The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	501818	507679	4056450		Burkholderia_virus(57.14%)	9	NA	NA
WP_004527234.1|501818_502052_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004531416.1|502087_502315_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004557051.1|503948_504344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028200808.1|504624_505047_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
WP_028200809.1|505043_505550_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_071810609.1|505891_506494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009920998.1|506500_507226_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_076833215.1|507246_507432_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_004196630.1|507415_507679_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
>prophage 2
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	1032927	1041801	4056450		Tanapox_virus(16.67%)	8	NA	NA
WP_012730421.1|1032927_1033770_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	3.6e-17
WP_004522362.1|1034108_1035032_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_164977834.1|1035210_1036518_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|1036744_1037647_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_004189725.1|1038005_1038323_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004537712.1|1038394_1039387_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009921652.1|1039445_1040369_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004522358.1|1040400_1041801_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
>prophage 3
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	1380085	1389329	4056450		unidentified_phage(16.67%)	7	NA	NA
WP_028201128.1|1380085_1381633_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|1381669_1382197_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|1382193_1382877_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|1382941_1383757_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_085509357.1|1383939_1385946_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.3	1.8e-51
WP_004533593.1|1385979_1387110_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_004533561.1|1387376_1389329_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 4
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	1678437	1734596	4056450	plate,tRNA,integrase,protease	Pseudomonas_phage(28.57%)	47	1682658:1682675	1736609:1736626
WP_004521984.1|1678437_1679736_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|1679802_1680885_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|1680928_1681786_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|1681865_1682174_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|1682188_1682785_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
1682658:1682675	attL	CCGCGTTCTACGCGATGC	NA	NA	NA	NA
WP_004521980.1|1683068_1683857_+	dioxygenase	NA	NA	NA	NA	NA
WP_028200846.1|1684278_1685880_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|1686313_1686517_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_004198059.1|1688595_1689201_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|1689162_1689738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|1689697_1690981_-	MFS transporter	NA	NA	NA	NA	NA
WP_004534987.1|1691139_1691784_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004527819.1|1692121_1692745_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004521971.1|1692829_1693726_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|1693853_1694990_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004545617.1|1694966_1695272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545603.1|1695346_1696465_-	acyltransferase	NA	NA	NA	NA	NA
WP_004545599.1|1696463_1696943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199982.1|1696902_1697406_-	lipoprotein	NA	NA	NA	NA	NA
WP_004204896.1|1698009_1700175_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_009945507.1|1700756_1701155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185238.1|1701230_1701467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|1701569_1701800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967185.1|1702033_1702390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|1702415_1703684_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004521963.1|1703698_1705960_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.2e-36
WP_004199995.1|1705956_1707405_+	TolC family protein	NA	NA	NA	NA	NA
WP_004555447.1|1707614_1708601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199998.1|1708726_1709578_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009967195.1|1709856_1713750_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|1713746_1714736_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004535030.1|1714740_1715673_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|1715871_1716993_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_071810443.1|1717082_1719752_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.8	5.0e-89
WP_004200010.1|1719785_1720886_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004527836.1|1720849_1722688_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004204912.1|1722767_1723250_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|1723307_1723811_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|1723883_1725374_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009967200.1|1725390_1725909_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|1725945_1726617_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|1726992_1727607_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|1727715_1729062_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|1729058_1729844_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_080003363.1|1729930_1730788_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	58.9	2.0e-84
