091_1162051_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003905437.1|1162499_1163180_-	response regulator	NA	W8CYM9	Bacillus_phage	30.2	2.1e-23
>prophage 81
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1167796	1172809	4427062		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003405320.1|1167796_1169926_+	potassium-transporting ATPase subunit KdpB	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
WP_003405322.1|1169925_1170495_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003405324.1|1170498_1172028_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003405328.1|1172035_1172809_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
>prophage 82
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1183496	1184744	4427062	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1183496_1184744_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 83
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1191001	1191447	4427062	integrase	Mycobacterium_phage(50.0%)	2	1189292:1189307	1197207:1197222
1189292:1189307	attL	GTGTCCTCGACCAGCG	NA	NA	NA	NA
WP_003905442.1|1191001_1191316_+	hypothetical protein	NA	Q854H9	Mycobacterium_phage	53.6	1.0e-09
WP_072139304.1|1191252_1191447_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1197207:1197222	attR	CGCTGGTCGAGGACAC	NA	NA	NA	NA
>prophage 84
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1194757	1196389	4427062		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003405625.1|1194757_1196389_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.6	8.8e-28
>prophage 85
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1215375	1218892	4427062		Streptococcus_phage(50.0%)	3	NA	NA
WP_003405730.1|1215375_1216770_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.6e-57
WP_003901991.1|1216971_1217694_+	RDD family protein	NA	NA	NA	NA	NA
WP_003405736.1|1217725_1218892_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	34.9	2.5e-24
>prophage 86
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1224253	1225042	4427062		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003903314.1|1224253_1225042_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.0	1.2e-14
>prophage 87
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1234226	1237951	4427062		Aeromonas_phage(50.0%)	3	NA	NA
WP_003405797.1|1234226_1235507_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-86
WP_003405801.1|1235611_1236439_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003405802.1|1236649_1237951_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.2	1.0e-23
>prophage 88
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1246491	1249108	4427062		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_003405840.1|1246491_1247604_-	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	1.9e-29
WP_003405844.1|1247613_1247871_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003405846.1|1247860_1249108_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.3	7.5e-72
>prophage 89
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1253834	1259799	4427062		Mycobacterium_phage(33.33%)	7	NA	NA
WP_003898733.1|1253834_1254533_+	hypothetical protein	NA	A0A0K2FNG4	Mycobacterium_phage	35.7	1.9e-08
WP_003901093.1|1254650_1254836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651777.1|1254762_1255038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003405871.1|1255280_1255604_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003898734.1|1255618_1256479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898735.1|1257354_1258755_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.6	1.2e-62
WP_003405880.1|1258776_1259799_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	53.4	7.0e-92
>prophage 90
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1263579	1265052	4427062		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003898737.1|1263579_1265052_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	1.4e-69
>prophage 91
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1276652	1277914	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1276652_1277914_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 92
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1286160	1286913	4427062		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003405961.1|1286160_1286913_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	3.7e-05
>prophage 93
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1293909	1294623	4427062		Escherichia_phage(100.0%)	1	NA	NA
WP_003406044.1|1293909_1294623_-	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	33.5	4.4e-16
>prophage 94
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1306070	1307747	4427062		Escherichia_phage(100.0%)	1	NA	NA
WP_003406090.1|1306070_1307747_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	1.5e-19
>prophage 95
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1317936	1320507	4427062		Mamastrovirus(100.0%)	1	NA	NA
WP_003406167.1|1317936_1320507_+	FO synthase	NA	A9ZMK9	Mamastrovirus	33.8	3.4e-18
>prophage 96
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1328731	1334989	4427062		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003406192.1|1328731_1334989_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.6	5.7e-27
>prophage 97
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1339538	1340618	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003406195.1|1339538_1340618_-	PE-PPE domain-containing protein	NA	A0A222ZS78	Mycobacterium_phage	36.1	2.4e-18
>prophage 98
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1350800	1352222	4427062		Hepacivirus(100.0%)	1	NA	NA
WP_003905485.1|1350800_1352222_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	31.0	5.8e-28
>prophage 99
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1356363	1357611	4427062	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1356363_1357611_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 100
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1363724	1364288	4427062		Enterococcus_phage(100.0%)	1	NA	NA
WP_003898770.1|1363724_1364288_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	32.1	1.7e-10
>prophage 101
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1376803	1382469	4427062	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003900295.1|1376803_1377739_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.3e-19
WP_003406254.1|1377728_1378367_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911448.1|1378508_1379183_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003406257.1|1379418_1380192_+	ECF RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	9.6e-09
WP_003406258.1|1380349_1380814_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003898779.1|1380882_1382469_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.2	8.6e-12
>prophage 102
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1395692	1396874	4427062		Planktothrix_phage(100.0%)	1	NA	NA
WP_003406299.1|1395692_1396874_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.2	6.6e-25
>prophage 103
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1414873	1417713	4427062		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003898793.1|1414873_1416565_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	4.6e-56
WP_003406347.1|1416561_1417713_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	26.8	3.8e-09
>prophage 104
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1428863	1430744	4427062		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003898799.1|1428863_1430744_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	34.1	6.8e-16
>prophage 105
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1435321	1438962	4427062		Bacillus_phage(100.0%)	2	NA	NA
WP_003406569.1|1435321_1437217_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.4e-55
WP_003406574.1|1437213_1438962_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.7e-42
>prophage 106
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1444973	1450183	4427062		Klosneuvirus(50.0%)	3	NA	NA
WP_003406598.1|1444973_1446560_+	oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	28.0	1.5e-48
WP_003900310.1|1446576_1448352_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_003406602.1|1448344_1450183_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-19
>prophage 107
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1453818	1455663	4427062		Hokovirus(100.0%)	1	NA	NA
WP_003406621.1|1453818_1455663_+	adenylyl-sulfate kinase	NA	A0A1V0SGC3	Hokovirus	25.6	1.1e-34
>prophage 108
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1472411	1473065	4427062		Pandoravirus(100.0%)	1	NA	NA
WP_003898815.1|1472411_1473065_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	2.3e-19
>prophage 109
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1491987	1495678	4427062		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_003406857.1|1491987_1492485_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	5.4e-21
WP_003406860.1|1492481_1493972_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003406864.1|1494052_1495678_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.1	2.5e-14
>prophage 110
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1499041	1500745	4427062		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031709366.1|1499041_1500745_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	2.2e-13
>prophage 111
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1513685	1524678	4427062	protease	Bacillus_phage(20.0%)	13	NA	NA
WP_003901136.1|1513685_1515680_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.2	2.0e-50
WP_003900321.1|1515703_1517050_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	36.3	9.4e-44
WP_003406906.1|1517151_1517457_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003898829.1|1517416_1518073_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003406908.1|1518089_1519124_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_003898830.1|1519131_1519572_+	CysO-cysteine peptidase	NA	NA	NA	NA	NA
WP_003406910.1|1519593_1519875_+	sulfur carrier protein CysO	NA	NA	NA	NA	NA
WP_003406912.1|1519884_1520856_+	O-phosphoserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	37.5	5.9e-48
WP_003898831.1|1520846_1521569_+|protease	rhomboid family intramembrane serine protease	protease	L7RCY0	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-06
WP_003406919.1|1521565_1522381_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003406922.1|1522407_1523229_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003406926.1|1523245_1524025_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003406931.1|1524063_1524678_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	30.5	7.6e-09
>prophage 112
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1529537	1534725	4427062		Bacillus_phage(66.67%)	3	NA	NA
WP_003406958.1|1529537_1532117_+	iron ABC transporter ATP-binding protein/permease IrtA	NA	W8CYL7	Bacillus_phage	26.7	4.8e-28
WP_003900322.1|1532113_1533853_+	iron ABC transporter ATP-binding protein/permease IrtB	NA	W8CYL7	Bacillus_phage	25.3	2.6e-22
WP_003406963.1|1533981_1534725_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	3.6e-05
>prophage 113
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1554880	1555931	4427062		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003407164.1|1554880_1555702_+	GTP pyrophosphokinase family protein	NA	A0A142K822	Mycobacterium_phage	51.1	1.7e-48
WP_003907641.1|1555670_1555931_+	hypothetical protein	NA	A0A142K823	Mycobacterium_phage	60.6	8.7e-15
>prophage 114
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1559147	1560409	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1559147_1560409_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 115
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1580892	1587461	4427062		Abalone_herpesvirus(25.0%)	6	NA	NA
