The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	1602801	1609941	4858944		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1602801_1603440_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1603436_1604699_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1604695_1605604_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1605799_1606567_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1606617_1607274_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1607379_1609941_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	2214621	2224063	4858944		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001748561.1|2214621_2215548_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_001471850.1|2215552_2216284_+	osmoprotectant uptake system permease yehW	NA	NA	NA	NA	NA
WP_001216961.1|2216264_2216372_-	membrane protein	NA	NA	NA	NA	NA
WP_001240401.1|2216431_2217163_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2217384_2219070_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2219066_2219786_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001442361.1|2219832_2220303_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	6.7e-82
WP_085704054.1|2220343_2220805_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001317947.1|2220929_2222930_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|2222926_2224063_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	2316775	2323973	4858944		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001115986.1|2316775_2318170_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.1e-18
WP_000183060.1|2318344_2319238_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_071529667.1|2319277_2319538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038998936.1|2319609_2320695_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	2.1e-102
WP_038998934.1|2320694_2321594_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	5.7e-29
WP_085704074.1|2321651_2322530_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_032267164.1|2322534_2323083_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.1e-50
WP_085704076.1|2323094_2323973_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.9	9.2e-16
>prophage 4
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	2765314	2828810	4858944	holin,terminase,tail,portal,protease	Enterobacteria_phage(45.45%)	70	NA	NA
WP_001260855.1|2765314_2766136_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2766235_2766319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2766411_2766747_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2767143_2768397_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2768503_2769397_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2769531_2770752_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_000919231.1|2770876_2771572_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_001315626.1|2771524_2772817_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2772976_2773591_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2773633_2774488_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2774489_2775107_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2775117_2777541_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041534.1|2777601_2780028_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
WP_001295396.1|2780226_2780532_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2780639_2781350_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2781352_2781913_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2781947_2782289_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2782423_2782750_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_071524605.1|2782786_2782975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|2782955_2784170_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2784181_2785201_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072133799.1|2785258_2785369_+	transporter	NA	NA	NA	NA	NA
WP_001344508.1|2785388_2786684_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
WP_000005552.1|2786703_2786955_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048357.1|2787027_2789499_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2789592_2789784_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000783095.1|2789780_2789969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347339.1|2790455_2791073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2791032_2791188_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001322436.1|2791380_2791839_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
WP_000476993.1|2791865_2792093_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2792076_2792598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250466.1|2792524_2793544_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.6e-56
WP_001151185.1|2793584_2794010_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	5.4e-62
WP_023156363.1|2794382_2795090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402181.1|2795099_2795366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096969.1|2796598_2797948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250468.1|2798185_2798365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2798581_2798737_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000981001.1|2798953_2799205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032151735.1|2799271_2799550_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265024.1|2799551_2800607_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	3.2e-87
WP_000140005.1|2800607_2800988_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.7e-35
WP_000762931.1|2800984_2801806_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000839572.1|2802241_2802457_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193284.1|2802461_2802806_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.1e-36
WP_000369848.1|2802771_2803044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992051.1|2803149_2803692_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.2	9.5e-96
WP_000700650.1|2803688_2804225_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	4.2e-72
WP_000421825.1|2805654_2806194_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507029.1|2806202_2808302_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_001072975.1|2808298_2808511_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001613114.1|2808510_2810019_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	1.2e-286
WP_072170777.1|2809867_2811991_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.2	0.0e+00
WP_001322266.1|2812032_2812401_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
WP_001283153.1|2812393_2812669_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|2812680_2813259_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2813255_2813657_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2813668_2814412_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|2814472_2814859_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|2814867_2815197_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001613112.1|2815168_2818234_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447248.1|2818233_2818563_+|tail	tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001724602.1|2818572_2819271_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_024170790.1|2819276_2820020_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_010380892.1|2819917_2820559_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	2.5e-95