WP_129112226.1|1731181_1731655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527881.1|1734074_1734596_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
1736609:1736626	attR	GCATCGCGTAGAACGCGG	NA	NA	NA	NA
>prophage 5
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	1960164	1971908	4056450	transposase	Stx2-converting_phage(42.86%)	14	NA	NA
WP_004195754.1|1960164_1960809_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
WP_009982077.1|1961593_1962190_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_085504666.1|1962230_1963793_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_017335489.1|1963822_1964170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085509634.1|1964166_1964574_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	36.5	3.1e-14
WP_004525721.1|1964802_1965051_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004530408.1|1965207_1966287_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_009932249.1|1966286_1966739_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_009932250.1|1966996_1967539_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_004530410.1|1967792_1968710_-	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922658.1|1968709_1969027_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_009982080.1|1969564_1969972_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|1969968_1970316_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|1970345_1971908_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
>prophage 6
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	2209017	2279579	4056450	protease,tRNA,transposase	Liberibacter_phage(17.39%)	60	NA	NA
WP_080495655.1|2209017_2210112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076894123.1|2210520_2210718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509432.1|2210714_2212217_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	53.7	2.0e-151
WP_085509659.1|2212306_2213845_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.4	3.6e-140
WP_085509433.1|2213837_2215001_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	47.3	4.0e-43
WP_085509434.1|2214997_2217985_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	39.2	2.7e-192
WP_085509435.1|2217994_2220856_+	chromosome segregation protein SMC	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.7	2.2e-13
WP_085509436.1|2220857_2222126_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_009982080.1|2222280_2222688_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|2222684_2223032_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|2223061_2224624_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_009982077.1|2224664_2225261_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_129112240.1|2225387_2226224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509438.1|2226373_2227591_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	66.8	1.0e-137
WP_085509439.1|2227615_2228374_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	47.4	1.6e-53
WP_085509440.1|2228370_2228895_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	61.6	4.9e-57
WP_004200732.1|2229518_2229923_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004189208.1|2229960_2230830_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004525849.1|2230950_2231967_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189230.1|2232405_2233461_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004525850.1|2233684_2236294_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004190199.1|2236504_2236876_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004525851.1|2236935_2238240_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.2e-21
WP_085509441.1|2238354_2238858_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	9.3e-13
WP_004525853.1|2238889_2239873_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525854.1|2239993_2240629_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004189409.1|2240738_2241596_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_009962382.1|2242115_2243525_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004188929.1|2243521_2244112_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523096.1|2244113_2246522_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004189647.1|2246522_2247206_+	response regulator	NA	NA	NA	NA	NA
WP_004190026.1|2247673_2248408_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_038729300.1|2248501_2249134_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.2	8.1e-06
WP_004189793.1|2249153_2249606_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189570.1|2250026_2250812_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_028201345.1|2250808_2251585_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004525857.1|2251976_2253125_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004525858.1|2253136_2255548_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004523092.1|2255731_2256244_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189331.1|2256240_2257314_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|2257433_2258477_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189769.1|2258842_2259142_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004525859.1|2259254_2260745_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_009962428.1|2260747_2262220_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189747.1|2262346_2263186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190029.1|2263217_2263988_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004531040.1|2264354_2265419_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.1	9.9e-81