WP_003900331.1|1580892_1581519_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.2	1.1e-15
WP_003407248.1|1581584_1581917_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003898859.1|1581932_1583189_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.7e-37
WP_003900333.1|1583316_1584528_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.4	5.7e-117
WP_003407257.1|1584600_1586079_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003407260.1|1586075_1587461_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.6	2.2e-24
>prophage 116
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1592323	1593286	4427062		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003905554.1|1592323_1593286_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	28.3	2.4e-25
>prophage 117
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1601683	1608643	4427062		Staphylococcus_phage(100.0%)	8	NA	NA
WP_003898867.1|1601683_1602703_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	5.8e-38
WP_003407310.1|1602699_1604256_-	MFS transporter	NA	NA	NA	NA	NA
WP_003407315.1|1604261_1604972_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003407318.1|1605056_1605662_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.1	4.1e-31
WP_071854210.1|1605869_1606391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407330.1|1606380_1606782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407334.1|1606886_1608164_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	5.7e-91
WP_003898872.1|1608160_1608643_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.4	3.6e-14
>prophage 118
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1612468	1614399	4427062		Thermobifida_phage(50.0%)	2	NA	NA
WP_003898873.1|1612468_1613374_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.3e-08
WP_003407352.1|1613370_1614399_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	7.9e-35
>prophage 119
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1617548	1624462	4427062		Mycobacterium_phage(66.67%)	5	NA	NA
WP_003407371.1|1617548_1618811_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	37.4	1.5e-35
WP_003898876.1|1618810_1620418_-	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.6e-27
WP_003407374.1|1620421_1621249_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003407376.1|1621367_1622636_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003407378.1|1622875_1624462_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	40.8	2.9e-28
>prophage 120
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1636282	1638583	4427062		Escherichia_phage(100.0%)	1	NA	NA
WP_003902073.1|1636282_1638583_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	31.6	2.4e-71
>prophage 121
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1641912	1643457	4427062		Synechococcus_phage(100.0%)	1	NA	NA
WP_003407443.1|1641912_1643457_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	35.8	1.5e-74
>prophage 122
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1660199	1670190	4427062		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1660199_1661141_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1661296_1663072_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1663119_1663926_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1663922_1666463_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1666459_1667653_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1667649_1668450_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1668451_1669705_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1669701_1670190_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 123
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1673990	1680575	4427062	transposase	Burkholderia_virus(25.0%)	6	NA	NA
WP_087902221.1|1673990_1675252_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003905583.1|1675250_1677227_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1677270_1677645_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1677660_1678032_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1678053_1678911_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1678946_1680575_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 124
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1686709	1687435	4427062		Streptomyces_phage(100.0%)	1	NA	NA
WP_003407525.1|1686709_1687435_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	36.4	6.7e-12
>prophage 125
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1691730	1692474	4427062		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003898892.1|1691730_1692474_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.6e-08
>prophage 126
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1709140	1710169	4427062		Salmonella_phage(100.0%)	1	NA	NA
WP_003407612.1|1709140_1710169_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	32.2	2.6e-33
>prophage 127
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1718155	1724079	4427062		Synechococcus_phage(25.0%)	6	NA	NA
WP_003407628.1|1718155_1718518_+	hypothetical protein	NA	M4QRT5	Synechococcus_phage	60.0	7.2e-07
WP_003407632.1|1718501_1719383_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003901183.1|1719584_1720883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407639.1|1721363_1722386_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.8	4.0e-103
WP_003407642.1|1722382_1723351_+	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	49.7	1.5e-83
WP_003407647.1|1723347_1724079_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	28.0	2.1e-05
>prophage 128
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1730591	1732343	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003901187.1|1730591_1732343_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.8	8.3e-08
>prophage 129
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1737015	1740350	4427062		Shahe_endorna-like_virus(100.0%)	3	NA	NA
WP_003407671.1|1737015_1738260_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	37.5	2.5e-06
WP_003407672.1|1738306_1739092_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003407676.1|1739069_1740350_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	7.4e-06
>prophage 130
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1754808	1757934	4427062	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003407714.1|1754808_1757934_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.2	1.0e-162
>prophage 131
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1765983	1773722	4427062		Saccharomonospora_phage(50.0%)	4	NA	NA
WP_003407751.1|1765983_1769538_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	60.2	0.0e+00
WP_003903497.1|1769586_1771623_-	PPE family protein	NA	NA	NA	NA	NA
WP_024742859.1|1771779_1772328_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_003917498.1|1772333_1773722_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.1e-39
>prophage 132
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1789929	1794995	4427062		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003407794.1|1789929_1792119_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.4	2.3e-23
WP_003407798.1|1792217_1792910_-	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	36.5	4.3e-08
WP_003407802.1|1793149_1793434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407803.1|1793681_1794995_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.2e-13
>prophage 133
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1809937	1811080	4427062		Faustovirus(100.0%)	1	NA	NA
WP_003407947.1|1809937_1811080_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.7e-17
>prophage 134
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1819281	1820100	4427062		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003407990.1|1819281_1820100_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.1	8.0e-30
>prophage 135
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1837221	1842421	4427062		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_003408045.1|1837221_1837839_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.0	3.9e-05
WP_003408054.1|1837906_1839115_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003408058.1|1839111_1839603_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_003901211.1|1839706_1842421_+	DNA polymerase I	NA	A0A060AFQ3	Listeria_phage	30.6	2.5e-43
>prophage 136
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1851939	1861920	4427062	tRNA	Mycobacterium_phage(25.0%)	6	NA	NA
WP_078387219.1|1851939_1852734_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	67.4	6.2e-11
WP_003408092.1|1852782_1855701_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	7.0e-294
WP_003408096.1|1855757_1856015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408099.1|1856030_1857500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003905614.1|1857558_1861077_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	35.8	9.6e-72
WP_003901217.1|1861314_1861920_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	35.3	9.5e-12
>prophage 137
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1867774	1868800	4427062	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003901219.1|1867774_1868800_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	5.1e-26
>prophage 138
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1877786	1878989	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003408163.1|1877786_1878989_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	28.2	8.7e-17
>prophage 139
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1884367	1890748	4427062		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003902218.1|1884367_1890748_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	1.9e-25
>prophage 140
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1902639	1904415	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003408257.1|1902639_1904415_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.1e-39
>prophage 141
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1921225	1923949	4427062	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_003898975.1|1921225_1921993_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.9e-21
WP_003408373.1|1922051_1922663_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003408375.1|1922674_1923949_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.2	8.0e-61
>prophage 142
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1932901	1936210	4427062		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003408396.1|1932901_1934662_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	1.4e-127
WP_003408399.1|1934654_1935278_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003408401.1|1935274_1936210_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.7e-20
>prophage 143
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1945432	1947914	4427062		Natrialba_phage(50.0%)	3	NA	NA
WP_003898982.1|1945432_1946389_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.4	1.9e-22
WP_003408432.1|1946385_1947222_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003408436.1|1947218_1947914_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.2	2.5e-08
>prophage 144
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1960924	1963707	4427062		Pandoravirus(50.0%)	3	NA	NA
WP_003900395.1|1960924_1962310_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1962342_1962912_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1962936_1963707_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
>prophage 145
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1969076	1969709	4427062		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003408506.1|1969076_1969709_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
>prophage 146
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1978225	1985449	4427062		Tupanvirus(33.33%)	5	NA	NA