WP_072656652.1|2820619_2824099_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001233114.1|2824166_2824766_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_072656653.1|2824830_2828229_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_001724755.1|2828228_2828810_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.2	2.3e-100
>prophage 5
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	3040036	3103983	4858944	lysis,transposase,terminase,holin,integrase,tail,tRNA	Escherichia_phage(42.86%)	70	3064849:3064865	3109584:3109600
WP_000837924.1|3040036_3041170_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3041310_3041745_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_063112648.1|3042704_3042887_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	93.3	1.7e-25
WP_000078178.1|3043254_3043845_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_063112647.1|3043942_3044518_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_074161850.1|3044517_3047913_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_063112646.1|3047977_3048577_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	8.5e-106
WP_063112645.1|3048644_3052124_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000741589.1|3052184_3052832_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140750.1|3052729_3053473_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_024238971.1|3053478_3054177_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.6e-127
WP_000024051.1|3054176_3054515_-|tail	tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_063112644.1|3054507_3057741_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.1	2.8e-110
WP_001755909.1|3057906_3058107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000470330.1|3058214_3058664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114146959.1|3059179_3060392_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_061301344.1|3061026_3061419_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_001029815.1|3061415_3061796_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|3061796_3062180_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|3062179_3062575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|3062797_3063937_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770038.1|3064035_3064800_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
3064849:3064865	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001317036.1|3064904_3066017_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000763708.1|3066000_3067407_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_063112643.1|3067409_3068711_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000089446.1|3068691_3069786_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000126788.1|3069789_3069999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|3069976_3070909_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_085947772.1|3071220_3072434_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_074161867.1|3072465_3072957_-	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	51.4	4.2e-34
WP_071533110.1|3072874_3073156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024235095.1|3073094_3074552_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228691.1|3074748_3074934_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	75.4	8.9e-14
WP_001135310.1|3075150_3075648_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|3075647_3075863_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|3076114_3076489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|3076660_3077089_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|3078133_3078676_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|3078672_3078963_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|3078962_3079562_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|3080375_3080714_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_048963425.1|3080932_3081076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117226.1|3081437_3082637_+	MFS transporter	NA	NA	NA	NA	NA
WP_085704121.1|3082648_3083341_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|3083337_3084219_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|3084349_3085627_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000606008.1|3085690_3087694_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
WP_001151151.1|3088028_3088451_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_063112683.1|3088491_3089562_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|3089633_3090059_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|3090042_3090324_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|3090424_3090844_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001312794.1|3091053_3091233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|3091243_3091399_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3091395_3091884_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_099481753.1|3091918_3092197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560225.1|3092325_3092547_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3092546_3092717_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3092791_3093067_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105142.1|3093168_3095760_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.0	1.3e-243
WP_000166319.1|3095752_3096562_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3096618_3096813_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3096805_3097015_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3097093_3097309_+	Rac prophage; conserved protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|3097310_3098546_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|3098597_3099533_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123739.1|3099661_3101035_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|3101064_3101238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|3101512_3102496_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3102750_3103983_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3109584:3109600	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 6
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	3474010	3600955	4858944	lysis,capsid,head,holin,plate,terminase,integrase,tail,portal,protease,tRNA	Escherichia_phage(47.54%)	119	3485949:3485969	3587608:3587628
WP_000156526.1|3474010_3475771_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_000227927.1|3475839_3476358_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000828648.1|3476427_3476595_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|3476850_3477414_-	DUF330 domain-containing protein	NA	NA	NA	NA	NA
WP_000445533.1|3477410_3479051_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
WP_000333176.1|3479055_3480309_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000053099.1|3480438_3482346_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
WP_001086549.1|3482357_3484466_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224273.1|3484709_3485819_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001295353.1|3485815_3486358_-	cell division protein ZapC	NA	NA	NA	NA	NA