WP_004531039.1|2265630_2266575_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004534253.1|2266948_2268001_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004523086.1|2267990_2269304_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004545692.1|2269315_2269930_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004545672.1|2269926_2271072_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004525865.1|2271420_2272113_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198307.1|2272079_2272883_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004200214.1|2272879_2273779_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198312.1|2274103_2274355_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_085503378.1|2274372_2275653_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198315.1|2275672_2276215_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082250115.1|2276655_2278119_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	4.0e-80
WP_025985937.1|2278235_2279579_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	5.3e-39
>prophage 7
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	2639706	2696783	4056450	protease,tRNA,integrase,transposase	Stx2-converting_phage(21.43%)	44	2635688:2635706	2700699:2700717
2635688:2635706	attL	GCTCGCGCGCGGCGGCGCG	NA	NA	NA	NA
WP_004202941.1|2639706_2640312_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004200150.1|2640425_2641040_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_004195243.1|2641203_2642160_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	5.3e-41
WP_004195241.1|2642337_2643219_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004522859.1|2643252_2643876_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004530938.1|2643872_2645693_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004522858.1|2645781_2646612_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_004195232.1|2646616_2647723_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004195230.1|2648116_2648749_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_004530937.1|2648775_2649669_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	4.4e-05
WP_004195225.1|2649754_2650723_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_004534308.1|2650851_2651361_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004195219.1|2651593_2651953_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004195216.1|2652102_2653611_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004195214.1|2653779_2654556_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.2e-22
WP_004195213.1|2654552_2655218_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_085509464.1|2655236_2655851_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_085509465.1|2655856_2656396_-	HAD family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	28.0	8.4e-12
WP_004195206.1|2656395_2657379_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.5	9.9e-43
WP_004522854.1|2657506_2659516_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_020850417.1|2659599_2660163_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.1	1.5e-27
WP_004526063.1|2660256_2660871_+	LysE family translocator	NA	NA	NA	NA	NA
WP_009963293.1|2660883_2661741_+	DUF4743 domain-containing protein	NA	NA	NA	NA	NA
WP_004522850.1|2661792_2662674_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	35.7	4.3e-13
WP_004202932.1|2662972_2664058_-	membrane protein	NA	NA	NA	NA	NA
WP_004537849.1|2664276_2667144_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	2.3e-305
WP_085509466.1|2667356_2668544_+	MFS transporter	NA	NA	NA	NA	NA
WP_085509467.1|2668657_2669224_+	single-stranded DNA-binding protein	NA	C5IHK5	Burkholderia_virus	87.7	2.6e-48
WP_085509662.1|2669672_2669975_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129112242.1|2672254_2672617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112243.1|2672904_2674031_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	4.3e-58
WP_048984163.1|2674614_2675022_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	2.1e-15
WP_049006466.1|2675018_2675366_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	4.3e-41
WP_085509468.1|2675395_2676958_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.1	4.3e-149
WP_048987429.1|2676998_2677595_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.2	2.7e-27
WP_085509469.1|2678306_2680502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509470.1|2680516_2684719_-	helicase	NA	NA	NA	NA	NA
WP_085509664.1|2684705_2687258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509665.1|2687458_2689141_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_085509471.1|2689414_2691268_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_129112244.1|2691264_2691711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112245.1|2691703_2692918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509474.1|2694004_2695261_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_085509475.1|2695244_2696783_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2700699:2700717	attR	CGCGCCGCCGCGCGCGAGC	NA	NA	NA	NA
>prophage 8
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	3048097	3059052	4056450	protease	Streptococcus_phage(16.67%)	10	NA	NA
WP_004197486.1|3048097_3050212_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_004185496.1|3050509_3051019_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_071810810.1|3051210_3051429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503329.1|3051691_3052270_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|3052537_3053797_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_009929279.1|3053769_3053952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536101.1|3053964_3055575_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|3055704_3055908_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|3056440_3056755_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|3056751_3059052_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 9
