The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020894	Legionella longbeachae strain F1157CHC chromosome, complete genome	4142881	1065495	1121497	4142881	tRNA,transposase,integrase	Cronobacter_phage(16.67%)	56	1110633:1110650	1128903:1128920
WP_012978931.1|1065495_1065831_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_105223260.1|1065850_1066513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003632400.1|1066658_1068140_-	amino acid permease	NA	NA	NA	NA	NA
WP_085662914.1|1068388_1068817_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_085662877.1|1069338_1069524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662878.1|1069524_1070322_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	30.2	5.6e-20
WP_085662879.1|1070738_1071491_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_085662880.1|1071520_1072597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662881.1|1072871_1074320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662882.1|1075590_1076133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125466281.1|1076506_1076584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662883.1|1076650_1077481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662884.1|1077793_1078120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662885.1|1078258_1078762_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	33.3	2.8e-17
WP_085662886.1|1079568_1080585_+	esterase family protein	NA	NA	NA	NA	NA
WP_085662887.1|1080716_1081616_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_085662888.1|1081608_1082412_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_085662889.1|1083043_1083400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662890.1|1083648_1085583_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_085662891.1|1085579_1085903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172622898.1|1085917_1086091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662892.1|1086096_1087650_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_085662893.1|1087662_1089021_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662894.1|1089030_1090005_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662895.1|1089997_1092757_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_085662896.1|1092766_1093114_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_085662897.1|1093070_1094330_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662898.1|1094326_1095103_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662899.1|1095089_1095746_-	DUF2895 family protein	NA	NA	NA	NA	NA
WP_085662900.1|1095738_1096101_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_058463393.1|1096113_1096479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662901.1|1096475_1096742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662902.1|1096741_1097068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662903.1|1097077_1097713_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_085662904.1|1097703_1098135_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662905.1|1098134_1098956_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_085662906.1|1098948_1099533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662907.1|1099529_1099943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662908.1|1099935_1100166_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_085662909.1|1100526_1101432_-	Vir protein	NA	NA	NA	NA	NA
WP_085662910.1|1101688_1103419_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085662911.1|1103459_1103732_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085662912.1|1103785_1105762_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.4	3.4e-34
WP_085662914.1|1106563_1106992_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_085662915.1|1107143_1107440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085662916.1|1107439_1110745_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
1110633:1110650	attL	TAATAAACATCAACGATA	NA	NA	NA	NA
WP_011215181.1|1111140_1111413_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085662917.1|1111488_1113240_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.7	2.3e-66
WP_085662918.1|1113361_1114171_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_172622899.1|1114820_1116539_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_085662920.1|1116539_1117934_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_085663037.1|1118306_1118582_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085662921.1|1118578_1118929_+	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	35.8	2.6e-06
WP_085662922.1|1118948_1119308_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085662923.1|1119376_1119631_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_085662924.1|1120255_1121497_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHM8	Moraxella_phage	34.1	2.0e-56
1128903:1128920	attR	TATCGTTGATGTTTATTA	NA	NA	NA	NA
>prophage 2
NZ_CP020894	Legionella longbeachae strain F1157CHC chromosome, complete genome	4142881	2223303	2276559	4142881	transposase	uncultured_virus(25.0%)	45	NA	NA
WP_085662449.1|2223303_2223885_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	33.3	1.2e-19
WP_172622906.1|2224060_2224234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619749.1|2225115_2225658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165391558.1|2226203_2226506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080619747.1|2226498_2226888_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_080619746.1|2227087_2228110_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_080619745.1|2228183_2228540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085662451.1|2228559_2228838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165391555.1|2229588_2229753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662453.1|2229749_2232509_-	cation-transporting P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	8.6e-68
WP_085662455.1|2232525_2233464_-	universal stress protein	NA	NA	NA	NA	NA