WP_003898998.1|1978225_1979926_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1980210_1980612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1980601_1981213_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1981359_1982790_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|1982851_1985449_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
>prophage 147
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	1996061	1998133	4427062	transposase,integrase	Burkholderia_virus(100.0%)	2	1986833:1986848	2000849:2000864
1986833:1986848	attL	AACCCGCCGTCGCCGC	NA	NA	NA	NA
WP_087902221.1|1996061_1997323_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|1997893_1998133_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
2000849:2000864	attR	GCGGCGACGGCGGGTT	NA	NA	NA	NA
>prophage 148
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2016490	2022183	4427062		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003899021.1|2016490_2018011_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2018007_2022183_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
>prophage 149
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2032479	2040171	4427062	protease	Mycobacterium_phage(100.0%)	5	NA	NA
WP_003408854.1|2032479_2034237_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
WP_003408859.1|2034233_2035454_+	type VII secretion system ESX-5 subunit EccE5	NA	NA	NA	NA	NA
WP_003408868.1|2035450_2037283_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	31.0	3.1e-66
WP_003899024.1|2037909_2038101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901256.1|2038203_2040171_+	PPE family protein PPE28	NA	A0A222ZKN7	Mycobacterium_phage	31.7	2.2e-17
>prophage 150
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2052193	2052898	4427062		Bacillus_virus(100.0%)	1	NA	NA
WP_003899032.1|2052193_2052898_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	3.8e-12
>prophage 151
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2061567	2063487	4427062		Bacillus_virus(100.0%)	1	NA	NA
WP_031709287.1|2061567_2063487_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.2	1.1e-05
>prophage 152
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2074579	2077405	4427062		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003900418.1|2074579_2077405_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	3.0e-257
>prophage 153
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2090961	2093885	4427062		Klosneuvirus(50.0%)	2	NA	NA
WP_003900420.1|2090961_2092398_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.1	3.1e-45
WP_025234866.1|2092433_2093885_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.6	6.6e-35
>prophage 154
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2105270	2109282	4427062		Planktothrix_phage(50.0%)	4	NA	NA
WP_003899051.1|2105270_2106380_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.0e-19
WP_003409337.1|2106432_2107410_+	alanine and proline-rich secreted protein Apa	NA	NA	NA	NA	NA
WP_003409339.1|2107861_2108167_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003409345.1|2108241_2109282_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.9	1.6e-19
>prophage 155
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2121871	2126665	4427062		Bodo_saltans_virus(50.0%)	6	NA	NA
WP_003409385.1|2121871_2122309_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	39.8	5.6e-14
WP_003904723.1|2122381_2123068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899059.1|2123078_2123522_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003910872.1|2123527_2123740_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003409398.1|2124037_2124517_+	bacterioferritin BfrA	NA	NA	NA	NA	NA
WP_003899060.1|2124601_2126665_+	MFS-type transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	3.2e-19
>prophage 156
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2132443	2134580	4427062		Macacine_betaherpesvirus(100.0%)	3	NA	NA
WP_003409420.1|2132443_2132974_-	resuscitation-promoting factor RpfC	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	2.7e-95
WP_003899064.1|2132985_2133585_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003409456.1|2133602_2134580_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	99.7	1.1e-190
>prophage 157
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2143936	2149042	4427062		Scale_drop_disease_virus(33.33%)	4	NA	NA
WP_003899068.1|2143936_2145013_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	32.5	3.9e-08
WP_003409539.1|2145012_2146401_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_003900426.1|2146429_2147722_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	9.7e-14
WP_031709290.1|2147773_2149042_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	1.8e-12
>prophage 158
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2165502	2166764	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2165502_2166764_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 159
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2175178	2176294	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003409667.1|2175178_2176294_+	lipoprotein	NA	S5Z991	Mycobacterium_phage	29.7	1.9e-18
>prophage 160
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2181561	2182329	4427062		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003409686.1|2181561_2182329_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	1.9e-17
>prophage 161
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2189607	2194779	4427062		Synechococcus_phage(50.0%)	4	NA	NA
WP_003409714.1|2189607_2192127_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	34.9	7.7e-07
WP_003902252.1|2192138_2193209_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003409718.1|2193205_2193721_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003899092.1|2193717_2194779_+	riboflavin biosynthesis protein RibA	NA	A0A2H4PQS2	Staphylococcus_phage	33.9	3.1e-34
>prophage 162
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2229826	2230795	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899116.1|2229826_2230795_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.2	2.2e-127
>prophage 163
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2240597	2242913	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899120.1|2240597_2242913_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
>prophage 164
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2253265	2254048	4427062		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003410047.1|2253265_2254048_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
>prophage 165
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2269275	2272002	4427062	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_087902221.1|2269275_2270537_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003918359.1|2270614_2270965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410103.1|2270961_2272002_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
>prophage 166
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2276303	2282204	4427062		Gordonia_phage(50.0%)	2	NA	NA
WP_003410136.1|2276303_2277200_-	hypothetical protein	NA	A0A1B3AYM4	Gordonia_phage	34.7	1.8e-35
WP_003900451.1|2277383_2282204_-	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	23.0	6.4e-34
>prophage 167
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2288403	2290895	4427062		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003410178.1|2288403_2290449_-	hypothetical protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	26.5	3.7e-07
WP_003410189.1|2290460_2290895_-	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	35.0	3.3e-06
>prophage 168
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2294709	2296759	4427062		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003410214.1|2294709_2295684_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.5	6.6e-15
WP_003410218.1|2295685_2296759_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.5e-23
>prophage 169
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2301647	2303183	4427062		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_003899145.1|2301647_2303183_-	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	31.9	3.6e-15
>prophage 170
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2320093	2322718	4427062		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_003902238.1|2320093_2322718_-	apolipoprotein N-acyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.3	1.0e-25
>prophage 171
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2337848	2338772	4427062		Salmonella_phage(100.0%)	1	NA	NA
WP_003410677.1|2337848_2338772_-	class A beta-lactamase BlaA	NA	A0A1B0VBP7	Salmonella_phage	42.2	2.7e-50
>prophage 172
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2345285	2346257	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899159.1|2345285_2346257_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	34.9	1.3e-15
>prophage 173
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2356386	2363916	4427062		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003905749.1|2356386_2358156_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.4	6.4e-16
WP_003905750.1|2358172_2359300_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011799244.1|2359348_2360416_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.8	6.1e-14
WP_003410762.1|2360419_2361154_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_003899167.1|2361195_2363916_-	RNA helicase	NA	M1HCW4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.3e-71
>prophage 174
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2372167	2378776	4427062	transposase	Yellowstone_lake_phycodnavirus(50.0%)	6	NA	NA
WP_003899171.1|2372167_2375209_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.3	1.0e-37
WP_003899172.1|2375201_2376035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003905754.1|2376013_2376448_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003410814.1|2376454_2376709_-	antitoxin	NA	NA	NA	NA	NA
WP_003410816.1|2376724_2376982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2377515_2378776_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 175
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2386444	2388274	4427062		Lymphocystis_disease_virus(100.0%)	1	NA	NA
WP_003411035.1|2386444_2388274_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	39.1	3.5e-33
>prophage 176
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2403197	2404442	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003411091.1|2403197_2404442_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	35.5	1.1e-30
>prophage 177
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2448568	2452945	4427062	transposase	Pandoravirus(50.0%)	5	NA	NA
WP_003899202.1|2448568_2449768_+	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	30.0	8.7e-17
WP_003899203.1|2449909_2450575_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003905774.1|2450508_2450691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411323.1|2450959_2452348_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_003411331.1|2452438_2452945_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A142UMD2	Mycobacterium_phage	44.0	1.9e-26
>prophage 178
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2458787	2467371	4427062		Catovirus(25.0%)	7	NA	NA
WP_003901348.1|2458787_2460590_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.1e-50
WP_003411369.1|2460620_2461778_-	GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase	NA	NA	NA	NA	NA
WP_003411371.1|2461874_2462648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411373.1|2462742_2463900_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.6	2.0e-18
WP_003411376.1|2464085_2464337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901350.1|2464446_2466384_+	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	33.9	9.4e-13
WP_003411387.1|2466258_2467371_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	8.6e-43
>prophage 179