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	3225362	3285950	4056450	terminase,portal,holin,capsid,tail,protease,head,integrase	Burkholderia_phage(86.49%)	58	3245000:3245020	3286023:3286043
WP_004522511.1|3225362_3225902_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009969854.1|3225999_3227136_-	murein-DD-endopeptidase	NA	NA	NA	NA	NA
WP_004200110.1|3227376_3227601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526357.1|3228057_3228534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509519.1|3230204_3239528_+	contact-dependent inhibition toxin BcpA	NA	A0A0R6PJK4	Moraxella_phage	33.9	1.2e-33
WP_123850157.1|3239524_3239815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543927.1|3239916_3240096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850843.1|3240114_3240339_+	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_004556790.1|3240363_3242121_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004543939.1|3242153_3242351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004541745.1|3242525_3243110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977860.1|3243415_3243571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509520.1|3243621_3244836_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.8	9.6e-88
3245000:3245020	attL	TGGTCCCCCCGACAGGAATCG	NA	NA	NA	NA
WP_085509521.1|3245182_3246193_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	51.2	3.4e-70
WP_085509522.1|3246189_3246495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164977861.1|3248222_3248987_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_129112250.1|3248983_3249349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509672.1|3249360_3250152_-	PRTRC system protein A	NA	NA	NA	NA	NA
WP_085509525.1|3250166_3250880_-	PRTRC system protein B	NA	NA	NA	NA	NA
WP_164977862.1|3250876_3251938_-	PRTRC system protein F	NA	NA	NA	NA	NA
WP_164977863.1|3251934_3252120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509527.1|3252116_3252599_-	PRTRC system protein C	NA	NA	NA	NA	NA
WP_085509528.1|3252613_3253162_-	PRTRC system protein E	NA	NA	NA	NA	NA
WP_085509529.1|3253183_3253474_-	hypothetical protein	NA	Q546W6	Burkholderia_phage	56.7	4.1e-21
WP_085509530.1|3253477_3253684_-	hypothetical protein	NA	C7BGF3	Burkholderia_phage	85.3	5.3e-23
WP_129112251.1|3253813_3254038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509531.1|3254309_3254975_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	44.7	2.0e-31
WP_085509532.1|3255073_3255316_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	47.1	1.1e-06
WP_101633359.1|3255550_3256072_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	63.4	8.3e-49
WP_085509534.1|3256098_3257469_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	61.2	1.6e-152
WP_085509535.1|3257507_3258518_+	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	44.3	1.8e-71
WP_085509536.1|3258530_3258935_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	52.2	9.4e-32
WP_085509537.1|3259377_3259746_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	89.3	1.9e-60
WP_085509538.1|3259940_3260444_+	hypothetical protein	NA	C7BGG6	Burkholderia_phage	92.8	4.8e-86
WP_085509539.1|3260488_3262165_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	96.2	0.0e+00
WP_085509540.1|3262161_3263451_+|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	97.2	2.5e-243
WP_085509673.1|3263416_3264226_+|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	98.5	7.7e-102
WP_085509541.1|3264294_3265560_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	98.1	7.8e-234
WP_085509542.1|3265610_3266195_+	hypothetical protein	NA	C7BGH1	Burkholderia_phage	93.8	1.5e-99
WP_085509543.1|3266205_3266532_+|head	phage head closure protein	head	C7BGH2	Burkholderia_phage	98.1	6.3e-55
WP_085509544.1|3266942_3267284_+	DUF3168 domain-containing protein	NA	Q3HQT5	Burkholderia_phage	74.6	1.8e-39
WP_085509545.1|3267343_3267808_+|tail	phage tail protein	tail	Q4FAS7	Burkholderia_phage	90.9	8.1e-72
WP_085509546.1|3267836_3268304_+|tail	phage tail protein	tail	C7BGC7	Burkholderia_phage	80.0	2.0e-65
WP_085509547.1|3268300_3268579_+	DUF4035 domain-containing protein	NA	Q4FAS6	Burkholderia_phage	92.4	9.9e-41
WP_085509548.1|3268592_3272693_+|tail	phage tail tape measure protein	tail	C7BGC8	Burkholderia_phage	91.3	0.0e+00
WP_085509549.1|3272692_3273031_+|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	94.6	3.2e-57
WP_085509550.1|3274502_3275186_+|tail	phage minor tail protein L	tail	C7BGD1	Burkholderia_phage	89.0	3.8e-118
WP_085509551.1|3275235_3275988_+	C40 family peptidase	NA	C7BGD2	Burkholderia_phage	92.0	1.2e-141
WP_085509552.1|3275984_3276548_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	98.4	2.4e-94
WP_085509553.1|3276544_3280450_+	DUF1983 domain-containing protein	NA	C7BGD4	Burkholderia_phage	96.5	0.0e+00
WP_085509554.1|3280756_3281473_+	hypothetical protein	NA	C7BGD6	Burkholderia_phage	91.6	5.6e-128
WP_085509555.1|3281528_3281813_+|holin	holin	holin	C7BGD7	Burkholderia_phage	97.9	5.0e-40
WP_085509556.1|3281815_3282265_+	peptidase M15	NA	C7BGD8	Burkholderia_phage	91.3	1.9e-70
WP_085509557.1|3282261_3282744_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	84.4	2.6e-65
WP_085509558.1|3282882_3283674_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	89.7	1.8e-140
WP_085509559.1|3283776_3284673_+	hypothetical protein	NA	C7BGE2	Burkholderia_phage	91.6	3.4e-151
WP_085509560.1|3284700_3285192_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	89.6	3.7e-83
WP_085509561.1|3285245_3285950_+	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	73.4	3.2e-104