3485949:3485969	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001295352.1|3486531_3487542_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001307090.1|3487652_3488363_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|3488355_3488871_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730612.1|3488878_3489421_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165655.1|3489432_3490503_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286325.1|3490493_3493094_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000845152.1|3493118_3493820_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000750284.1|3493902_3494445_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263934.1|3494801_3495377_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244318.1|3495369_3496329_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063112661.1|3496325_3497471_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
WP_000235203.1|3497481_3498273_+	aliphatic sulfonate ABC transporter permease	NA	NA	NA	NA	NA
WP_001090514.1|3498269_3499037_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193844.1|3499243_3501856_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|3502121_3503324_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3503492_3504893_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3505494_3506583_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000492467.1|3506598_3506781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000462687.1|3506767_3507958_+	aspartate aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|3508179_3508827_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001295932.1|3508853_3509402_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|3509582_3511430_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001471316.1|3511690_3516151_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3516150_3516855_-	condensin subunit E	NA	NA	NA	NA	NA
WP_001288850.1|3516835_3518158_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3518154_3518940_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|3519075_3519855_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3519831_3520725_-	protein kinase-like domain protein	NA	NA	NA	NA	NA
WP_000011590.1|3520878_3521625_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3521621_3521804_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056529.1|3521855_3523088_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570542.1|3523124_3524111_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3524107_3525856_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3525892_3528157_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3528363_3528648_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3528807_3530481_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_001583403.1|3530591_3531275_-	cytidylate kinase	NA	NA	NA	NA	NA
WP_001295345.1|3531447_3532212_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_001471310.1|3532380_3533664_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001471308.1|3533734_3534823_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642849.1|3535021_3535714_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001307086.1|3535843_3537604_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3538009_3538867_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3538921_3541204_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000035493.1|3541523_3541778_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
WP_000882940.1|3541823_3542987_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_085704129.1|3542986_3543466_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	2.5e-84
WP_085704131.1|3543480_3545928_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	95.1	0.0e+00
WP_000785970.1|3545920_3546040_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3546072_3546348_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3546404_3546923_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|3546935_3548126_-|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001474029.1|3548185_3548779_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	95.4	3.3e-102
WP_085704135.1|3548806_3549142_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000289820.1|3549143_3549572_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	1.1e-25
WP_085704138.1|3549543_3550137_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	65.0	2.4e-60
WP_085704140.1|3550136_3551420_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	65.6	2.0e-160
WP_085704143.1|3551416_3552028_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.1e-116
WP_021525816.1|3552020_3552929_-	hypothetical protein	NA	A0A0F7LCQ9	Escherichia_phage	99.7	5.7e-162
WP_032277167.1|3552933_3553281_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_085704146.1|3553277_3553913_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.2	4.2e-111
WP_085704148.1|3553990_3554746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021563760.1|3554742_3555201_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	7.8e-43
WP_000917186.1|3555193_3555661_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001300730.1|3555623_3555797_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_085704151.1|3555768_3556194_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	96.5	8.0e-66
WP_024235657.1|3556181_3556607_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.9	2.9e-60
WP_001144101.1|3556621_3557119_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3557118_3557400_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|3557403_3557607_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|3557606_3558116_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_085704156.1|3558215_3558959_-|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.4	3.0e-124
WP_001543013.1|3558962_3560036_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	1.6e-200
WP_001543014.1|3560094_3560949_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	4.7e-134
WP_000156861.1|3561122_3562895_+|terminase	terminase	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001543015.1|3562894_3563929_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.2e-200
WP_001389235.1|3564321_3565305_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_001062015.1|3565297_3566581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085704159.1|3566756_3569012_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.3	0.0e+00
WP_000027662.1|3569001_3569277_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	100.0	3.8e-45
WP_085704162.1|3569273_3569498_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	95.9	1.2e-33
WP_001277949.1|3569497_3569800_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	95.0	4.2e-45
WP_000557703.1|3569799_3570024_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217682.1|3570087_3570588_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_085704165.1|3570584_3570782_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	8.0e-29
WP_001389237.1|3570765_3571122_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3571230_3571530_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3571623_3572619_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3572650_3573448_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190375.1|3573529_3574120_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242675.1|3574219_3575128_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3575128_3576559_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
WP_000109289.1|3576768_3577917_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3578231_3578858_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3578893_3579757_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_000213098.1|3579758_3580376_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850313.1|3580386_3582831_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000886683.1|3583069_3584362_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067751.1|3584452_3585796_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|3585806_3586418_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000077054.1|3586576_3590644_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3587608:3587628	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3590778_3591273_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