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2475567	2477526	4427062		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003411413.1|2475567_2477526_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	28.2	7.3e-21
>prophage 180
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2488908	2492272	4427062		Mycoplasma_phage(50.0%)	2	NA	NA
WP_003899220.1|2488908_2490456_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	8.6e-33
WP_003411445.1|2490493_2492272_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	25.9	1.4e-07
>prophage 181
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2512214	2513309	4427062		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003899226.1|2512214_2513309_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	33.3	1.1e-05
>prophage 182
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2542764	2543850	4427062		Synechococcus_phage(100.0%)	1	NA	NA
WP_003899236.1|2542764_2543850_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.2	2.5e-31
>prophage 183
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2556691	2557561	4427062	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003411681.1|2556691_2557561_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	26.1	2.4e-08
>prophage 184
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2561623	2563282	4427062		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_045245504.1|2561623_2563282_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
>prophage 185
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2578511	2580455	4427062		Catovirus(100.0%)	1	NA	NA
WP_003411855.1|2578511_2580455_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.2	1.0e-107
>prophage 186
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2587956	2592232	4427062	integrase	Mycobacterium_phage(66.67%)	7	2582342:2582355	2593661:2593674
2582342:2582355	attL	TCGAGGTGCGCTCC	NA	NA	NA	NA
WP_003899265.1|2587956_2588388_-	hypothetical protein	NA	A0A076GDT8	Mycobacterium_phage	47.1	2.0e-16
WP_003902166.1|2588480_2588663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902167.1|2588871_2589588_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_003411888.1|2589597_2589930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899267.1|2590295_2590751_-|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	47.2	3.6e-24
WP_003902168.1|2591497_2591785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411901.1|2591887_2592232_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.3	7.3e-09
2593661:2593674	attR	GGAGCGCACCTCGA	NA	NA	NA	NA
>prophage 187
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2607258	2609352	4427062		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003411969.1|2607258_2609352_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	1.6e-05
>prophage 188
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2618200	2619133	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899275.1|2618200_2619133_+	O-acetylserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	53.4	2.4e-83
>prophage 189
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2629936	2631856	4427062		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_003412049.1|2629936_2631856_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	30.3	1.4e-32
>prophage 190
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2643504	2644765	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2643504_2644765_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 191
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2649905	2653701	4427062	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_003412200.1|2649905_2651297_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.4	7.7e-49
WP_003412205.1|2651478_2651886_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003899290.1|2651882_2652275_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003412208.1|2652382_2652811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003412212.1|2652810_2653701_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	38.3	1.0e-17
>prophage 192
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2659148	2664220	4427062		Pseudomonas_phage(50.0%)	6	NA	NA
WP_003412235.1|2659148_2660207_-	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.1e-47
WP_003902257.1|2660178_2660481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899293.1|2660477_2661791_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003901386.1|2661883_2662171_+	PE family protein	NA	NA	NA	NA	NA
WP_003900509.1|2662269_2663058_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003899294.1|2663071_2664220_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	1.0e-22
>prophage 193
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2667932	2677495	4427062		Tupanvirus(100.0%)	2	NA	NA
WP_003412267.1|2667932_2672318_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	1.8e-51
WP_003899297.1|2672299_2677495_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-82
>prophage 194
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2681825	2686070	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003902259.1|2681825_2686070_-	phenyloxazoline synthase MbtB	NA	A0A2K9KZV5	Tupanvirus	26.1	2.3e-43
>prophage 195
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2693480	2693945	4427062		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003412293.1|2693480_2693945_-	resuscitation-promoting factor RpfD	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-83
>prophage 196
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2704141	2705197	4427062		Bacillus_virus(100.0%)	1	NA	NA
WP_003412325.1|2704141_2705197_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	1.3e-29
>prophage 197
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2711519	2713481	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003900516.1|2711519_2713481_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	8.6e-22
>prophage 198
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2734462	2735710	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412516.1|2734462_2735710_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	3.3e-91
>prophage 199
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2747134	2748265	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412568.1|2747134_2748265_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.8e-51
>prophage 200
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2755331	2762198	4427062	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003412592.1|2755331_2755742_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	2.6e-29
WP_003412596.1|2755784_2756156_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003899324.1|2756152_2757616_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003899325.1|2757612_2760243_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	7.0e-144
WP_003412609.1|2760330_2761590_-	enoyl reductase	NA	NA	NA	NA	NA
WP_003905853.1|2761679_2762198_-	resuscitation-promoting factor rpfE	NA	A0A1J0GVU2	Streptomyces_phage	82.9	2.5e-29
>prophage 201
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2768225	2769506	4427062	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_003412634.1|2768225_2769506_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	4.2e-142
>prophage 202
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2772548	2773792	4427062	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003412648.1|2772548_2773193_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	31.4	5.2e-08
WP_003412650.1|2773189_2773792_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	1.2e-38
>prophage 203
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2776876	2783053	4427062		Bacillus_phage(33.33%)	7	NA	NA
WP_003412657.1|2776876_2777683_-	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	28.9	6.5e-08
WP_003899332.1|2777688_2778177_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_003412664.1|2778278_2778902_-	Rv2466c family mycothiol-dependent reductase	NA	NA	NA	NA	NA
WP_003412666.1|2779003_2781589_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.2	3.6e-44
WP_003412669.1|2781661_2782165_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003412671.1|2782115_2782349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899334.1|2782384_2783053_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.2	1.2e-18
>prophage 204
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2792383	2794647	4427062		Tupanvirus(50.0%)	2	NA	NA
WP_003412708.1|2792383_2794060_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.4e-44
WP_003900529.1|2794140_2794647_-	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	31.2	1.4e-08
>prophage 205
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2801382	2802648	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003902276.1|2801382_2802648_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	38.8	2.0e-35
>prophage 206
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2825543	2830255	4427062		Pike_perch_iridovirus(50.0%)	4	NA	NA
WP_003905871.1|2825543_2827133_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
WP_003412782.1|2827129_2827786_-	succinyl-CoA--3-ketoacid CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003412786.1|2827782_2828529_-	succinyl-CoA--3-ketoacid CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003899357.1|2828611_2830255_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	2.1e-29
>prophage 207
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2834146	2838462	4427062	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2834146_2835748_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2835815_2836463_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2837214_2838462_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 208
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2858510	2859233	4427062		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003412957.1|2858510_2859233_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	50.7	4.1e-54
>prophage 209
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2871860	2873066	4427062		Pandoravirus(100.0%)	1	NA	NA
WP_003413027.1|2871860_2873066_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.9	1.6e-47
>prophage 210
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2882424	2888583	4427062	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_003902305.1|2882424_2885139_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.5	4.8e-63
WP_003413208.1|2885229_2885619_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_003899374.1|2885725_2886400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413213.1|2886484_2887195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899376.1|2887224_2888583_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.8e-80
>prophage 211
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2891994	2892987	4427062		Planktothrix_phage(100.0%)	1	NA	NA
WP_003901426.1|2891994_2892987_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	9.4e-33
>prophage 212
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2907991	2908873	4427062		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003899384.1|2907991_2908873_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	48.0	3.2e-53
>prophage 213
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2912291	2932886	4427062	tRNA	Klosneuvirus(22.22%)	14	NA	NA
WP_003413363.1|2912291_2913194_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.0	4.2e-56
WP_003413365.1|2913473_2914745_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	23.1	4.0e-12
WP_003413366.1|2914741_2915416_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.3	6.8e-19
WP_003413367.1|2915466_2916393_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	34.2	2.3e-09
WP_003413368.1|2916478_2918851_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_003413369.1|2918881_2919553_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	32.2	3.1e-11