3286023:3286043	attR	TGGTCCCCCCGACAGGAATCG	NA	NA	NA	NA
>prophage 10
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	3663419	3703179	4056450	integrase,transposase	Stx2-converting_phage(28.57%)	34	3676628:3676644	3704112:3704128
WP_009982077.1|3663419_3664016_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_085509468.1|3664056_3665619_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.1	4.3e-149
WP_049006466.1|3665648_3665996_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	4.3e-41
WP_085509592.1|3666308_3666905_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.7	5.4e-28
WP_085509593.1|3666944_3668507_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.4	1.7e-142
WP_025404693.1|3668536_3668884_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_129112256.1|3668883_3669246_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085509678.1|3669863_3670076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509594.1|3670211_3670442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006397367.1|3672209_3672425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509595.1|3672436_3673432_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.2	3.9e-55
WP_085509596.1|3673501_3673702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509597.1|3673698_3674667_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.3	5.7e-59
WP_059844718.1|3674762_3674990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509598.1|3675791_3676979_+	hypothetical protein	NA	A0A1V0SHS2	Klosneuvirus	23.5	9.5e-24
3676628:3676644	attL	CAAGAACGCCGCGACGA	NA	NA	NA	NA
WP_012492498.1|3677093_3677471_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_085509599.1|3677495_3678068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112259.1|3678069_3678195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105800266.1|3678289_3679412_+|transposase	IS3-like element ISBvi7 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	5.4e-45
WP_085509600.1|3681325_3683437_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.6	4.4e-64
WP_129112260.1|3683448_3684741_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_085509601.1|3684725_3685916_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_045579254.1|3686026_3686824_+	ankryin	NA	NA	NA	NA	NA
WP_129112261.1|3686923_3687961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509602.1|3687973_3688435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977868.1|3689369_3689528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509603.1|3690885_3691152_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_085509680.1|3691588_3691903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977869.1|3695946_3697068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112262.1|3697064_3698519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071810706.1|3700111_3700540_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_004521809.1|3700717_3701431_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.3	1.5e-32
WP_164977870.1|3701439_3702033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112243.1|3702052_3703179_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	4.3e-58
3704112:3704128	attR	TCGTCGCGGCGTTCTTG	NA	NA	NA	NA
>prophage 11
NZ_CP018410	Burkholderia pseudomallei strain 3000015237 chromosome 1, complete sequence	4056450	3929873	4001055	4056450	tRNA,integrase,transposase	Stx2-converting_phage(25.0%)	56	3957789:3957806	4003908:4003925
WP_038718503.1|3929873_3930809_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004193982.1|3931078_3932638_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004521673.1|3932660_3933896_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_028201109.1|3933963_3935460_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192835.1|3935559_3936057_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191941.1|3936256_3936397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193111.1|3936349_3938176_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004526855.1|3938514_3941379_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004526856.1|3941513_3942791_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004534933.1|3942890_3944321_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.4e-42
WP_085509688.1|3944427_3945525_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191720.1|3945719_3946130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004526860.1|3946366_3946828_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004550550.1|3947071_3948751_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004521664.1|3948901_3950167_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004550548.1|3950216_3951806_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004521661.1|3952443_3952641_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_004521660.1|3952723_3953224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193213.1|3953220_3953688_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024430415.1|3953767_3954667_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_004192085.1|3954730_3956056_+	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_004193624.1|3956122_3957361_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004521658.1|3957364_3958708_+	CpaF family protein	NA	NA	NA	NA	NA
3957789:3957806	attL	CGATCGGCCGCCGGCTCG	NA	NA	NA	NA
WP_085509627.1|3958700_3959699_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_004545233.1|3959704_3960715_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_004550545.1|3960751_3961687_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_038787156.1|3961708_3962104_+	DUF3613 domain-containing protein	NA	NA	NA	NA	NA
WP_004526869.1|3962111_3963920_+	membrane protein	NA	NA	NA	NA	NA