WP_085662457.1|2233542_2234283_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_085662459.1|2234334_2235489_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	46.6	2.2e-78
WP_080619740.1|2235681_2236425_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080619969.1|2236843_2237527_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_085662461.1|2238137_2238455_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	38.6	2.3e-09
WP_165391563.1|2239311_2239653_+	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_085662465.1|2239653_2239992_+	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_085662467.1|2240206_2240845_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080619735.1|2241040_2242582_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_085662461.1|2242815_2243133_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	38.6	2.3e-09
WP_105166017.1|2243203_2243641_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085662469.1|2244053_2246453_+	SidC	NA	NA	NA	NA	NA
WP_085662471.1|2247580_2248486_+	DNA polymerase III subunit epsilon	NA	A0A223W0B0	Agrobacterium_phage	36.6	4.0e-30
WP_080619968.1|2248549_2248807_+	YheU family protein	NA	NA	NA	NA	NA
WP_080619730.1|2248924_2249842_-	bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085662473.1|2252178_2253306_+	DUF4424 domain-containing protein	NA	NA	NA	NA	NA
WP_080619728.1|2253876_2254209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172622907.1|2254874_2255792_+	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	35.0	3.7e-44
WP_080619725.1|2256256_2256976_-	endonuclease	NA	NA	NA	NA	NA
WP_125461271.1|2257829_2261141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165391560.1|2261372_2261543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619723.1|2261551_2262616_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_125466274.1|2262618_2263842_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.3	7.3e-19
WP_085662479.1|2263916_2264828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125461270.1|2265479_2265701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619720.1|2266006_2266513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619719.1|2266900_2267761_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080619718.1|2268201_2269314_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_080619717.1|2269332_2270505_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_080619716.1|2271193_2272240_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_085662481.1|2272321_2273608_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_003636919.1|2273947_2274886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636918.1|2275276_2275696_+	TIGR03792 family protein	NA	NA	NA	NA	NA
WP_003636916.1|2276394_2276559_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP020894	Legionella longbeachae strain F1157CHC chromosome, complete genome	4142881	2434024	2440841	4142881		Acinetobacter_phage(42.86%)	9	NA	NA
WP_003636739.1|2434024_2434822_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.1e-23
WP_003636738.1|2434955_2435918_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	4.2e-38
WP_003636736.1|2435917_2436445_+	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	47.1	1.4e-24
WP_003636734.1|2436441_2437014_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003636733.1|2436994_2437537_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003636730.1|2437533_2438259_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	7.3e-19
WP_003636726.1|2438478_2439045_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.5e-56
WP_003636725.1|2439034_2440069_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.9	4.6e-75
WP_003636724.1|2440061_2440841_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.0	5.1e-58
>prophage 4
NZ_CP020894	Legionella longbeachae strain F1157CHC chromosome, complete genome	4142881	2994040	3003290	4142881		Bacillus_phage(16.67%)	6	NA	NA
WP_003635765.1|2994040_2995723_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	29.1	1.3e-18
WP_003635764.1|2996056_2997382_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.9	2.8e-48
WP_003635763.1|2997392_2998541_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.2	2.6e-127
WP_003635762.1|2998649_2999762_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	1.7e-51
WP_085662568.1|2999897_3001037_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.4	1.3e-25
WP_003635760.1|3001340_3003290_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	1.5e-146
>prophage 5
NZ_CP020894	Legionella longbeachae strain F1157CHC chromosome, complete genome	4142881	3209060	3276794	4142881	tRNA,transposase,protease,integrase	uncultured_Mediterranean_phage(20.0%)	60	3196884:3196908	3233759:3233783
3196884:3196908	attL	AATTACAGGGTGCATGCAGGGTGCA	NA	NA	NA	NA
WP_003636923.1|3209060_3209954_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105223258.1|3210094_3210994_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_085662596.1|3211260_3213672_-	SidC	NA	NA	NA	NA	NA
WP_085662598.1|3214084_3216271_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.6	3.4e-35
WP_019349995.1|3216263_3216428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662600.1|3216424_3216970_-	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_085662602.1|3216966_3218856_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_085662604.1|3218852_3220235_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_085662606.1|3220239_3220452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662608.1|3220475_3221216_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_085662610.1|3221227_3222475_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_085662612.1|3222480_3222888_-	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_085662614.1|3222890_3223766_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_085662616.1|3223762_3224461_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_085662618.1|3224457_3226992_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_058450406.1|3226988_3227288_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_058450407.1|3227284_3227662_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_085662620.1|3227673_3228639_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_085662622.1|3228658_3228931_-	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	51.0	7.7e-06