WP_003413373.1|2919656_2921330_-	lipoprotein	NA	NA	NA	NA	NA
WP_003899387.1|2921335_2922664_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.7	2.9e-21
WP_003413385.1|2922667_2924389_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003413391.1|2924498_2924846_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003413395.1|2925012_2926362_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	5.0e-21
WP_003413409.1|2926523_2930030_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.6	3.9e-17
WP_009940036.1|2930203_2931835_+	PE family protein	NA	NA	NA	NA	NA
WP_003413416.1|2931851_2932886_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	7.0e-07
>prophage 214
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2937040	2938612	4427062		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003899392.1|2937040_2938612_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.2	5.1e-09
>prophage 215
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2949841	2988113	4427062	protease,head,integrase,tRNA,terminase,capsid	Mycobacterium_phage(30.0%)	48	2978642:2978669	2988266:2988293
WP_003413486.1|2949841_2951920_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2952028_2952256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2952252_2953638_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2953982_2954483_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2954499_2954940_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2955086_2955764_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2955748_2956102_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2956114_2956540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2956536_2957211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2957288_2958110_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2958245_2959139_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2959141_2959960_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2959974_2961156_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2961214_2961646_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2962159_2963401_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2963710_2964073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2964419_2965544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2965545_2966085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2966224_2967523_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2967561_2967843_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2967987_2968473_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2968499_2968757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2968757_2971094_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2971122_2971365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2971365_2972043_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2972238_2972895_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2973057_2973504_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2973678_2974011_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2974130_2974490_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2974591_2975050_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2975185_2975566_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2975562_2977059_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2977248_2977485_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2977557_2977731_+	hypothetical protein	NA	NA	NA	NA	NA
2978642:2978669	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2978775_2979207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2979203_2980202_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2980215_2980680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2980667_2980919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2981089_2982529_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2982536_2983070_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2983222_2983849_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2983880_2984204_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2984283_2984529_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2984525_2985953_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2985954_2986347_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2986343_2986604_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2986620_2986983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2986985_2988113_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2988266:2988293	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 216
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2991190	2991949	4427062	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003413845.1|2991190_2991949_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
>prophage 217
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	2999983	3001342	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003413871.1|2999983_3001342_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	37.4	2.4e-07
>prophage 218
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3012298	3013204	4427062		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003413913.1|3012298_3013204_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.2e-13
>prophage 219
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3021126	3021591	4427062		Streptomyces_phage(100.0%)	1	NA	NA
WP_003413930.1|3021126_3021591_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	47.6	9.4e-28
>prophage 220
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3025278	3043537	4427062		Cyanophage(28.57%)	21	NA	NA
WP_003413944.1|3025278_3026865_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	4.6e-42
WP_003899440.1|3026901_3027330_+	RidA family protein	NA	NA	NA	NA	NA
WP_003413947.1|3027257_3027647_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003902340.1|3027643_3027901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413953.1|3028016_3028991_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003899441.1|3028991_3029240_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	47.5	8.3e-15
WP_003910933.1|3029282_3029720_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_003413958.1|3029895_3030867_+	RNA polymerase sigma factor SigB	NA	M4SMP8	Cyanophage	35.7	6.6e-39
WP_003413962.1|3030999_3031692_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003905914.1|3031704_3032763_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003900556.1|3032875_3034282_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.4e-42
WP_003901455.1|3034499_3035474_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003900558.1|3035532_3036558_+	alpha/beta hydrolase	NA	G1DAB1	Mycobacterium_virus	30.0	9.7e-17
WP_003413971.1|3036606_3037293_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003900559.1|3037301_3037796_-	FABP family protein	NA	NA	NA	NA	NA
WP_003413973.1|3037847_3038312_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003413974.1|3038474_3038972_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899448.1|3039222_3039933_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	8.0e-10
WP_003900560.1|3039954_3042054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902343.1|3042069_3042318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413979.1|3042343_3043537_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	33.3	8.4e-28
>prophage 221
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3054255	3058859	4427062		Mycobacterium_phage(66.67%)	4	NA	NA
WP_003899455.1|3054255_3055110_+	DUF5131 family protein	NA	A0A088F7U1	Mycobacterium_phage	48.6	1.8e-64
WP_003899456.1|3054994_3055987_-	three-Cys-motif partner protein TcmP	NA	A0A142KCL9	Gordonia_phage	60.3	3.0e-108
WP_003905919.1|3055996_3056521_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003414006.1|3056486_3058859_-	intein-containing recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	50.0	5.2e-21
>prophage 222
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3067289	3069941	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414040.1|3067289_3069941_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	57.9	4.2e-112
>prophage 223
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3074627	3077518	4427062		Rhodococcus_phage(50.0%)	3	NA	NA
WP_003899465.1|3074627_3075380_-	FAD-dependent thymidylate synthase	NA	M9MU99	Rhodococcus_phage	47.4	4.9e-50
WP_003414055.1|3075623_3075899_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003414057.1|3075895_3077518_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	5.9e-08
>prophage 224
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3080564	3081915	4427062		Ralstonia_phage(50.0%)	2	NA	NA
WP_003414073.1|3080564_3081044_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	38.6	6.8e-21
WP_003911953.1|3081114_3081915_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	70.5	2.2e-109
>prophage 225
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3096479	3097796	4427062		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_003414119.1|3096479_3097796_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	24.4	5.4e-28
>prophage 226
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3107636	3109597	4427062	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_085701474.1|3107636_3109016_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.8	9.3e-31
WP_003414146.1|3109015_3109597_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
>prophage 227
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3127724	3128985	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3127724_3128985_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 228
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3139204	3140287	4427062		Bacillus_virus(100.0%)	1	NA	NA
WP_003414499.1|3139204_3140287_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
>prophage 229
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3146276	3148979	4427062		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003899505.1|3146276_3148979_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
>prophage 230
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3154144	3155737	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414532.1|3154144_3155737_-	multidrug efflux MFS transporter EfpA	NA	A0A0M3UL24	Mycobacterium_phage	33.0	7.7e-45
>prophage 231
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3166311	3172753	4427062		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_003414557.1|3166311_3167691_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.1e-34
WP_003414559.1|3167790_3168909_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003414562.1|3168974_3169307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414566.1|3169318_3169534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099171521.1|3169454_3169637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414570.1|3169689_3170466_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.0e-15
WP_003900585.1|3170462_3171830_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003900586.1|3171826_3172753_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	32.5	4.2e-11
>prophage 232
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3195387	3197591	4427062	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003901487.1|3195387_3196707_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	29.4	4.1e-28
WP_003899526.1|3196703_3197591_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	27.3	2.6e-10
>prophage 233
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3204552	3205449	4427062		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003414689.1|3204552_3205449_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.9	3.1e-19
>prophage 234
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3213320	3214115	4427062		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003414713.1|3213320_3214115_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	26.9	7.1e-07