WP_009966349.1|3963936_3965328_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531212.1|3965418_3966132_+	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_004547026.1|3966282_3966927_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_004521652.1|3967231_3967504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017882207.1|3967679_3968678_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_004199468.1|3968698_3970471_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.9	6.6e-37
WP_004526875.1|3970655_3971606_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192776.1|3971822_3973049_-	MFS transporter	NA	NA	NA	NA	NA
WP_004192889.1|3973460_3974015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193730.1|3974152_3974779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192099.1|3974825_3976538_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_004545114.1|3976942_3978529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193117.1|3978765_3980253_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_004191606.1|3980786_3982499_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	8.3e-13
WP_085509628.1|3982908_3983235_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_085509629.1|3983231_3986174_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	30.6	8.0e-80
WP_085509630.1|3986170_3987484_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085509631.1|3987470_3989303_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	29.4	1.2e-54
WP_085509632.1|3989480_3991502_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085509633.1|3991498_3992644_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_129112265.1|3992653_3993007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085509634.1|3993127_3993535_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	36.5	3.1e-14
WP_017335489.1|3993531_3993879_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|3993908_3995471_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_009982077.1|3995511_3996108_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_129112266.1|3996144_3997065_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	40.5	1.7e-44
WP_085509635.1|3997103_3997886_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	45.0	1.7e-50
WP_004550537.1|3998616_4001055_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.6	1.5e-68
4003908:4003925	attR	CGATCGGCCGCCGGCTCG	NA	NA	NA	NA
>prophage 1
NZ_CP018411	Burkholderia pseudomallei strain 3000015237 chromosome 2, complete sequence	3263237	930727	996291	3263237	transposase,plate	Acanthocystis_turfacea_Chlorella_virus(14.29%)	41	NA	NA
WP_004530163.1|930727_932131_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004529328.1|932146_933463_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_085504612.1|933465_937095_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_164977913.1|937076_938042_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|938026_938254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503058.1|938252_940865_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_009982092.1|940904_941984_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|942046_942625_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|942617_944126_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|944185_944677_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009935240.1|944695_945244_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004524812.1|945248_947120_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004537556.1|947116_948562_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004533146.1|948574_951241_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_085508262.1|951237_953442_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	1.3e-45
WP_164977887.1|954916_955339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085509797.1|955354_956623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977914.1|956609_961268_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_085510113.1|961859_962123_+	putative Immunity protein 75	NA	NA	NA	NA	NA
WP_071811406.1|962123_962321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112169.1|971839_972145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811408.1|972112_972478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509798.1|972726_974481_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004539275.1|974694_975423_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004536963.1|975517_976489_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004529289.1|976495_976915_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_085509799.1|976928_978782_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_009969385.1|978778_979804_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004544778.1|979844_980885_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_085509800.1|980881_981817_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009927010.1|981829_982114_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_004548868.1|982139_983174_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_025986259.1|984160_985822_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	3.5e-32
WP_009969379.1|986184_987069_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_004540584.1|987104_989111_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_085504620.1|989107_989950_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004529278.1|989956_991108_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_009982064.1|991120_992737_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_004529276.1|992738_993599_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	7.1e-13
