The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	174612	228808	4047168	tRNA,integrase,plate,transposase	Pseudomonas_phage(14.29%)	50	216013:216032	232986:233005
WP_004521984.1|174612_175911_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|175977_177060_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_085514447.1|177103_177961_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|178040_178349_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|178363_178960_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_004521980.1|179243_180032_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|180535_182137_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|182570_182774_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_085503478.1|182880_184344_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	37.9	1.2e-79
WP_004555450.1|184555_185818_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|186618_187224_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|187185_187761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|187720_189004_-	MFS transporter	NA	NA	NA	NA	NA
WP_004534987.1|189162_189807_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204168.1|189797_190148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527819.1|190144_190768_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004521971.1|190852_191749_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|191876_193013_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_085514750.1|193009_193225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085514448.1|193369_194488_-	acyltransferase	NA	NA	NA	NA	NA
WP_052107327.1|194486_194936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205258.1|194929_195376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076893105.1|195902_195998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553842.1|196036_198202_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_009945507.1|198783_199182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|199224_199494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|199596_199827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076906246.1|200060_200417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|200442_201711_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004521963.1|201725_203987_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_004199995.1|203983_205432_+	TolC family protein	NA	NA	NA	NA	NA
WP_004555447.1|205641_206628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|206639_207605_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009922418.1|207622_207901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085514449.1|207876_211770_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|211766_212756_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_024430742.1|212760_213693_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|213891_215013_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_009967199.1|215102_217772_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	2.9e-89
216013:216032	attL	AGATCGCGCAGGTTCAGCAC	NA	NA	NA	NA
WP_004200010.1|217805_218906_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_085514751.1|218869_220696_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011205263.1|220787_221300_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|221327_221831_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|221903_223394_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009967200.1|223410_223929_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|223965_224637_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|225012_225627_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|225735_227082_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|227078_227864_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_080003363.1|227950_228808_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	58.9	2.0e-84
232986:233005	attR	AGATCGCGCAGGTTCAGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	490965	497858	4047168	integrase	Burkholderia_phage(25.0%)	9	488170:488187	504765:504782
488170:488187	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_085514471.1|490965_491667_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	4.8e-07
WP_020850756.1|492123_492300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525721.1|492510_492759_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004530408.1|492915_493995_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_009932249.1|493994_494447_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_009932250.1|494704_495247_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_004530410.1|495500_496418_-	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922658.1|496417_496735_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004525725.1|497114_497858_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	9.4e-54
504765:504782	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	687262	755621	4047168	tRNA,integrase,transposase,portal	Liberibacter_phage(16.67%)	63	724135:724151	761427:761443
WP_011205178.1|687262_688726_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.5e-79
WP_004545318.1|688831_689293_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004524586.1|689588_690992_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_009906630.1|691160_692390_+|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	38.7	1.2e-66
WP_038740319.1|692488_693328_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	69.2	2.1e-81
WP_080558221.1|694036_696904_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
WP_009907004.1|697033_697375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405247.1|697371_697629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907002.1|697621_697798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405248.1|698168_698648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525824.1|698647_698818_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009906999.1|699048_699561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405250.1|699969_700911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405251.1|700879_701980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936425.1|702006_702156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085514482.1|702610_703186_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	40.1	4.2e-25
WP_157130482.1|703213_704164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085514483.1|704167_705226_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_076808774.1|706224_707157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525828.1|707524_708682_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_004533510.1|708744_708900_+	lipoprotein	NA	NA	NA	NA	NA
WP_004554138.1|709247_709559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524603.1|709576_710137_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_011204742.1|710625_710970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197759.1|711185_711740_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_004197761.1|711969_712386_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004523120.1|712788_713883_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	5.0e-19