>prophage 235
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3219496	3235745	4427062		Erythrobacter_phage(20.0%)	11	NA	NA
WP_023644660.1|3219496_3220372_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	4.4e-10
WP_003414739.1|3220431_3221019_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899536.1|3221020_3222856_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003900593.1|3222924_3224682_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	23.4	1.3e-05
WP_003899537.1|3224725_3225838_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003414748.1|3225865_3227443_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003414750.1|3227520_3229401_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	41.0	3.9e-88
WP_003899539.1|3229411_3231838_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003414756.1|3231895_3232234_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003899540.1|3232230_3233664_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.8	1.4e-40
WP_003899541.1|3234476_3235745_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.5	1.5e-11
>prophage 236
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3240203	3242154	4427062		Bacillus_phage(50.0%)	2	NA	NA
WP_003414814.1|3240203_3241073_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	25.1	1.1e-13
WP_003414820.1|3241431_3242154_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.4	1.9e-22
>prophage 237
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3247047	3257290	4427062		Paenibacillus_phage(100.0%)	3	NA	NA
WP_157127691.1|3247047_3250263_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	29.8	1.6e-28
WP_072496070.1|3250145_3252677_+	KR domain-containing protein	NA	NA	NA	NA	NA
WP_003899547.1|3252673_3257290_+	phthiocerol type I polyketide synthase PpsB	NA	D0R7J2	Paenibacillus_phage	36.3	1.1e-32
>prophage 238
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3263851	3269335	4427062		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003899549.1|3263851_3269335_+	phthiocerol type I polyketide synthase PpsD	NA	D0R7J2	Paenibacillus_phage	31.6	3.7e-30
>prophage 239
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3273817	3274813	4427062		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003901496.1|3273817_3274813_+	daunorubicin ABC transporter permease DrrB	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	1.5e-22
>prophage 240
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3277983	3284319	4427062		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003901497.1|3277983_3284319_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.3	9.9e-27
>prophage 241
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3309190	3311010	4427062		uncultured_virus(50.0%)	2	NA	NA
WP_003414906.1|3309190_3310156_-	[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha- L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L- rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase	NA	A0A218MM68	uncultured_virus	25.5	1.5e-06
WP_003899556.1|3310278_3311010_+	[alpha-L-fucopyranosyl-(1->3)-alpha-L- rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase	NA	Q58M88	Prochlorococcus_phage	33.3	1.3e-07
>prophage 242
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3318139	3320426	4427062		Synechococcus_phage(50.0%)	3	NA	NA
WP_003901503.1|3318139_3319072_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	2.1e-10
WP_003414994.1|3319711_3319897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414998.1|3319940_3320426_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	9.3e-18
>prophage 243
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3326183	3328560	4427062		Moumouvirus(50.0%)	2	NA	NA
WP_003415015.1|3326183_3327314_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	5.0e-30
WP_003415022.1|3327711_3328560_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	1.0e-56
>prophage 244
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3333679	3337357	4427062	transposase	Pandoravirus(33.33%)	4	NA	NA
WP_003899565.1|3333679_3334363_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	40.7	3.8e-33
WP_003415034.1|3334395_3335397_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_003415037.1|3335393_3336773_-	resolvase	NA	I4AZM3	Saccharomonospora_phage	32.9	2.3e-21
WP_003415039.1|3336772_3337357_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	29.9	1.1e-17
>prophage 245
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3344899	3345544	4427062		Streptomyces_phage(100.0%)	1	NA	NA
WP_003415107.1|3344899_3345544_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	2.8e-14
>prophage 246
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3355206	3356793	4427062		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003899578.1|3355206_3356793_-	D-3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.5	1.2e-34
>prophage 247
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3360335	3364710	4427062		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003415160.1|3360335_3360995_+	ABC transporter permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.2	6.9e-08
WP_003899581.1|3361308_3362310_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003415167.1|3362347_3362854_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003415168.1|3362853_3364710_-	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.3	9.6e-55
>prophage 248
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3370546	3376344	4427062	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003415251.1|3370546_3371578_-	ATP-dependent 6-phosphofructokinase	NA	E5EQL4	Micromonas_sp._RCC1109_virus	24.2	2.3e-13
WP_003900613.1|3371673_3373158_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003415256.1|3373154_3373454_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003901515.1|3373538_3374195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003415263.1|3374268_3376344_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	8.3e-108
>prophage 249
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3380328	3387675	4427062	transposase,tRNA	Burkholderia_virus(33.33%)	7	NA	NA
WP_087902221.1|3380328_3381589_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003415342.1|3381643_3381937_-	type VII secretion system protein EsxS	NA	NA	NA	NA	NA
WP_003910692.1|3381983_3383291_-	PPE family protein	NA	NA	NA	NA	NA
WP_003415766.1|3383287_3383602_-	PE family protein	NA	NA	NA	NA	NA
WP_003901078.1|3383983_3385231_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_085701475.1|3385393_3386497_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003415911.1|3386493_3387675_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.6	1.4e-30
>prophage 250
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3403663	3404527	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003415944.1|3403663_3404527_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.7e-07
>prophage 251
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3408893	3421257	4427062		Mycobacterium_phage(28.57%)	13	NA	NA
WP_003415965.1|3408893_3409934_+	NADP-dependent alcohol dehydrogenase C	NA	A0A2K9L7I1	Tupanvirus	41.2	3.7e-72
WP_003415968.1|3409922_3410297_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003902400.1|3410630_3410915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003415973.1|3411012_3411987_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	85.3	8.0e-154
WP_003899895.1|3412117_3413692_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003415979.1|3413825_3414566_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078387223.1|3414693_3416871_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.8e-209
WP_003415981.1|3416840_3417293_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003415982.1|3417327_3417567_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	68.0	3.4e-21
WP_003415983.1|3418029_3418584_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	4.0e-09
WP_003415984.1|3418675_3419290_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899898.1|3419299_3420340_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	31.8	7.1e-15
WP_003415986.1|3420393_3421257_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	2.2e-06
>prophage 252
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3442203	3448651	4427062		Tupanvirus(50.0%)	4	NA	NA
WP_003901535.1|3442203_3444015_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	34.8	9.6e-84
WP_003416059.1|3444015_3444417_+	hydrogenase	NA	NA	NA	NA	NA
WP_003416061.1|3444432_3445260_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003899905.1|3445318_3448651_-	serine/threonine-protein kinase PknK	NA	A0A1M7XTW9	Cedratvirus	28.0	3.0e-14
>prophage 253
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3454443	3461761	4427062		Synechococcus_phage(33.33%)	5	NA	NA
WP_003416075.1|3454443_3455550_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-27
WP_003416076.1|3455587_3457006_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416079.1|3457002_3458427_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416081.1|3458423_3459935_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	5.6e-45
WP_003416086.1|3460873_3461761_+	SPFH domain-containing protein	NA	A0A0M4RAA7	Mycobacterium_phage	50.5	2.8e-68
>prophage 254
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3471963	3474032	4427062		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003416113.1|3471963_3472446_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	1.5e-31
WP_003416117.1|3472448_3473342_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003416120.1|3473342_3474032_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.7	2.5e-32
>prophage 255
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3483422	3486609	4427062	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_003901545.1|3483422_3483953_+	nucleoside deaminase	NA	A0A2I7QX61	Vibrio_phage	39.0	5.8e-05
WP_003904994.1|3483971_3484115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901078.1|3484114_3485362_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003899922.1|3485439_3486609_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.1	1.6e-10
>prophage 256
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3496616	3497878	4427062	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3496616_3497878_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 257
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3546403	3547303	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003416610.1|3546403_3547303_-	alpha/beta hydrolase	NA	A0A1C9LZ53	Mycobacterium_phage	31.1	9.8e-05
>prophage 258
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3552004	3557061	4427062	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_003416628.1|3552004_3552865_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	28.6	7.4e-10
WP_071854247.1|3552959_3553355_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003416635.1|3553594_3553888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416640.1|3554175_3555465_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087902221.1|3555799_3557061_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 259
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3562510	3563545	4427062	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003416786.1|3562510_3563545_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.3	7.0e-31
>prophage 260
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3574308	3582236	4427062		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_003416822.1|3574308_3576411_-	ATP-dependent DNA helicase UvrD2	NA	A0A2H4UW05	Bodo_saltans_virus	24.2	4.9e-15
WP_003416827.1|3576534_3576789_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_003906027.1|3576801_3577743_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003899966.1|3577801_3578869_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003910809.1|3578930_3582236_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	1.8e-08