WP_058481199.1|3228950_3229259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662624.1|3229263_3230145_-	Vir protein	NA	NA	NA	NA	NA
WP_085662626.1|3230329_3231004_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085662628.1|3231104_3231524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058481195.1|3231527_3232751_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	28.7	6.4e-23
WP_085662630.1|3232753_3233488_-	Abi family protein	NA	NA	NA	NA	NA
WP_080619950.1|3233935_3234205_-	hypothetical protein	NA	NA	NA	NA	NA
3233759:3233783	attR	AATTACAGGGTGCATGCAGGGTGCA	NA	NA	NA	NA
WP_012979348.1|3234500_3236132_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_085662632.1|3236621_3239402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635412.1|3240458_3242312_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_012979349.1|3242565_3243312_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635408.1|3243654_3243867_+	ORF6N domain-containing protein	NA	NA	NA	NA	NA
WP_003635403.1|3244112_3245282_+	tetracycline destructase Tet(56)	NA	NA	NA	NA	NA
WP_003635401.1|3245511_3246135_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012979350.1|3246605_3247280_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_003635395.1|3247703_3248552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635393.1|3248721_3248949_-	ChaB family protein	NA	A5IZT6	Spodoptera_litura_granulovirus	42.7	1.3e-09
WP_003635391.1|3249126_3249411_-	DUF3175 domain-containing protein	NA	A0A0F6TH17	Sinorhizobium_phage	66.3	4.7e-22
WP_003635390.1|3249709_3250207_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012979352.1|3250341_3251946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979353.1|3252275_3253046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635384.1|3253088_3254375_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.6e-96
WP_003635381.1|3254567_3255338_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003635379.1|3255334_3255787_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003635377.1|3255942_3256986_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003635375.1|3257000_3257501_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_003635373.1|3257668_3259981_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003635371.1|3260115_3261468_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003635370.1|3261631_3262414_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003635368.1|3262442_3263201_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.3	2.0e-22
WP_003635363.1|3263573_3265115_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012979354.1|3265107_3266331_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_003635359.1|3266421_3267774_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.3	3.6e-19
WP_003635356.1|3267963_3268806_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_012979355.1|3268919_3269495_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635352.1|3269626_3270292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012979356.1|3270451_3271180_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012979357.1|3271374_3272859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635346.1|3273355_3274654_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.1	5.3e-68
WP_003635344.1|3274740_3275655_-|protease	protease modulator HflC	protease	R4VJU7	Alteromonas_phage	26.3	1.5e-05
WP_003635342.1|3275657_3276794_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 1
NZ_CP020895	Legionella longbeachae strain F1157CHC plasmid pLLO-F1157CHC, complete sequence	108267	90	28294	108267	transposase	Escherichia_phage(42.86%)	25	NA	NA
WP_172622932.1|90_831_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_085663042.1|2260_3268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979194.1|6913_7288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105223258.1|7247_8147_-	reverse transcriptase	NA	H7BVN7	unidentified_phage	24.5	1.5e-05
WP_003636923.1|8287_9181_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105223261.1|9213_9849_-|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	30.1	2.1e-14
WP_125466282.1|9827_10046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105223262.1|10446_11484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105223263.1|11623_12301_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	5.8e-42
WP_085663128.1|12705_13071_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085663049.1|13063_13366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085663050.1|13467_14589_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	32.1	1.6e-25
WP_085662914.1|15966_16395_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_085663053.1|16544_20165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085663054.1|20254_20533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105223266.1|20704_21418_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	8.1e-71
WP_085663055.1|21766_22024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085662914.1|22215_22644_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_085663056.1|22842_23025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085663057.1|23841_24846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105223267.1|25343_26045_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	1.5e-37
WP_085663058.1|26434_26758_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_085663059.1|26741_27101_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085663060.1|27360_27513_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_085663061.1|27586_28294_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.8	3.9e-25