WP_009969373.1|993925_995098_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_080495655.1|995196_996291_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018411	Burkholderia pseudomallei strain 3000015237 chromosome 2, complete sequence	3263237	2830100	2889304	3263237	transposase,tail,plate,head,terminase,capsid,portal	Burkholderia_virus(10.81%)	85	NA	NA
WP_085509998.1|2830100_2830868_-	recombinase	NA	K7ZRM9	Xanthomonas_citri_phage	23.7	3.5e-11
WP_085509999.1|2832969_2833152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112310.1|2833148_2833388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130333.1|2833470_2833629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112311.1|2833625_2833943_-	DUF2528 family protein	NA	Q6QIE6	Burkholderia_phage	32.0	2.5e-08
WP_085510001.1|2833939_2834143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510002.1|2834142_2834412_-	hypothetical protein	NA	F8WPQ1	Bacillus_phage	52.3	8.7e-18
WP_085510003.1|2834421_2834637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112312.1|2834950_2835190_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_164977941.1|2835186_2835345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112313.1|2835475_2835757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510005.1|2835911_2836202_-	hypothetical protein	NA	I6X6S0	Burkholderia_virus	64.9	9.4e-26
WP_129112314.1|2836201_2836531_-	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	76.3	3.7e-18
WP_085509634.1|2836776_2837184_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	36.5	3.1e-14
WP_017335489.1|2837180_2837528_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|2837557_2839120_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_009982077.1|2839160_2839757_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_085510147.1|2840108_2840348_-	hypothetical protein	NA	Q6V7Q4	Burkholderia_virus	75.0	2.1e-15
WP_085510007.1|2840371_2841568_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	41.9	7.6e-13
WP_085510008.1|2841564_2841753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157129866.1|2841749_2841887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510009.1|2841888_2842167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164977942.1|2843090_2843252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112316.1|2843379_2843577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510010.1|2843539_2843725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129112317.1|2844149_2844548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510011.1|2844626_2844848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112318.1|2845050_2845443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510013.1|2845439_2845637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112319.1|2846208_2846814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510015.1|2846813_2848313_+	DEAD/DEAH box helicase	NA	A0A2I7RTF8	Vibrio_phage	37.5	5.1e-83
WP_129112320.1|2848299_2848956_+	hypothetical protein	NA	A0A0U1WFE9	Staphylococcus_phage	41.1	6.4e-30
WP_085510148.1|2848945_2849839_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	37.7	4.5e-50
WP_085510016.1|2850014_2850365_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	67.6	2.7e-35
WP_164977943.1|2850373_2850832_+	HNH endonuclease	NA	H9YT15	environmental_Halophage	38.3	1.0e-18
WP_085510018.1|2850833_2851514_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085510019.1|2851510_2851792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112321.1|2851831_2852305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112322.1|2852669_2853002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510022.1|2852998_2853310_+	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	44.8	9.1e-19
WP_129112323.1|2853306_2853789_+	hypothetical protein	NA	A0A2D2W3E4	Mycobacterium_phage	57.4	2.2e-35
WP_129112324.1|2853812_2854013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112325.1|2854009_2854378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977944.1|2854374_2854551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510025.1|2854547_2854964_+	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	47.4	3.8e-28
WP_164977945.1|2854960_2855107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510149.1|2855381_2855660_+	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	62.5	1.6e-22
WP_085510026.1|2855656_2856382_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	50.7	4.9e-63
WP_164977946.1|2856378_2856537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112326.1|2856533_2856725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112327.1|2856721_2856913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112328.1|2856909_2857305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510028.1|2857297_2857813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112329.1|2857907_2858270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112330.1|2858875_2859055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510029.1|2860699_2861188_+	hypothetical protein	NA	A5H1K2	Xanthomonas_virus	57.3	9.9e-20
WP_085510030.1|2861416_2862586_+	winged helix-turn-helix domain-containing protein	NA	A0A1P8L636	Pectobacterium_phage	53.2	3.0e-107
WP_085510031.1|2862692_2863400_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_085510032.1|2863396_2863579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510033.1|2863672_2864371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112331.1|2864608_2865262_+	hypothetical protein	NA	B0VK26	Azospirillum_phage	43.3	1.0e-19
WP_129112332.1|2865346_2865955_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	24.7	2.4e-07
WP_085510035.1|2865890_2868017_+|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.6	8.0e-98
WP_085504266.1|2868061_2868289_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_085504265.1|2868357_2869923_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	34.8	5.5e-88