WP_000537418.1|3591817_3592783_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043601.1|3592905_3594672_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3594672_3596394_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3596435_3597140_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3597424_3597643_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3598327_3600604_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3600634_3600955_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 7
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	4187592	4271993	4858944	transposase,capsid,head,holin,plate,terminase,integrase,tail,portal,protease	Shigella_phage(55.0%)	99	4228419:4228474	4268082:4268137
WP_072652242.1|4187592_4188792_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001159102.1|4189994_4191665_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|4192739_4193303_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|4193632_4194427_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|4194580_4195342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|4196487_4197681_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|4197864_4198530_+	membrane protein	NA	NA	NA	NA	NA
WP_001095423.1|4198504_4198702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001330878.1|4198608_4198821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370308.1|4198775_4199471_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|4199463_4200891_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4200901_4201621_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|4202150_4203005_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046304.1|4203230_4204556_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474074.1|4204664_4204901_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|4204912_4205506_+	membrane protein	NA	NA	NA	NA	NA
WP_001268229.1|4206062_4206953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092556.1|4207073_4211327_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4212442_4212544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|4212906_4213170_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
WP_000866436.1|4213169_4213310_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|4213344_4213572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220237.1|4214346_4214937_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000730974.1|4215011_4215599_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4215656_4216325_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|4216350_4218876_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|4218865_4220509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305432.1|4220477_4221188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|4221500_4221830_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001315267.1|4221824_4222004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|4222077_4222692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296889.1|4222804_4222930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063112707.1|4223109_4223799_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4223795_4224752_+	PaoABC aldehyde oxidoreductase FAD-containing subunit	NA	NA	NA	NA	NA
WP_000667026.1|4224748_4226947_+	PaoABC aldehyde oxidoreductase Moco-containing subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121354.1|4226956_4227913_+	XdhC family protein	NA	NA	NA	NA	NA
WP_001111353.1|4227891_4228302_+	hypothetical protein	NA	NA	NA	NA	NA
4228419:4228474	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000543001.1|4228539_4228692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246059.1|4229228_4229972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001328133.1|4230220_4230424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|4230796_4231570_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904961.1|4231630_4232185_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	89.5	1.5e-88
WP_085704207.1|4233280_4233682_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	55.6	1.6e-23
WP_038977180.1|4234292_4234877_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_061350227.1|4234867_4235926_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	2.5e-201
WP_001310202.1|4235912_4236341_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259082.1|4236337_4236886_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	1.5e-96
WP_000999510.1|4236885_4237965_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_053893056.1|4237961_4239338_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.9	2.5e-254
WP_072656756.1|4239362_4241270_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.2	0.0e+00
WP_000571713.1|4241354_4241678_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_001526906.1|4241674_4242031_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_072656758.1|4242030_4243527_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.4	2.9e-272
WP_000497748.1|4243510_4243681_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_072656760.1|4243689_4244250_-	hypothetical protein	NA	U5P4H6	Shigella_phage	98.4	3.7e-103
WP_001522202.1|4244246_4244771_-	hypothetical protein	NA	U5P416	Shigella_phage	100.0	8.6e-94
WP_000702400.1|4244742_4245153_-|head,tail	head-tail adaptor protein	head,tail	U5P0R0	Shigella_phage	100.0	1.7e-73
WP_000927711.1|4245149_4245473_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_024221346.1|4245475_4245676_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	4.5e-27
WP_024221345.1|4245724_4246930_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	5.9e-223
WP_000279346.1|4246944_4247631_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
WP_000466255.1|4247572_4248814_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|4248813_4248996_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088153.1|4249007_4250741_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
WP_077250491.1|4250737_4251241_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	3.3e-87
WP_024188390.1|4251357_4251708_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	6.8e-63
WP_000594256.1|4251870_4252209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021539062.1|4252428_4252821_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	85.9	1.9e-53
WP_001075792.1|4252817_4253432_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.5	2.0e-110
WP_000422366.1|4253431_4253713_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4253699_4254086_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001569330.1|4254165_4254423_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_085704210.1|4254573_4255326_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	9.0e-137
WP_114146960.1|4255339_4256329_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	3.1e-193
WP_001061378.1|4256336_4257146_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_000767127.1|4257165_4257555_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001532214.1|4257551_4257878_-	lexA DNA-binding domain protein	NA	A5LH73	Enterobacteria_phage	99.1	7.8e-53
WP_001532213.1|4257874_4258528_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_085704217.1|4258527_4259022_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.1	1.4e-82