WP_004545654.1|713879_714821_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_076853110.1|714991_716593_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004531075.1|716611_718060_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	2.9e-30
WP_009962325.1|718322_718871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017843685.1|719262_719373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189874.1|719461_720031_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004543087.1|720133_721102_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009962333.1|721244_722339_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004536006.1|722367_723480_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.5	3.5e-36
WP_004535322.1|723490_724366_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.0	2.1e-73
724135:724151	attL	CGGCGTCGAGCGCGGCG	NA	NA	NA	NA
WP_009969932.1|725384_726410_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_041197015.1|726406_727288_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009972644.1|727284_728139_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009972645.1|728323_729337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085514485.1|729343_729778_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157130483.1|730917_731973_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.1	3.7e-205
WP_004188977.1|732045_732330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|732326_732809_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_085504122.1|733437_734532_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076894123.1|734940_735138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509432.1|735134_736637_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	53.7	2.0e-151
WP_085509659.1|736726_738265_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.4	3.6e-140
WP_085509433.1|738257_739421_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	47.3	4.0e-43
WP_085512352.1|739417_742405_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	40.6	4.1e-209
WP_085514486.1|742414_745276_+	chromosome segregation protein SMC	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.3	2.8e-13
WP_085509436.1|745277_746546_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_009982080.1|746700_747108_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|747104_747452_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|747481_749044_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_080003473.1|749051_749681_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
WP_129112240.1|749807_750644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509438.1|750793_752011_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	66.8	1.0e-137
WP_085509439.1|752035_752794_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	47.4	1.6e-53
WP_085509440.1|752790_753315_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	61.6	4.9e-57
WP_085514487.1|753902_755273_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	23.3	1.8e-05
WP_085514488.1|755303_755621_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	47.9	5.3e-14
761427:761443	attR	CGCCGCGCTCGACGCCG	NA	NA	NA	NA
>prophage 4
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	1551712	1562662	4047168	protease	Streptococcus_phage(16.67%)	10	NA	NA
WP_004197486.1|1551712_1553827_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_050869651.1|1554124_1554628_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.4e-13
WP_071810810.1|1554819_1555038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189780.1|1555300_1555879_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|1556146_1557406_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_009929279.1|1557378_1557561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536101.1|1557573_1559184_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|1559314_1559518_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1560050_1560365_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1560361_1562662_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 5
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	2151095	2157886	4047168	integrase	Burkholderia_virus(33.33%)	10	2148898:2148918	2174669:2174689
2148898:2148918	attL	TCGCGGCGGGCGGCGGCGTGC	NA	NA	NA	NA
WP_004192768.1|2151095_2151797_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
WP_004526695.1|2152093_2153002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|2153549_2154380_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_071810706.1|2154688_2155117_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_009941993.1|2155067_2155274_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_004521809.1|2155294_2156008_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.3	1.5e-32
WP_011204999.1|2156016_2156523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009982284.1|2156494_2156968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028200809.1|2156960_2157467_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_028200808.1|2157463_2157886_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
2174669:2174689	attR	GCACGCCGCCGCCCGCCGCGA	NA	NA	NA	NA
>prophage 6
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	2999239	3003720	4047168		Burkholderia_virus(57.14%)	9	NA	NA
WP_004527234.1|2999239_2999473_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004531416.1|2999508_2999736_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004557051.1|2999989_3000385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028200808.1|3000665_3001088_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
WP_028200809.1|3001084_3001591_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_071810609.1|3001932_3002535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076804729.1|3002955_3003267_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_076833215.1|3003287_3003473_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_004196630.1|3003456_3003720_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
>prophage 7
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	3519462	3528291	4047168		Tanapox_virus(16.67%)	8	NA	NA
WP_004535490.1|3519462_3520305_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.6	1.4e-16
WP_004522362.1|3520643_3521567_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_122771151.1|3521694_3523023_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|3523249_3524152_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_004189725.1|3524495_3524813_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004537712.1|3524884_3525877_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009921652.1|3525935_3526859_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004537711.1|3526890_3528291_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	4.2e-79
>prophage 8
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	3590901	3626656	4047168	plate,integrase,transposase	Stx2-converting_phage(30.0%)	33	3604331:3604345	3621060:3621074
WP_045591085.1|3590901_3592365_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.2e-79
WP_004522322.1|3592623_3593184_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_085514684.1|3593721_3596091_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.8	2.0e-12
WP_004185855.1|3596157_3596361_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004185877.1|3596421_3597105_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.5	7.4e-13