WP_085510036.1|2869919_2870801_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	39.9	9.8e-50
WP_085503778.1|2872621_2873683_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.3	2.9e-48
WP_085510038.1|2873970_2874300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085510039.1|2874296_2874941_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_085503775.1|2874951_2875128_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_085510040.1|2875124_2876606_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.9	2.2e-102
WP_085504264.1|2876657_2877026_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_085503773.1|2877027_2877312_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_085510041.1|2877430_2879281_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_085510042.1|2879277_2880735_+	DNA circulation family protein	NA	U5P4I0	Shigella_phage	22.1	1.5e-18
WP_085503770.1|2880737_2881133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510043.1|2881156_2882248_+	Mu P family protein	NA	M1PVV2	Vibrio_phage	29.9	2.7e-33
WP_085503768.1|2882244_2882844_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	37.3	2.7e-19
WP_085503767.1|2882840_2883287_+	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	38.1	2.8e-21
WP_085510044.1|2883286_2884408_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	28.2	3.1e-16
WP_085510045.1|2884416_2885064_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_085510150.1|2885345_2886050_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	71.7	2.3e-81
WP_129112333.1|2886059_2886245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164977947.1|2886237_2886849_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_129112334.1|2887000_2889304_+	hypothetical protein	NA	I6X6U1	Burkholderia_virus	43.3	1.5e-12
>prophage 3
NZ_CP018411	Burkholderia pseudomallei strain 3000015237 chromosome 2, complete sequence	3263237	3069749	3137556	3263237	plate,holin	Aeromonas_phage(25.0%)	49	NA	NA
WP_004530063.1|3069749_3070700_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|3070967_3071912_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530060.1|3072383_3074087_+	thermolysin metallopeptidase	NA	NA	NA	NA	NA
WP_004545903.1|3074204_3075431_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|3075485_3076628_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|3076736_3076859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530058.1|3076855_3077893_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_025986125.1|3077889_3079443_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004554841.1|3079605_3080478_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|3080621_3081497_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004530057.1|3081583_3083239_-	APC family permease	NA	NA	NA	NA	NA
WP_004186918.1|3083419_3084283_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085510065.1|3084392_3085538_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004535147.1|3085558_3086800_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|3086851_3087637_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523138.1|3087633_3088806_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186901.1|3088810_3090736_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004523137.1|3090738_3092802_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|3092862_3093396_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186989.1|3093546_3094518_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004530801.1|3094590_3095865_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004198247.1|3096298_3097324_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|3097501_3098701_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004530800.1|3099146_3100163_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004546670.1|3100351_3101917_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_009967873.1|3102049_3103714_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
WP_004186853.1|3104281_3105535_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004528656.1|3106261_3107845_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_038724161.1|3107841_3108024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186828.1|3108149_3109145_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_045597683.1|3109415_3111002_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162483310.1|3112206_3112509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|3112550_3113450_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004536812.1|3114000_3114276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530792.1|3114596_3115019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|3115041_3115401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085510067.1|3115459_3118963_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_045597681.1|3118959_3120618_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004525552.1|3120700_3122062_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530042.1|3122058_3122652_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004190606.1|3122657_3123047_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004190800.1|3123089_3123806_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|3123808_3124879_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004547074.1|3124878_3127095_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|3127098_3129387_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_085510068.1|3129552_3131844_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004525547.1|3131834_3134705_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004190851.1|3134707_3135697_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|3135693_3137556_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