WP_001406328.1|4259018_4259960_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
WP_001250269.1|4259949_4260129_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001752099.1|4260304_4260856_-	hypothetical protein	NA	S5FXP0	Shigella_phage	95.1	8.7e-97
WP_000187185.1|4260878_4261127_-	chaperone TorD	NA	NA	NA	NA	NA
WP_000853319.1|4261262_4261949_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000389078.1|4261931_4262822_-	hypothetical protein	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
WP_001083098.1|4263024_4263228_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_001514782.1|4263236_4263512_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_000141753.1|4263429_4263675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085704220.1|4263815_4264040_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	1.1e-13
WP_000135680.1|4264112_4264475_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|4264540_4265365_+	DUF2303 family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008202.1|4265492_4266029_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|4266019_4266382_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206733.1|4266381_4266687_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_000433939.1|4266686_4267037_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_064734231.1|4267138_4268077_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
WP_063112563.1|4268281_4269535_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.7e-95
4268082:4268137	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4269546_4270650_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4270937_4271993_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 8
NZ_CP020933	Escherichia coli strain HB-Coli0 chromosome, complete genome	4858944	4296471	4352960	4858944	plate,tRNA,transposase	uncultured_Caudovirales_phage(22.22%)	43	NA	NA
WP_033882869.1|4296471_4297608_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001350058.1|4298478_4298916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112532.1|4298875_4302937_-	RHS repeat family protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_000103361.1|4303012_4305154_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|4305363_4305882_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|4306578_4307079_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4307113_4307338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114146961.1|4308148_4308304_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085947772.1|4308335_4309548_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000611738.1|4310318_4310732_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393855.1|4310735_4312586_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4312549_4313632_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4313656_4314937_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4314933_4315458_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|4315460_4316792_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|4316796_4317558_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_085704223.1|4317566_4320332_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	1.5e-80
WP_000088862.1|4320328_4321072_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_089180192.1|4321010_4322489_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001137126.1|4322567_4326032_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|4326042_4327395_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4327418_4327901_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|4327944_4328859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4328868_4329348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4329484_4330270_-	aminopeptidase	NA	NA	NA	NA	NA
WP_099139211.1|4330689_4330869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4330808_4331540_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4331604_4332072_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4332068_4332791_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4332824_4333580_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4333651_4335010_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|4335057_4335828_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4335905_4336706_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|4336946_4337861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|4337857_4338661_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140187.1|4344547_4345123_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4345310_4346342_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4346334_4346988_+	methionine ABC transporter	NA	NA	NA	NA	NA
WP_000874224.1|4347027_4347843_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4347960_4348365_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4348361_4349069_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|4349180_4350899_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|4351979_4352960_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020934	Escherichia coli strain HB-Coli0 plasmid unnamed1, complete sequence	151137	1406	61876	151137	integrase,protease,transposase	Escherichia_phage(19.05%)	59	39720:39749	59482:59511
WP_114146962.1|1406_2598_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000738422.1|3760_4054_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001324238.1|4569_4752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324233.1|6737_7001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001318220.1|7199_8315_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_015918732.1|8328_12114_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
WP_000933678.1|12217_13447_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271274.1|13531_14488_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|14532_16710_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_085704285.1|17007_17235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243204.1|17234_17450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312840.1|17454_17655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190234.1|17575_18610_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_012006526.1|18627_18819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377483.1|19169_19478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|19576_19759_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|19755_19953_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001324221.1|20667_21909_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
WP_001183604.1|21883_23998_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|24167_24479_-	colicin V	NA	NA	NA	NA	NA
WP_000358967.1|24574_24781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379710.1|25632_25902_+	membrane protein	NA	NA	NA	NA	NA
WP_063099985.1|25898_26879_+	flavin-binding monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001171523.1|26954_27335_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|27331_27679_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_077249982.1|30639_30819_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
WP_063102497.1|30887_31274_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|31593_31986_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_002914189.1|33343_34519_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|34542_37695_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|37764_38244_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|38345_39050_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000656305.1|39300_39678_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