WP_004185526.1|3597111_3598035_-	YicC family protein	NA	NA	NA	NA	NA
WP_004186400.1|3598206_3598938_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_004186211.1|3598934_3599567_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_085514685.1|3599563_3600781_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_080303461.1|3601304_3601511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534014.1|3601505_3601715_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	62.7	1.2e-11
WP_076849568.1|3601988_3602567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186041.1|3602740_3603235_+	TonB family protein	NA	NA	NA	NA	NA
WP_009980815.1|3603653_3604967_+	MHS family MFS transporter	NA	NA	NA	NA	NA
3604331:3604345	attL	CCAGGCCGCGCTCGA	NA	NA	NA	NA
WP_004186356.1|3605147_3605330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004522315.1|3605364_3606387_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_004532268.1|3606548_3608210_+	chloride channel protein	NA	NA	NA	NA	NA
WP_004194891.1|3608326_3608746_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_004186076.1|3608867_3609122_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_004185427.1|3609134_3609950_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004522312.1|3610008_3610821_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004552529.1|3610974_3611547_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004541356.1|3612465_3612738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085514686.1|3613129_3614320_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	40.6	6.1e-63
WP_085514687.1|3614511_3617442_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_085962187.1|3617478_3618712_+|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
WP_157130501.1|3618759_3619383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205728.1|3619415_3620045_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
WP_085504666.1|3620052_3621615_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
3621060:3621074	attR	CCAGGCCGCGCTCGA	NA	NA	NA	NA
WP_004524834.1|3621644_3621992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_085514782.1|3621988_3622396_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	35.7	2.4e-11
WP_157130502.1|3622467_3622914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085514688.1|3624844_3626656_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 9
NZ_CP018387	Burkholderia pseudomallei strain 2010007509 chromosome 1, complete sequence	4047168	3926991	3936258	4047168		unidentified_phage(16.67%)	7	NA	NA
WP_038752072.1|3926991_3928539_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|3928575_3929103_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|3929099_3929783_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|3929847_3930663_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_028201129.1|3930856_3932875_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004522147.1|3932908_3934039_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_004533561.1|3934305_3936258_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 1
NZ_CP018388	Burkholderia pseudomallei strain 2010007509 chromosome 2, complete sequence	3138916	74719	130235	3138916	transposase,plate	Trichoplusia_ni_ascovirus(14.29%)	34	NA	NA
WP_085504122.1|74719_75814_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004524887.1|75971_77144_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004529276.1|77472_78333_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	7.1e-13
WP_009982064.1|78334_79951_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_004529278.1|79963_81115_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004524882.1|81121_81964_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_085514796.1|81960_83967_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_009969379.1|84001_84886_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_085515004.1|85248_86910_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	4.6e-32
WP_004524878.1|88018_88930_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_009927010.1|88955_89240_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_004539278.1|89252_90188_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004544778.1|90184_91225_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_004529287.1|91265_92291_+	amidohydrolase	NA	NA	NA	NA	NA
WP_085514797.1|92287_94141_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_004529289.1|94154_94574_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_011205721.1|94646_95552_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004540486.1|96021_96618_+	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_004529292.1|96854_97583_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.7	8.4e-23
WP_038802333.1|98786_99907_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009969387.1|99937_100312_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_085515005.1|100530_102300_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_009941131.1|102811_103141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085514798.1|103147_112459_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071811406.1|112610_112808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|112808_113072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080003471.1|113663_118295_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004524859.1|118308_119577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130508.1|119592_121473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|121488_123693_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004533146.1|123689_126356_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_004537556.1|126368_127814_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004524812.1|127810_129682_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009935240.1|129686_130235_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP018388	Burkholderia pseudomallei strain 2010007509 chromosome 2, complete sequence	3138916	981087	1003731	3138916	integrase,transposase	Burkholderia_virus(30.77%)	23	980591:980609	988348:988366
980591:980609	attL	ATCCCCCTCTCTCCGCCAG	NA	NA	NA	NA
WP_009967711.1|981087_982368_+|integrase	putative integrase	integrase	NA	NA	NA	NA
WP_025249783.1|982588_984223_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_009967713.1|984215_985265_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.8	3.0e-53
WP_009935582.1|985442_985724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157130511.1|985883_987003_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_017882403.1|987125_987533_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	53.3	9.1e-35
WP_080003473.1|989034_989664_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
988348:988366	attR	ATCCCCCTCTCTCCGCCAG	NA	NA	NA	NA
WP_085504666.1|989671_991234_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_017335489.1|991263_991611_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_009982080.1|991607_992015_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_004542548.1|992665_993247_+	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_009967718.1|993492_993759_+	hypothetical protein	NA	Q8W6Q4	Burkholderia_virus	95.2	3.6e-40