>prophage 261
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3592996	3596692	4427062		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_003416875.1|3592996_3594580_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.9e-46
WP_003416876.1|3594592_3595816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901572.1|3595891_3596692_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.8	1.3e-16
>prophage 262
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3600912	3604751	4427062		Mycobacterium_phage(50.0%)	7	NA	NA
WP_003416884.1|3600912_3601167_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	8.8e-12
WP_003901574.1|3601228_3602734_-	ATPase	NA	NA	NA	NA	NA
WP_003416887.1|3602750_3602966_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_003416889.1|3603166_3603241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416891.1|3603250_3603556_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_003899976.1|3603552_3604104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003416897.1|3604100_3604751_-	ECF RNA polymerase sigma factor SigH	NA	A0A076YQ50	Rhizobium_phage	26.5	6.8e-08
>prophage 263
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3607763	3608522	4427062		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003416907.1|3607763_3608522_-	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	37.6	1.5e-27
>prophage 264
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3630110	3634848	4427062		Bacillus_phage(66.67%)	4	NA	NA
WP_003906038.1|3630110_3631814_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.3e-18
WP_003899985.1|3631863_3632550_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.6e-39
WP_003417036.1|3632619_3633264_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003417039.1|3633360_3634848_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.2	1.4e-43
>prophage 265
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3645072	3645342	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003417079.1|3645072_3645342_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	81.2	6.4e-29
>prophage 266
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3650098	3657883	4427062		Sphingomonas_phage(33.33%)	7	NA	NA
WP_003417097.1|3650098_3651178_-	NDP-sugar synthase	NA	H9NC64	Sphingomonas_phage	32.6	2.1e-17
WP_003901582.1|3651179_3652085_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003899993.1|3652095_3653010_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	8.4e-28
WP_003417107.1|3653085_3654582_+	LCP family protein	NA	NA	NA	NA	NA
WP_003417112.1|3654620_3655310_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_003417115.1|3655434_3655716_+	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003899995.1|3655726_3657883_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	33.5	6.2e-82
>prophage 267
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3663314	3663839	4427062		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003899997.1|3663314_3663839_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	1.1e-21
>prophage 268
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3673234	3676860	4427062		Bacillus_phage(50.0%)	5	NA	NA
WP_003417158.1|3673234_3674020_-	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	33.2	3.6e-19
WP_003417160.1|3674016_3674454_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_003417162.1|3674651_3675065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417165.1|3675099_3675477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900004.1|3675510_3676860_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	45.5	1.1e-111
>prophage 269
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3681840	3686382	4427062		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003901592.1|3681840_3686382_+	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	37.5	2.6e-05
>prophage 270
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3699987	3701592	4427062		Streptococcus_phage(100.0%)	1	NA	NA
WP_003900011.1|3699987_3701592_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.1	3.4e-48
>prophage 271
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3707307	3708591	4427062		Geobacillus_virus(100.0%)	1	NA	NA
WP_003900016.1|3707307_3708591_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.3	3.8e-79
>prophage 272
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3719119	3810359	4427062	transposase,tRNA	Burkholderia_virus(28.57%)	58	NA	NA
WP_087902221.1|3719119_3720381_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3720674_3720836_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3720857_3722387_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3722319_3723258_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3723266_3724634_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3724702_3725920_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3726015_3727524_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3727520_3728672_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3728862_3729708_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3730182_3730623_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3730656_3731526_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3731546_3732557_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3732841_3733474_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3733540_3734770_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3735052_3736402_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3736413_3737553_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3737549_3738281_+	methyltransferase	NA	NA	NA	NA	NA
WP_070902727.1|3749403_3750441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031743085.1|3750342_3750672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157127692.1|3750821_3755348_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003417619.1|3755771_3756029_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3756284_3765758_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3766383_3766830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3766866_3767685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3767901_3768189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3779918_3780713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3780794_3781166_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3781063_3781474_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3781308_3781569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3781683_3782073_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3782086_3782380_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3782376_3783222_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3783345_3783621_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3783617_3783875_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3783916_3785107_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3785223_3785592_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3785588_3786140_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3786146_3786728_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3786708_3787077_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3787054_3787447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3787443_3790074_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3790309_3790774_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3791140_3792916_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3792916_3793561_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3793559_3793994_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3794082_3797322_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_031709368.1|3797513_3798848_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3798889_3800065_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3800118_3800223_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3800301_3800943_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3800943_3801192_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3801196_3802624_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3802731_3803385_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3803423_3804929_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3804933_3805824_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003918607.1|3805832_3807671_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417912.1|3807667_3808657_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_087902221.1|3809098_3810359_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 273
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3820133	3820997	4427062		Tupanvirus(100.0%)	1	NA	NA
WP_003900041.1|3820133_3820997_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
>prophage 274
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3833908	3835147	4427062		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003902474.1|3833908_3835147_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
>prophage 275
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3839507	3839807	4427062		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003911013.1|3839507_3839807_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	99.0	1.6e-44
>prophage 276
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3843185	3844775	4427062		Klosneuvirus(100.0%)	1	NA	NA
WP_003901630.1|3843185_3844775_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	6.2e-87
>prophage 277
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3848147	3851845	4427062	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_003418017.1|3848147_3848456_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
WP_003418021.1|3848527_3850147_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
WP_003418028.1|3850241_3850544_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
WP_003900052.1|3850810_3851845_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
>prophage 278
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3857138	3858988	4427062	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003418125.1|3857138_3857894_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	1.5e-22
WP_104591446.1|3857977_3858988_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	7.7e-83
>prophage 279
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3872050	3873925	4427062		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003418289.1|3872050_3873925_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
>prophage 280
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3881562	3885273	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418326.1|3881562_3885273_-	type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
>prophage 281
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3898929	3904179	4427062		Enterobacteria_phage(50.0%)	5	NA	NA
WP_003418607.1|3898929_3899925_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	3.1e-76
WP_003906113.1|3899926_3900535_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	37.8	7.5e-25
WP_003911061.1|3901056_3902013_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003900066.1|3902070_3903165_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	28.0	1.8e-05
WP_003900067.1|3903168_3904179_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.6e-27
>prophage 282
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3917061	3917844	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418925.1|3917061_3917844_-	DUF2510 domain-containing protein	NA	A0A088F7R2	Mycobacterium_phage	63.2	7.0e-07
>prophage 283
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3951774	3953322	4427062		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003900872.1|3951774_3953322_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	33.3	3.9e-09
>prophage 284