39720:39749	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_063112526.1|39744_42711_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|42713_43274_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_004193519.1|43399_44014_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|43952_44966_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|45123_45597_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|45670_46375_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000880559.1|46436_47144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240536.1|47130_47982_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|48289_49105_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|49165_49969_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|49968_50805_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|50865_51570_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|51720_52536_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|52725_53430_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|53476_54781_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000204520.1|54819_55527_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|55523_55760_-	mercury resistance protein	NA	NA	NA	NA	NA
WP_001277456.1|55756_56119_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000105636.1|56136_57831_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|57882_58305_-	mercury transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|58340_58616_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|58629_58980_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429836.1|59051_59486_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
WP_012602142.1|60437_60542_-	hypothetical protein	NA	NA	NA	NA	NA
59482:59511	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_012602143.1|60538_61003_-	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_000616807.1|61222_61876_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP020936	Escherichia coli strain HB-Coli0 plasmid unnamed3, complete sequence	64749	3550	63671	64749	transposase,plate,terminase	Escherichia_phage(60.34%)	66	NA	NA
WP_063100006.1|3550_5107_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
WP_001190712.1|5289_5511_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216033.1|5510_5891_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.3e-62
WP_001339207.1|5895_6075_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_063100003.1|6102_7146_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	97.4	9.1e-204
WP_001326849.1|7234_7687_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_032167084.1|7772_8966_+|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	99.5	1.4e-179
WP_000124159.1|8965_10450_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_071527722.1|10672_10792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001361625.1|10810_11032_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	81.2	6.0e-25
WP_059257146.1|11028_12141_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	86.5	1.7e-176
WP_000611664.1|12173_13025_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_000874156.1|13135_13345_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_012817944.1|13310_13406_-	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_001312283.1|13424_13538_-	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_000542332.1|13949_14171_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_063100004.1|14178_15210_+	recombinase	NA	Q71TG5	Escherichia_phage	99.7	2.9e-194
WP_001224242.1|15260_15572_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	1.3e-44
WP_063100005.1|15820_16396_+	recombinase	NA	Q71TG3	Escherichia_phage	97.2	3.4e-96
WP_001138064.1|16392_19359_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_072650945.1|19361_19922_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067858.1|20484_21189_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001615634.1|21266_21833_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	1.9e-99
WP_077879418.1|21963_23196_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000245712.1|24260_24482_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_074147523.1|25920_26145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063099947.1|26163_26964_+	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.2	5.4e-148
WP_063099946.1|26993_27839_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.6	2.5e-151
WP_001369095.1|27889_28135_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|28316_28472_+	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001300563.1|28665_29778_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000944483.1|30175_31168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509939.1|31465_31975_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|31986_32568_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041756.1|32603_33419_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
WP_063099991.1|33428_35018_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.6	3.7e-305
WP_000067710.1|35078_36785_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_042016981.1|37049_38015_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	98.1	3.4e-165
WP_000817632.1|38011_39217_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|39616_40477_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_063099992.1|40795_41188_-	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	97.7	1.9e-69
WP_063099993.1|41365_41788_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	85.0	2.2e-55
WP_063099994.1|41827_42616_-	hypothetical protein	NA	A0A077SK48	Escherichia_phage	98.1	1.1e-116
WP_001369296.1|42624_42804_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_063099995.1|43079_43364_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472529.1|43356_44262_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_063099996.1|44258_47300_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.1	0.0e+00
WP_063099997.1|47670_48840_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	84.6	1.3e-177
WP_112920662.1|48736_48949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535202.1|51393_52026_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_063099998.1|52018_53035_-	hypothetical protein	NA	Q1MVH7	Enterobacteria_phage	99.7	3.5e-192
WP_000602711.1|53036_53822_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_063099999.1|53808_54537_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	99.6	2.7e-138
WP_001141915.1|54540_55758_-	hypothetical protein	NA	Q71T88	Escherichia_phage	100.0	1.4e-224
WP_000235786.1|55767_56145_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|56291_56537_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|56539_57118_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|57184_57340_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_072652242.1|58169_59369_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|59378_59567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114146963.1|59622_60156_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	3.4e-90
WP_001354545.1|60152_60830_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684845.1|60826_61528_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_000267620.1|61609_61828_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_063100000.1|61829_63092_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.0e-233
WP_063100001.1|63164_63671_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.2	1.0e-91