WP_004552390.1|993743_993965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557715.1|993991_994099_-	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	97.1	8.2e-12
WP_009923452.1|994100_994232_-	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_004537565.1|994241_994517_-	bacteriophage protein Gp49	NA	Q6JIH4	Burkholderia_virus	95.6	5.2e-42
WP_004547086.1|995135_995357_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|995340_995625_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_085504122.1|996028_997123_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_085514864.1|998627_1000088_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_085504453.1|1000138_1001509_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_009967729.1|1001665_1002598_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_157130512.1|1003041_1003731_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018388	Burkholderia pseudomallei strain 2010007509 chromosome 2, complete sequence	3138916	1149419	1221150	3138916	holin,plate	Vibrio_phage(25.0%)	57	NA	NA
WP_004525541.1|1149419_1150187_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|1150225_1151227_-	HpnL family protein	NA	NA	NA	NA	NA
WP_009969809.1|1151223_1151997_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_009969808.1|1151993_1152689_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_009969807.1|1153053_1154568_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_076853326.1|1154537_1154870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525545.1|1156277_1157216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|1157249_1157798_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|1157794_1159306_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|1159449_1159977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|1160056_1160488_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|1160501_1162364_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|1162360_1163350_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|1163352_1166223_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_050868720.1|1166213_1168505_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|1168670_1170959_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|1170962_1173179_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|1173178_1174249_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004190800.1|1174251_1174968_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|1175010_1175400_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|1175405_1175999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|1175995_1177357_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_076852928.1|1177382_1179098_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004190265.1|1179094_1182598_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|1182656_1183016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530792.1|1183038_1183461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|1183685_1184057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967872.1|1184154_1184328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|1184607_1185507_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004199051.1|1185581_1185710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857650.1|1185717_1187037_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_045597683.1|1187033_1188620_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_041220842.1|1188884_1189880_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038724161.1|1190005_1190188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528656.1|1190184_1191768_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004545880.1|1192494_1193748_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009967873.1|1194269_1195934_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
WP_004546670.1|1196066_1197632_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530800.1|1197820_1198837_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|1199304_1200504_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|1200681_1201707_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009923708.1|1201865_1202129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530801.1|1202140_1203415_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004186989.1|1203487_1204459_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|1204609_1205143_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004523137.1|1205203_1207267_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|1207269_1209195_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_071811252.1|1209199_1210372_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|1210368_1211154_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|1211178_1212447_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|1212467_1213613_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|1213722_1214586_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|1214766_1216422_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|1216508_1217384_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_076809203.1|1217527_1218427_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|1218562_1220116_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004535106.1|1220151_1221150_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP018388	Burkholderia pseudomallei strain 2010007509 chromosome 2, complete sequence	3138916	2529838	2558497	3138916	transposase,plate	Agrobacterium_phage(33.33%)	23	NA	NA
WP_004530572.1|2529838_2530300_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_028201330.1|2530336_2532079_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_028201329.1|2532066_2533089_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_085514965.1|2533075_2536132_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.0e-79
WP_009968887.1|2536158_2539182_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	7.1e-23
WP_009981800.1|2539207_2541841_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_085504699.1|2541858_2542923_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_038727444.1|2542919_2543675_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004200966.1|2543703_2544096_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004200965.1|2544105_2544903_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004536933.1|2544935_2546333_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_028201661.1|2546329_2546995_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_085515032.1|2547006_2550984_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_157130524.1|2551076_2551259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085514966.1|2551617_2553066_+	peptidase	NA	NA	NA	NA	NA
WP_076841883.1|2553025_2553271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009940791.1|2553229_2553523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528803.1|2553527_2554160_+	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_157130522.1|2555092_2556076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009949406.1|2556046_2556349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004551886.1|2556782_2557226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557777.1|2557310_2557598_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085515033.1|2557915_2558497_+|transposase	transposase	transposase	NA	NA	NA	NA