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3960463	3961120	4427062		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902513.1|3960463_3961120_-	fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	1.6e-09
>prophage 285
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3966416	3968063	4427062		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003911024.1|3966416_3968063_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.6	2.0e-16
>prophage 286
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3989181	3990093	4427062		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003419251.1|3989181_3990093_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	1.7e-36
>prophage 287
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	3993651	3995091	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003900090.1|3993651_3995091_+	PPE family protein	NA	A0A222ZKN7	Mycobacterium_phage	31.4	1.5e-23
>prophage 288
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4002973	4003888	4427062		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003900711.1|4002973_4003888_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.4e-11
>prophage 289
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4008276	4010334	4427062		Synechococcus_phage(100.0%)	1	NA	NA
WP_003901670.1|4008276_4010334_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	36.8	6.3e-07
>prophage 290
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4017228	4018752	4427062		Hepacivirus(100.0%)	1	NA	NA
WP_003900098.1|4017228_4018752_+	3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase	NA	Q75ZG1	Hepacivirus	27.4	3.9e-38
>prophage 291
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4037985	4039395	4427062	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003900108.1|4037985_4039395_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	7.8e-41
>prophage 292
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4051448	4058532	4427062	protease,tRNA	Mycobacterium_virus(25.0%)	5	NA	NA
WP_003419504.1|4051448_4052276_+	hypothetical protein	NA	G8I9P6	Mycobacterium_virus	63.9	2.9e-96
WP_003911027.1|4052322_4053642_-	PE family protein	NA	NA	NA	NA	NA
WP_003419511.1|4053749_4056296_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	1.8e-128
WP_003419513.1|4056572_4056911_-	nucleoid-associated protein	NA	A0A2D1GPL8	Mycobacterium_phage	42.4	4.6e-16
WP_003901683.1|4057014_4058532_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	34.5	1.1e-69
>prophage 294
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4133214	4133670	4427062		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003419733.1|4133214_4133670_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.6	4.9e-21
>prophage 295
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4136695	4137052	4427062		Tsukamurella_phage(100.0%)	1	NA	NA
WP_003419743.1|4136695_4137052_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	1.8e-10
>prophage 296
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4142790	4144221	4427062		Mollivirus(100.0%)	1	NA	NA
WP_003419754.1|4142790_4144221_-	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	31.6	2.6e-23
>prophage 297
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4165525	4166536	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003419818.1|4165525_4166536_-	DUF4185 domain-containing protein	NA	B5LJL4	Mycobacterium_phage	31.5	7.9e-11
>prophage 298
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4179231	4182227	4427062		Tupanvirus(50.0%)	2	NA	NA
WP_003420415.1|4179231_4180494_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.0	1.4e-36
WP_003420417.1|4180490_4182227_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	1.7e-42
>prophage 299
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4185709	4186711	4427062		Vaccinia_virus(100.0%)	1	NA	NA
WP_003911033.1|4185709_4186711_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q1M1E9	Vaccinia_virus	34.4	1.2e-08
>prophage 300
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4197254	4198331	4427062		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003420435.1|4197254_4198331_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	28.2	2.7e-17
>prophage 301
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4208887	4215202	4427062	integrase	Acidithiobacillus_phage(40.0%)	10	4208904:4208918	4214776:4214790
WP_003899665.1|4208887_4210870_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	8.8e-91
4208904:4208918	attL	CCAGCGGCGCGGCGC	NA	NA	NA	NA
WP_003901716.1|4210936_4211299_+	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR	NA	NA	NA	NA	NA
WP_003899668.1|4211382_4211595_-	DUF2237 family protein	NA	NA	NA	NA	NA
WP_003899670.1|4211667_4212003_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003899671.1|4212220_4212604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899672.1|4212733_4213093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899673.1|4213125_4213635_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	42.6	4.0e-11
WP_003420504.1|4213702_4214095_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	47.0	4.8e-17
WP_071854238.1|4214358_4214586_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	72.4	1.5e-15
WP_003420508.1|4214743_4215202_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.2e-05
4214776:4214790	attR	CCAGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 302
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4218783	4228476	4427062		Planktothrix_phage(20.0%)	9	NA	NA
WP_003906205.1|4218783_4219914_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.9e-20
WP_003901718.1|4219922_4220870_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003420534.1|4221034_4221337_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003420539.1|4221358_4222414_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003900750.1|4222492_4224373_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	7.5e-140
WP_003420544.1|4224543_4225023_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_003906207.1|4225078_4226506_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.3e-06
WP_003420552.1|4226576_4227281_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.9e-35
WP_003901719.1|4227789_4228476_+	hypothetical protein	NA	A0A2P1CG82	Mycobacterium_phage	54.1	4.6e-55
>prophage 303
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4232627	4233689	4427062		Pacmanvirus(100.0%)	1	NA	NA
WP_003420576.1|4232627_4233689_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	4.7e-14
>prophage 304
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4243021	4249001	4427062		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003420603.1|4243021_4243843_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	5.4e-10
WP_003906213.1|4243839_4244754_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003420610.1|4244750_4245593_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003420612.1|4245748_4246729_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.5	1.2e-32
WP_003420618.1|4247777_4249001_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	31.4	3.4e-08
>prophage 305
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4278758	4282063	4427062		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_003420779.1|4278758_4279769_-	cutinase family protein	NA	A0A2K9VEH2	Gordonia_phage	28.6	6.9e-07
WP_003420783.1|4279967_4280867_-	MPT51/MPB51 antigen	NA	A0A2I6AZH7	Macacine_betaherpesvirus	38.4	5.1e-46
WP_003900759.1|4281046_4282063_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	1.3e-178
>prophage 306
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4287680	4291822	4427062		Streptococcus_phage(50.0%)	3	NA	NA
WP_003420798.1|4287680_4288880_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.5	8.8e-86
WP_003420801.1|4289143_4289998_+	exported repetitive protein	NA	NA	NA	NA	NA
WP_003420805.1|4290202_4291822_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	39.4	1.1e-06
>prophage 307
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4302125	4303340	4427062		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899709.1|4302125_4303340_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	35.6	3.7e-23
>prophage 308
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4308629	4315010	4427062		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003900763.1|4308629_4315010_-	phthioceranic/hydroxyphthioceranic acid synthase	NA	D0R7J2	Paenibacillus_phage	30.1	4.6e-24
>prophage 309
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4323061	4324321	4427062	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003420889.1|4323061_4324321_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	33.8	7.7e-56
>prophage 310
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4336110	4336734	4427062		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003399735.1|4336110_4336734_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	1.2e-33
>prophage 311
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4358718	4370468	4427062		Mycobacterium_phage(40.0%)	9	NA	NA
WP_003399850.1|4358718_4360440_+	type VII secretion system ESX-1 AAA family ATPase EccA1	NA	V5UQM2	Mycobacterium_phage	33.2	8.6e-58
WP_003399854.1|4360443_4361886_+	type VII secretion system ESX-1 subunit EccB1	NA	NA	NA	NA	NA
WP_003899738.1|4361885_4364129_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1	NA	A0A142F150	Bacillus_phage	28.6	7.6e-14
WP_003399865.1|4364284_4366060_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1	NA	A0A1P8DJB2	Virus_Rctr71	26.7	1.4e-07
WP_003399870.1|4366202_4366499_+	type VII secretion system ESX-1 target PE35	NA	NA	NA	NA	NA
WP_003399879.1|4366532_4367639_+	type VII secretion system ESX-1 target PPE68	NA	NA	NA	NA	NA
WP_003399940.1|4367731_4368034_+	type VII secretion system ESX-1 WXG100 family target CFP-10	NA	NA	NA	NA	NA
WP_003399963.1|4368066_4368354_+	type VII secretion system ESX-1 WXG100 family target ESAT-6	NA	A0A2I6AZH7	Macacine_betaherpesvirus	100.0	1.4e-45
WP_003909105.1|4368467_4370468_+	type VII secretion system ESX-1 associated protein EspI	NA	V5UPR8	Mycobacterium_phage	28.8	4.4e-21
>prophage 312
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4378910	4385664	4427062	protease	Mycobacterium_phage(100.0%)	4	NA	NA
WP_003400004.1|4378910_4380251_-|protease	type VII secretion system ESX-1 serine protease mycosin MycP1	protease	V5UPA7	Mycobacterium_phage	41.0	1.4e-79
WP_003400005.1|4380472_4382332_-	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	29.3	2.5e-47
WP_031709332.1|4382401_4384015_-	type VII secretion system ESX-2 subunit EccE2	NA	NA	NA	NA	NA
WP_003400012.1|4384011_4385664_-|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	V5UPA7	Mycobacterium_phage	36.6	1.1e-67
>prophage 313
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4395945	4398344	4427062		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031709335.1|4395945_4397433_-	type VII secretion system ESX-2 subunit EccB2	NA	V5UN45	Mycobacterium_phage	37.2	7.6e-71
WP_003899753.1|4397435_4398344_-	transglycosylase	NA	A0A2H4PIU8	Corynebacterium_phage	46.1	2.4e-11
>prophage 314
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4407128	4408571	4427062	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400120.1|4407128_4408571_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	37.3	7.7e-60
>prophage 315
NZ_CP017593	Mycobacterium tuberculosis strain Beijing-like/35049 chromosome, complete genome	4427062	4417224	4423028	4427062		Orpheovirus(25.0%)	6	NA	NA
WP_003900782.1|4417224_4418232_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.2	1.1e-68
WP_003400164.1|4418228_4418579_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.8	3.9e-26
WP_003400168.1|4418688_4419909_+	hydrolase	NA	Q0H257	Geobacillus_phage	29.2	2.6e-08
WP_003400171.1|4419929_4420664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400175.1|4420953_4421988_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_078387225.1|4421984_4423028_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	1.4e-23
